Microbiological Evaluation and Molecular Discrimination of Milk Samples from Humans and Different Animals Текст научной статьи по специальности «Животноводство и молочное дело»

2022, Scienceline Publication

Worlds Veterinary Journal

World Vet J, 12(1): 09-18, March 25, 2022

DOI: https://dx.doi.org/10.54203/scil.2022.wvj2

Microbiological Evaluation and Molecular Discrimination of Milk Samples from Humans and Different Animals

Azza Sayed Mohammed Abuelnaga1, Nagwa Sayed Ata1, Khaled Abd El-Hamid Abd EL-Razik2, Riham Hassan Hedia1, Mona Mohamed Hassan Soliman1 , Mai Mohamed Kandil1, Elgabry Abd-Elalim Elgabry1, and Amany Ahmed Arafa1

'Department of Microbiology and Immunology, National Research Centre, Giza, Egypt 2Department of Animal Reproduction, National Research Centre, Giza, Egypt

"•"Corresponding author's Email: mona_nrc.micro@yahoo.com; : 0000-0003-0871-0632

ABSTRACT

Milk is a highly nutritious food and it is important to be free of any pathogenic microbes that could be transmitted to humans and affect public health. A total of 145 milk samples were collected from humans and different animal species (cow, buffalo, ewe, goat, camel, mare, and donkey) and underwent physical examination (color, odor, and taste), chemical analysis for its components (water, total salt, fat, protein, lactose, and ash), and finally microbiological (bacteriological and mycological) examinations. Standard plate count, preliminary incubation count, lab pasteurized count, coliform, Escherichia coli, Staphylococcus species, Salmonella species, yeast, and mold counts were measured. PCR test was performed to differentiate milk from different sources (animals and humans) by producing a specific band for each milk type. The results of the physical examination of different kinds of milk showed different grades of white color with the characteristic odor and taste of each milk type. Chemical examination revealed that the highest water content was in donkey milk and the lowest was in buffalo milk while total solids indicated the highest content in sheep milk and the lowest in donkey milk. The microbiological analysis presented that the standard plate count results were the highest in the milk obtained from sheep and camel, while donkey milk was the least in this regard. Yeast counts were the highest in buffalo milk but cow milk was the highest in mold counts. PCR results of milk types using species-specific primers and DNA template extracted from milk somatic cells revealed a specific band for each milk type as 157, 195, 225, 242, 274, and 711 base pair (bp) for goat, human, sheep, buffalo, cattle milk, and camel milk, respectively. It was concluded that more restrictions must be applied to decrease milk contamination as high microbial counts detected in the present study can affect milk quality, public health, and the dairy industry. PCR used in the current work for milk discrimination used milk somatic cells specifically mitochondrial cytochrome b gene which exhibited high specificity in the PCR reactions and this could be served as a cheap and simple method, compared to other types of PCR.

Keywords: Bacterial count, Fungal count, Milk, PCR INTRODUCTION

Milk serves the nutritional and physiological needs of the offspring. It is high-quality nourishment and a nearly complete human food that can be consumed without any processing steps (Mehta, 2015; Roy et al., 2020). Milk microbial constituents (bacteria and fungi) vary and originate from different sources of defilement, such as the udder skin, milking utensils cleanliness, water, air, animal feed, grass, housing circumstances, fecal matter, and soil (Quigley et al., 2013; Machado et al., 2017).

Pathogenic bacteria present in milk is often considered as a major public health concern, especially for immunocompromised individuals. Keeping fresh milk at a high temperature together with unhygienic practices during the milking process may also result in low-quality milk (Chatterjee et al., 2006). Many milk-borne diseases are transferable to humans through raw or unpasteurized milk consumption (Parekh and Subhash, 2008).

Bacterial counts are determined in raw milk before processing, and their results express the health condition of the mammary gland. Hygiene demands for animals in production herds prevent milk collection from ill animals. Non-hygienic circumstances create serious hazards for customers' health because microbiologically infected raw milk constitutes a source of pathogenic microbes and milk-borne illnesses for humans. The existence of milk-borne diseases is more common in the population consuming raw milk than in those consuming pasteurized milk (Pyz-Lukasik et al., 2015). Raw milk is mainly considered as a perfect growth medium for microbes, including many fungal elements, as raw milk contains all essential nourishments and circumstances that support their growth (Gulbe and Valdovska, 2014). Several studies assured that yeasts and molds can contaminate milk from various sources as ambient air and farmworkers. In most cases, yeasts are the most common, but in some ecosystems, molds are predominant, indicating that the relative proportions of yeasts and molds can differ significantly (Lavoie et al., 2012). Many different methods have been used for the identification of species, including chromatographic (Pellegrino et al., 1991), immunological (Addeon et al., 1995), electrophoretic (Cartoni et al., 1998), reversed-phase high-performance liquid chromatography, and ELISA (Haasnoot et al., 2014), as well as chemical methods (Makadiya and Pandey, 2015).

9

ISSN 2322-4568

A R

c n

c c

e i

p v

e ft

: :

2 O

OO OC

F a

b U

2 C 0 2 2 2 2

0

1 —

G

HH

2 A L

A R

T —

C L E

Recently, molecular approaches have been used for species discrimination, and it has been recommended due to its simplicity, sensitivity, repeatability, and reproducibility (Bottero et al., 2003). PCR method has been successfully used to identify different meats from domesticated animals and meat products (Abd El-Razik et al., 2019; Abuelnaga et al., 2021). Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay is one of the recent molecular techniques which can be applied for the differentiation of various types of milk. Besides, PCR-RFLP has a lower cost in comparison with other methods, such as real-time PCR (Abdel-Rahman, 2017; Abd El-Razik et al., 2019). The cytochrome b gene was reported to be highly polymorphic and could be used to differentiate the buffalo from cow species (Bellagamba et al., 2001).

The aim of the present study was to investigate the microbial diversity of raw milk from human and different animal species. In this regard, PCR was used to make a differentiation between milk species from humans and those of different animal species. The result of the present study could have an important impact on improving the quality of the raw milk and dairy product industry.

MATERIALS AND METHODS

Ethical approval

The current work was approved by the Medical Research Ethics Committee, National Research Centre, Egypt (19156).

Sampling

A total of 145 milk samples, including 5 milk samples from humans (according to guidelines described by Lovelady et al., 2002) and 20 samples from each animal species from Baladi breeds (cow, buffalo, sheep, goat, camel, donkey, and horse) were collected from June 2020 to June 2021. Milk samples were examined physically (color, odor, and taste), chemically, and microbiologically and the results were recorded.

Chemical analysis of milk samples

Milk samples collected from humans and different animal species (cow, buffalo, camel, ewe, goat, mare, and donkey) underwent chemical analysis according to Mehta (2015).

Microbiological evaluation of milk

Bacterial counts of microorganisms in milk

The examined milk samples were subjected to standard plate count, preliminary incubation count (psychrotrophs), Lab pasteurized count (in a water bath at 77.6°C for 30 seconds), and coliform count at the NRC laboratory, Egypt, according to the methods described by Martin et al. (2011).

Detection of microorganisms in milk

Detection of different microbial contaminants present in milk was conducted as previously performed by Quinn et al. (2011).

Escherichia coli count

Escherichia coli (E. coli) was identified and confirmed by colony morphology on eosin methylene blue agar (EMB) (Oxoid company) and performing biochemical tests according to Bergey and Holt (1994).

Staphylococcus count

According to the plate count technique of APHA (1992), Staphylococcus aureus was counted using the direct plate count method on Baird Parker agar enriched with egg yolk tellurite emulsion (Oxoid company) (Lancette and Bennett, 2001).

Salmonella count

Isolation and quantification of Salmonella were carried out using the method described by Quinn et al. (2002). The samples were enriched by inoculating a sterile swab from milk sample into 5 ml of Rappaport Vassiliadis broth (Sigma-Aldrich, Inc., USA) and incubated at 37°C for 24 hours. Then, a loopful of enriched Rappaport-Vassiliadis broth was streaked onto xylose lysine desoxycholate (XLD) agar (Oxoid Ltd., Basingstoke, Hampshire, England) and incubated at 37°C for 24 hours. The colonies were examined for the characteristic red colonies with the black center of Salmonella with or without hydrogen sulfide. In the next step, several biochemical tests were performed following the standard protocol (Cappuccino and Sherman, 1996).

Fungal count in milk samples

The milk samples were serially (102 to 106) diluted in sterile 0.1% (w/v) peptone solution, then tenfold serial dilutions were performed for counting of fungi under complete aseptic conditions (Lavoie et al., 2012). In the next step, 1 ml of the prepared milk dilutions was added into a petri dish in duplicate. Then, 10-20 ml molten sabouraud dextrose agar (SDA, cooled to 42-45°C) were poured into each petri dish. The media and the dilutions were blended by whirling

10

gently clockwise and anti-clockwise and were left until solidification at room temperature (Soliman et al., 2019). Cultured plates were put upside down to prevent contamination and they were kept in an incubator at 25°C for 3 -5 days. Yeast colonies that were defined by being creamy, dull-white, pink, yellow, regular, and irregular patterns were counted utilizing a colony counter and yeast count/gram was estimated and recorded. Moreover, for mold count, the plates were kept at 250C for 5-7 days at a reversed position. Amid the incubation time, the plates were inspected routinely for the characteristic star-shaped mold structure, and colonies were numbered and indexed (APHA, 1992).

Polymerase chain reaction

DNA extraction

Milk samples (25 ml) from each milk type were gathered from cattle, buffalo, sheep, goat, camel, horse, donkey, and human, and centrifuged at 2200 g for 5 minutes for sedimentation of milk specimen. Then, 1 ml of the sediment was re-mixed with 200 pl TE (1 mM EDTA, 10 mM Tris-HCl (pH = 7.6), and 300 pi 0.5 M EDTA, pH = 8), and centrifuged at 3000 g for 10 minutes to prevent blocking by casein (Murphy et al., 2002; Psifidi et al., 2010). Milk pellet was then diluted in 200 pl of phosphate-buffered saline and DNA was extracted using GF-1 Tissue DNA extraction kit (Cat.-No.GF-TD-050, Vivantis Co., Malaysia) according to the company instructions with elution of DNA in 50 pL of elution buffer, then DNA was stored at -20°C until use.

Polymerase chain reaction

The reaction was applied in 25 pl reaction volume containing 12.5 pl of 2 x COSMO PCR RED Master Mix (Cat. W1020300X, Willofort Co., UK.), 1 pl (0.1 mM) of each primer, 9.5 pl of Double distilled water, and 1 pl of the purified DNA. The reaction steps composed of one cycle of 95°C for 2 minutes taken after 35 cycles of 95°C for 1 minute, annealing for 30 seconds (Table 1), 72°C for 45 seconds, and the final extension at 72°C for 10 minutes (GS-96 gradient thermocycler, Hercuvan, Malaysia). The amplification PCR products were visualized by 1.5% agarose gel electrophoresis colored with ViSafe Red Gel Stain, Vivantis Co., Malaysia). PCR products and 100 bp DNA ladder were electrophoresed at 100 V and examined using InGenius3 gel documentation system (Syngene, UK).

Statistical analysis

Results were measured statistically for descriptive analysis (mean, maximum, minimum, and standard error) utilizing SPSS 14.

Table 1. Species-specific PCR primers for the amplification of human, cattle, buffalo, sheep, goat, camel, horse, and donkey milk samples in Egypt during 2020-2021_

Species Sequence 5'- 3' Annealing temperature PCR product Reference

Cattle (Forward) GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA 60°C 274bp Matsunaga et al. (1999)

(Reverse) CTAGAAAAGTGTAAGACCCGTAATATAAG

Buffalo (Forward) TAGGCATCTGCCTAATTCTG (Reverse) ACTCCGA TGTTTCATGTTT CT 61°C 242bp Rajapaksha et al.(2003)

Sheep (Forward) TTAAAGACTGAGAGCATGATA 58°C 225bp Ilhak and Arslan (2007)

(Reverse) ATGAAAGAGGCAAATAGATTTTCG

goat (Forward) GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA (Reverse) CTCGACAAATGTGAGTTACAGAGGGA 58°C 157bp Matsunaga et al. ( 1999)

Camel (Forward) ACCACATTTCAACTATTTCAAAACCG 61°C 711bp Deng et al. (2020)

(Reverse) ATGTACGGCTGCGAGGGCGGTAA

Horse (Forward) CTATCCGACACACCCAGAAGTAAAG 61°C 153bp Kesmen et al. (2010)

(Reverse) GATGCTGGGAAATATGATGATCAGA

Donkey (Forward) ATCCTACTAACTATAGCCGTGCTA 57°C 145bp Kesmen et al. (2007)

(Reverse) CAGTGTTGGGTTGTACACTAAGATG

Human (Forward) CAGCAGCCATTCAAGCAATGC 60°C 195bp Kapoor et al. (2013)

(Reverse) ATCGGTGGGTTAAGTTTATTAAGTGT

RESULTS AND DISCUSSION

Milk is a great microbial growth medium when the temperature is optimum. It is easily contaminated and spoiled in case it is processed in an unsanitary manner. Many milk-borne outbreaks of human illnesses have spread due to the contamination of milk by unclean dairy employees' hands, unclean utensils, flies, and contaminated water supplies (Oliver et al., 2005).

Physical examinations of milk specimens were performed in the current study and the results indicated different grades of white color with the specific odor and taste for each type of milk (Table 2). The chemical analysis presented the average composition of different milk specimens (Table 3). In the present work, the milk samples contained water content of 88, 83, 80.6, 86, 87.8, 87.4, 90.9, and 89% in cow, buffalo, sheep, goat, camel, human, donkey, and horse milk, respectively. However, Mehta (2015) obtained 84.2, 86.3, 83.7, 86.5, 87.61, and 87.43% in buffalo, cow, sheep,

11

goat, camel, and human milk, respectively. Total solids in the current study were 12.35, 16.5, 17.5, 12.8, 12.1, 12.5, 11.5, and 13.8% in cow, buffalo, sheep, goat, camel, human, donkey, and horse milk, respectively, but Park and Haenlein (2006) and Guha et al. (2021) showed 14.4, 12.1, 16.3, 10.2 and 11% in camel, goat, sheep, donkey, and mare milk, respectively.

These differences in constituents of different types of milk components may be due to nutritional, genetic, and environmental variables that influence both major and minor components. The composition of milk also influences its suitability as a raw material for various dairy products, as well as its nutritional value and organoleptic and physicochemical properties (Alichanidis et al., 2016). According to the pasteurized milk ordinance standard, the maximum bacterial count in raw milk is 105 cells per ml. Several studies have also shown a high total bacterial count in milk samples. The high count may be due to milk handling and contamination from animal bedding and these results match with the current study in standard plate count results. The present work revealed that goat milk was the highest in standard plate count while camel milk was the least (Hayes et al., 2001; Muhammad et al., 2009; Lingathurai and Vellathurai, 2010). Minj and Behera (2012) observed that in cow's milk the average total viable count of rural milk specimens was 8.257 ± 0.937 log CFU/ml and that of the urban milk specimens was 8.756 ± 0.803 log CFU/ml. Nearly similar counts were also obtained concerning the preliminary incubation counts of rural and urban milk specimens. The mean counts of preliminary incubation values in rural specimens were 8.522 ± 0.929 log CFU/ml and the urban specimens were 8.889 ± 0.424 log CFU/ml. Moreover, for lab pasteurized count (LPC), the average bacterial load of the rural specimen was 8.083 ± 0.081 log CFU/ml and that of the urban milk specimen was 7.500 ± 0.739 log CFU/ml. Lower results were reported by Massouras et al. (2020) as they reported that the total aerobic mesophilic and psychrotrophic counts ranged 2.18-2.71 log CFU/ml and 1.48-2.37 log CFU/ml, respectively.

The bacterial counts in different types of milk are presented in Table (4). The preliminary incubation count provides a more accurate picture of psychrophilic (cold-loving) bacteria and the quality of cleanliness on the farm. Before making any conclusions, the preliminary incubation count should always be compared to the Total viable count of the fresh and un-incubated samples. According to the American Public Health Association (APHA, 1992), the highest allowed preliminary incubation count is 200000 CFU/ml, however, counts as low as 50000 CFU/ml are still possible. The preliminary incubation count in the current work is considered within the permissible limit. The highest preliminary incubation count was in goat milk and the least was in ewe milk.

The LPC is frequently used to assess the efficacy of farm hygienic conditions providing the relative number of organisms that may survive in the pasteurized milk specimen. Lab pasteurized counts in warmed milk were significantly lower than standard plate counts. Counts more than 300 CFU/ml are indicative of a source of contamination. Elevated LPC values are typically associated with chronic or repeated cleaning problems; the bacteria isolated from the LPC can survive pasteurization, but most of them cannot reproduce in refrigeration temperature and remain static, and some even vanish (Murphy and Carey, 2007). The results showed that the highest lab count was in goat milk while the least was in camel milk. Moreover, a high bacterial count was in goat milk and it was indicative of high contamination.

The absence of most pathogenic bacteria in camel milk might be due to the activity of protective proteins (Lysozyme, Lactoferrin, Lactoperoxidase, Immunoglobulin G and A) of camel milk. As reported by Barbour et al. (1984) and El-Agamy (1992), camel milk lysozyme (LZ) was effective against Salmonella. Lactoperoxidase was bacteriostatic against the Gram-positive strains and showed a bactericidal effect against Gram-negative cultures. Coliforms are considered typical flora of human and animal digestive tracts and several milk-borne outbreaks of human illness have been propagated. They have been employed as bacteriological quality indicators for milk and its products (Chatterjee et al., 2006). In the present work, the coliform count showed the highest value in donkey milk samples 1.1 x 103 ± 2.4 x 102 and the least load was in camel milk 8.9 x 10 ± 2.2 x 10, while the highest E. coli value was observed in buffalo milk 8.5 x 10 ± 0.5 x 10 and the least was in cow milk 2 x 10 ± 0.4 x 10. Staphylococcus (Staph) species showed the highest count in goat milk 4.6 x 103 ± 1.7 x 103 and the least count in sheep milk as 2.36 x 102 ± 0.66 x 102. Minj and Behera (2012) recorded in cow's milk higher values of the enteric count, while Adugna and Eshetu (2021) showed a lower count in the coliform count.

Table 2. Physical examination of different milk samples from animals and humans in Egypt during 2020-2021

Species Color Odor Taste

Human Little white Normal Sweet

Cow Yellowish white Characteristic fresh Sweet

Buffalo Creamy white Characteristic fresh Sweet bitter

Sheep Bright white Freshly milk sheepy flavor Creamy sweet

Goat Very white Characteristic odor of freshly milk goat Viscous sweet

Camel Very white Freshly milk camel Salty due to vitamin C

Donkey White Good palatable Very sweet due to lactose

Horse White Good palatable Very sweet due to lactose

Table 3. Chemical analysis of different milk samples from animals and humans in Egypt during 2020-2021

Milk Water (%) Total solids (%) Fat (%) Protein (%) Lactose (%) Ash (%)

Human 87.4 12.5 1.8 1.9 7.1 0.2

Cow 88 12.35 3.8 3.7 4.6 0.7

Buffalo 83 16.5 6.8 4.2 4.9 0.8

Sheep 80.6 17.5 7.4 5.5 4.7 0.9

Goat 86 12.8 4.4 3.9 4.1 0.8

Camel 87.8 12.1 3.0 2.5 1.3 0.7

Donkey 90.9 11.5 1.4 2.0 6.9 0.4

Horse 89 13.8 1.9 2.5 6.8 0.3

Table 4. The bacterial count in different types of milk in Egypt during 2020-2021

Cow

Buffalo

Camel

Sheep

Goat

Horse

Donkey

Human

Standard plate count

Minimum Maximum Mean±SE

2 x 103 8 x 106

1.6x106 ± 0.52 x 106

1 x 104 6 x 106

1.17 x 106 ± 0.39 x 106

2 x 104

4 x 106 8.9 x 105 ± 2.7 x 105

1 x 104 6 x 106

8.9 x 105± 3.3 x 105

1 x 104 6 x 107 8.6 x 106± 3.2 x 106

8 x 102 1 x 107

1.3 x 106 ± 0.57 x 106

8 x 102 1 x 102

6 x 106 3 x 103

1.1 x 106 ± 0.41 x 106 1.3 x 102 ± 5.6 x 102

Preliminary incubation

Minimum Maximum Mean±SE

1x 102

3x105

2.5x104 ± 1.4x104

1 x 102 8 x 104

2.3 x 104± 6.6 x 103

1 x 102 8 x 104

7.9 x 103 ± 4.09 x 103

1 x 102

2 x 104

2.7 x 103 ± 1.02 x 103

1 x 102

2 x 106

1.02x105±9.9x104

1 x 102 4 x 104

3.8 x103 ± 1.9 x 103

100 8 x 104

5.5 x 103 ± 3.9 x 103

6 x 10 1.1 x 102

9.4 x 10 ± 0.9 x 10

Lab pasteurized

Minimum Maximum Mean±SE

100 4 x 103 2.9 x 102± 2 x 102

100 1 x 103

1.3 x 102± 0.5 x 102

100 3 x 102 0.4 x 102± 0.18 x 102

100 3 x 103 2.9 x 102 ± 1.49 x 102

100 2 x 104

1.7 x 103 ± 1.08 x 103

100 8 x 102

0.8 x 102 ± 0.4 x 102

100 3 x 103 1.9x102 ± 1.4 x 102

Coliform

Minimum Maximum Mean±SE

3

1.1 x 103

9.7 x 10 ± 5.3 x 10

90 7 x 103 9.29 x 102 ± 3.8 x 102

95 4 x 102 8.9 x 10 ± 2.2 x 10

10 1 x 103

1.3 x 102 ± 0.52 x 102

9

9 x 104 4.9 x 103± 4.4 x 103

10 1 x 103 1.8 x 102 ± 0.6 x 102

100 5 x 103 1.1 x 103 ± 2.4 x 102

0

5 x 10 10 ± 10

Escherichia coli

Minimum Maximum Mean±SE

2

9.3 x 10 2 x 10 ± 0.4 x 10

20 100

8.5 x 10 ± 0.5 x 10

40

1 x 102

2.7 x 10 ± 0.8 x 10

12 100

3.7 x 10 ± 0.9 x 10

9 100

6.9 x 10 ± 0.8 x 10

20 2 x 102

5.9 x 10 ± 1.1 x 10

50

1 x 102

5.3 x 10 ± 0.9 x 10

Staphylococcus species

Minimum Maximum Mean±SE

1 x 102 1 x 104

1.7x103 ± 5.8x102

1 x 102 9 x 103 2.7 x 103 ± 7.8 x 102

8 x 10 1 x 103

2.5 x 102 ± 0.66 x 102

9

1 x 103

2.36 x 102 ± 0.66 x 102

1 x 102 3 x 104 4.6 x 103 ± 1.7 x 103

100 3 x 103 5.05 x 102 ± 1.7 x 102

100 0 9 x 103 10

1.3 x 103 ± 5.4 x 102 0.2 x 10 ± 0.2 x 10

Mean ± SE: Mean ± standard error

__13

ItBHBBPeB Abuelnaga ASM, Ata NS, Abd EL-Razik KhA, Hedia RH, Soliman MMH, Kandil MM, Elgabry EA, and Arafa AA (2022). Microbiological Evaluation and Molecular Discrimination of Milk Samples from Humans and Different Animals. World Vet. J., 12 (1): 09-18. DOI: https://dx.doi.org/10.54203/scil.2022.wvj2

In Buffalo milk, similar results in the coliform count were obtained by Gurler et al. (2013) as they recorded mean values of 2.95 ± 0.21 log10 cfu/ml and nearly equal counts in Staph species count (2.46 ± 024 log10 cfu/ml) and lower count in E. coli (1.10 ± 0.17 log10 cfu/ml). However, Han et al. (2007) recorded lower coliform and Staph species count (2.42 and 1.68 log10 cfu/ml), respectively, and a higher count of E. coli (1.53 log10 cfu/ml). In sheep and goat milk, Ombarak and Elbagory (2017) recorded lower counts of coliform and Staph species with mean count values of 6.47 ± 2.17 x 105 and 1.66 ± 0.85 x 105 CFU/ml in goat and ewe milk samples, respectively, and Staph species with mean count values of 1.41 x 104 and 6.67 x 104 CFU/ml in goat and ewe milk, respectively. In camel, Bassuony et al. (2014) recorded no detection of E. coli, Staph, and Salmonella and obtained a lower coliform count.

In mares, Czyzak-Runowska et al. (2018) did not detect the pathogenic Salmonella spp. and coliforms in the raw milk but Bauzad et al. (2019) reported a high rate of E. coli contamination in buffalo milk samples in all udder milk and farm milk samples in Curio and that may be due to several factors. These factors were mainly the low hygiene and sanitation during raw milk production at the farm level. According to Nurwantoro and Mulyani (2003), E. coli contamination could be caused by poor handling of milk, inadequate sanitation, and the environmental factors of the mesophilic temperature and the neutral pH.

Elevated count values of yeasts and molds in milk are quite uncommon because of the neutral pH of milk bacteria to prevail and their existence in large counts in milk is considered unacceptable due to its ability to deteriorate the sensory evaluation of milk (Lues et al., 2003).

In the present study, yeast and mold counts of different types of milk showed the highest yeast count in goat milk and the least in donkey milk, while the highest mold count was in cow milk and the least in mare milk (Table 5).

Higher fungal counts of 3.71 ± 0.83 cfu/ml were obtained by Adugna and Eshetu (2021) from milk samples in Ethiopia. In buffalo milk, Gurler et al. (2013) in Turkey recorded lower counts (2.63 ± 0.25 log10 cfu/ml), compared to the current study. Han et al. (2007) recorded a higher fungal count in buffalo milk as they reported 1.79 log10 cfu/ml in China. Regarding camel milk, Bassuony et al. (2014) recorded no detection of yeast in Egypt while Ismaili et al. (2016) detected high yeast and mold count in Egypt as the counts of yeast and mold were 3.13 x106 and 1.60 x 105 cfu ml, respectively.

In the present work, Salmonella was not isolated. Ombarak and Elbagory (2015) obtained the same result as they recorded that Salmonella was not isolated in any of examined raw milk samples. Bogdanovicova et al. (2016) did not detect Salmonella in sheep and goat milk while Abbas et al. (2013) recorded Salmonella in a low percentage (6.67%). The presence of Salmonella and other types of pathogenic bacteria in milk has been the cause of public health problems, especially for those persons who consume Salmonella contaminated milk.

Previous studies have assured that breast milk contains an important variety of bacteria that can be transmitted to the babies together with various other nourishments and immunological components. These bacteria are beneficial and could have a protective effect. They can also stimulate the immune system and add some of the first colonizers in the infant microbiome. Boix-Amoros et al. (2017) obtained higher bacterial and fungal counts as they reported 8.9 x 105 cells/ml and 3.5 x 105 cells/ml for bacterial and fungal counts, respectively.

Many approaches, such as chemical, immunological, and molecular approaches, have been used to determine the species origin of raw milk. PCR-RFLP (Abdelfatah et al., 2015), multiplex PCR (Bottero et al., 2003), Real-time PCR (Liao et al., 2017), and DNA-based fluorometric approach (Kounelli et al., 2017) are some of the molecular methods available for distinguishing closely related species.

Polymerase chain reaction used in the present study was ordinary PCR which could be cost-effectively and simply applied, compared to other types of PCR. For the identification of cattle, buffaloes, sheep, goat, camel, horse, donkey, and human milk samples, the accuracy of the species-specific primers and ideal PCR circumstances were utilized.

For molecular identification of milk from humans and different animals (buffaloes, sheep, goat, camel, horse, donkey, and human milk), species-specific primers and ideal PCR circumstances were performed. The primers yielded distinct species-specific PCR products of 274, 242, 225, 157, 711, and 195 bp for cattle, buffaloes, sheep, goat, camel, and human milk samples, respectively (Figure 1). Horse and donkey milk DNA provided the expected products (153 bp and 145 bp, respectively) as shown in Figures 2 and 3. These PCR bands were produced exclusively from the DNA retrieved from animal and human mitochondrial cytochrome b genes and exhibited no cross-matching with the DNA from other species Figures 1-3.

The present work implemented a fast, sensitive, practical, animal-friendly, and cost-effective source of genomic DNA extraction from milk somatic cells of different animals (cattle, sheep, goats, and horses). Milk was considered an excellent source of genomic DNA, and 10 ml of raw milk was sufficient to yield a significant volume of DNA appropriate for molecular analysis, such as PCR (Psifidi et al., 2010; Pokorska et al., 2016). Six different DNA extraction techniques were optimized, tested, and compared for the extraction of DNA from ovine milk samples. The primers used in the present study showed high specificity in the PCR reaction and succeed in the discrimination of different milk samples obtained from humans and animals.

14

Table 5. Total yeast and mold count of different types of milk in Egypt during 2020-2021

Yeast Mold

Minimum Maximum Mean±SE Minimum Maximum Mean± SE

Cow 20 1 x 103 2.4 x 102 ± 7.6 x 10 8 4 x 102 4 x 10 ± 1.9 x 10

Buffalo 10 4 x 102 7.5 x 10 ± 2.2 x 10 6 9 x 10 2.3 x 10 ± 0.7 x 10

Sheep 15 1 x 102 7.4 x 10 ± 1.1 x 10 8 7 x 10 3.4 x 10 ± 0.7 x 10

Goat 14 3 x 103 6.19 x 102 ± 2.3 x 102 7 6 x 10 2.1 x 10 ± 0.5 x 10

Horse 9 1 x 102 1.8 x 10 ± 0.8 x 10 5 2 x 10 0.3 x 10 ± 0.1 x 10

Camel 10 1 x 102 2.7 x 10 ± 0.8 x 10 3 6 x 10 0.4 x 10 ± 0.3 x 10

Donkey 12 9 x 10 0.6 x 10 ± 0.4 x 10 10 1 x 102 1.2 x 10 ± 0.6 x 10

Human 5 1.5 x 10 0.56 x 10 ± 0.2 x 10 1 0.3 x 10 0.13 x 10 ± 0.058 x 10

Mean ± SE: Mean ± standard error

1 2 3 4 5 6 7

KOObp

700bp

GOObp 71 Ibp

50(lbp ^mm

400bp m m

JOObp . .

200b p 225bp ST 274bP

I57bp

lOObp

Figure 1. The PCR product of different types of milk amplified with species-specific primers. 1: Molecular marker (100 bp), 2: Goat milk,; 3: Human milk, 4: Sheep meat, 5: Buffalo milk, 6: Cattle milk, 7: Camel milk

Figure 2. The PCR product amplified with horse-specific primers. 1: Molecular marker (100 bp), 2: Negative control, 3 and 4: Horse milk samples (153bp)

Figure 3. The PCR product amplified with donkey-specific primers. 1: Molecular marker (100 bp), 2: Negative control, 3 and 4: Donkey milk samples (145bp).

15

CONCLUSION

Milk is considered as a complete food for human beings as it is rich in various constituents that can also support the growth of different microbes, so monitoring microbial contamination of milk implemented in the current work is crucial to protect human beings from milk-borne microbes. In the present study, DNA was extracted from milk somatic cells specifically mitochondrial cytochrome b gene which exhibited high specificity in the PCR reactions. This method can succeed in the identification of eight different types of milk. Therefore, it can serve as a simple, sensitive, and reproducible method to be easily applied and those results will be the core of further studies on milk and its byproducts.

DECLARATIONS

Authors' contribution

Azza Sayed Mohammed Abuelnaga and Nagwa Sayed Ata designed the study, participated in performing the experiments and analyzing the data. Khaled Abd El-Hamid Abd El-Razik participated in designing the study, performing the experiments, and writing the manuscript. Riham Hassan Hedia participated in analyzing the data and writing the manuscript. Mona Mohamed Hassan Soliman participated in performing the experiments and writing the manuscript. Mai Mohamed Kandil, Elgabry Abd-Elalim ELgabry, and Amany Ahmed Arafa participated in performing the experiments and analyzing the data. All authors checked and confirm the final draft of the manuscript before submission to the journal.

Competing interests

The authors declare that they have no competing interests.

Ethical considerations

Ethical issues (including plagiarism, consent to publish, misconduct, data fabrication and/or falsification, double publication and/or submission, and redundancy) have been checked by the authors.

Consent to publish

The authors agreed to publish the article.

Acknowledgments

This work was supported by a grant (12050309) from the National Research Centre (NRC) in Egypt.

REFERENCES

Abbas MN, Khattak B, Sajid A, Ul Islam T, Jamal Q, and Munir S (2013). Biochemical and bacteriological analysis of cows' milk samples collected from district Peshawar. International Journal of Pharmaceutical Sciences Review and Research, 21(2): 221-226. Available at: https://www.globalresearchonline.net/pharmajournal/vol21iss2.aspx

Abd El-Razik KA, Abuelnaga ASM, Younes AM, Atta NS, Arafa AA, and Kandil MM (2019). Species-specific PCR test for the quick recognition of equine tissue in raw and 246 processed beef meat mixtures. Food Science and Technology, 39(1): 166-172. DOI: https://www.doi.org/10.1590/fst.39417

Abdelfatah EN, El-Araby IE, and Mohamed AA (2015). Identification of species adulteration in raw milk and butter using polymerase chain reaction-restriction fragment length polymorphism. Global Veterinaria, 15(3): 332-338. Available at: https://www.idosi.org/gv/gv15(3)15/13.pdf

Abdel-Rahman S (2017). Detection of adulteration and identification of meat and milk species using molecular genetic techniques. Agrotechnology, 6: 4. Available at: https://www.longdom.org/proceedings/detection-of-adulteration-and-identification-of-meat-and-milk-species-using-molecular-genetic-techniques-18498 .html

Abuelnaga ASM, Abd El-Razik KA, Atta NS, Hedia RH, Elgabry EA, Soliman MMH, and Marie HSA (2021). Bacteriological assessment and multiplex-PCR test for the detection of meat adulteration of different animal species. Food Science and Technology, Campinas, 41(1): 98-104. DOI: https://www.doi.org/10.1590/fst.11520

Addeon F, Nicolai MA, Chianese L, Moio L, Musso S, Bocca A, and Del Giovine L (1995). A control method to detect bovine milk in ewe and water buffalo cheese using immunoblotting. Milchwissenachaft, 50: 83-85. Available at: https://agris.fao.org/agris-

search/search.do?recordID=DE19950105378

Adugna C, and Eshetu M (2021). Hygienic practice, microbial quality and physco-chemical properties of milk collected from farmers and market chains in Eastern Wollega zone of Sibu Sire districts, Ethiopia. Journal of Agricultural Science and Food Technology, 7(1): 125-132. DOI: https://www.dx.doi.org/10.17352/2455-815X.000099

Alichanidis E, Moatsou G, and Polychroniadou A (2016). Composition and properties of non-cow milk and products. In Non-bovine milk and milk products. Academic Press, pp. 81-116, DOI: https://www.doi.org/10.1016/B978-0-12-803361-6.00005-3

American Public Health Association (APHA) (1992). Standard methods for the microbiological examination of dairy products. 16th Ed., American Public Health Association, Washington, D.C., USA. Available at: https://agris.fao.org/agris-search/search.do?recordID=US19950104912

Barbour EK, Nabbut NH, Frenches WM, and AL-Nakhil HM (1984). Inhibition of pathogenic bacteria by camel milk: Relation to whey lysozyme and stage of lactation. Journal of Food Protection, 47(11): 838-840. DOI: https://www.doi.org/10.4315/0362-028X-47.11.838

Bassuony NI, Abdel-Salam AF, Abdel-Ghany ZM, El-Karamany AMM, Atwa MA, and Hassanein AM (2014). Effect of camel milk on microbiological and chemical quality of soft cheese. Journal of Food and Dairy Sciences, Mansoura University, 5(2): 63-77. Available at: https://jfds.journals.ekb.eg/article 52740 8009b23bf12fe64989f224721edc30e0.pdf

Bauzad M, Yuliati FN, Prahesti KI, and Malaka R (2019). Total plate count and Escherichia coli in raw buffalo milk in curio district enrekang regency. In IOP Conference Series: Earth and Environmental Science, IOP Publishing, 247(1): 012027. DOI: https://www.doi.org/10.1088/1755-1315/247/1/012027

Bellagamba F, Moretti VM, Comincini S, and Valfre F (2001). Identification of species in animal feedstuffs by polymerase chain reaction- restriction fragment length polymorphism analysis of mitochondrial DNA. Journal of agricultural and food chemistry, 49(8): 3775-3781. DOI: https://www.doi.org/10.1021/jf0010329

Bergey DH, and Holt JG (1994). Bergey's manual of determinative bacteriology. 9th edition, Baltimore: Williams and Wilkins, pp. 337-339. Available at: https://www.biodiversitvlibrarv.org/item/41848#page/182/mode/1up

Bogdanovicova K, Vyletelova-Klimesova M, Babak V, Kalhotka L, Kolackova I, and Karpiskova R (2016). Microbiological quality of raw milk in the Czech Republic. Czech Journal of Food Sciences, 34: 189-196. DOI: https://www.doi.org/10.17221/25/2016-cjfs

Boix-Amoros A, Martinez-Costa C, Querol A. Collado MC, and Mira A (2017). Multiple approaches detect the presence of fungi in human breastmilk samples from healthy mothers. Scientific Reports, 7(1): 1-13. DOI: https://www.doi.org/10.1038/s41598-017-13270-x

Bottero MT, Civera T, Nucera D, Rosati S, Sacchi P, and Turi RM (2003). A multiplex polymerase chain reaction for the identification of cows', goats' and sheep's milk in dairy products. International dairy journal, 13(4): 277-282. DOI: https://doi.org/10.1016/S0958-6946(02)00170-X

Cappuccino JG, and Sherman N (1996). Microbiology - A laboratory manual. Menlo Park, California: The Benjamin/Cummings Publishing Corporation Inc. Available at: https://www.scirp.org/(S(351jmbntvnsjt1aadkposzje))/reference/ReferencesPapers.aspx?ReferenceID=2429655

Cartoni GP, Coccioli F, Jasionowska R, and Masci M (1998). Determination of cow milk in buffalo milk and Mozzarella cheese by capillary electrophoresis of the whey protein fractions. Italian Journal of Food Science, 2: 127-131. Available at: https://agris.fao.org/agris-search/search.do?recordID=IT2000060498

Chatterjee SN, Bhattachaijee I, Chatterjee SK, and Chandara G (2006). Microbiological examination of milk in Tarakeswar, India with special reference to coliforms. African Journal of Biotechnology, 5(15): 1383-1385. Available at: https://www.ajol.info/index.php/ajb/article/view/43120

Czyzak-Runowska G, Wojtowski J, Niewiadomska A, and Markiewicz-Keszycka M (2018). Quality of fresh and stored mares' milk. Mljekarstvo, 68(2): 108-115. DOI: https://www.doi .org/10.15567/mlj ekarstvo.2018.0204

Deng L, Li A, Gao Y, Shen T, Yue H, Miao J, Li R, and Yang J (2020). Detection of the bovine milk adulterated in camel, horse, and goat milk using duplex PCR. Food Analytical Methods, 13: 560-567. DOI: https://www.doi.org/10.1007/s12161-019-01678-2

El-Agamy E I, Ruppanne R, Ismail A, Champagne CP, and Assf R (1992). Antibacterial and Antiviral Activity of camel Protective Protein. Journal of Dairy Research, 59(2): 169-175. DOI: https://www.doi.org/10.1017/s0022029900030417

Guha S, Sharma H, Deshwa GK, and Rao PS (2021). A comprehensive review on bioactive peptides derived from milk and milk products of minor dairy species. Food production, processing and nutrition, 3(1): 1-21. Doi: https://www.doi.org/10.1186/s43014-020-00045-7

Gulbe G, and Valdovska A (2014). Diversity of microscopic fungi in the raw milk from Latvian organic farms. Proceedings of the Latvia University of Agriculture, 31(326): 46-53. DOI: https://www.doi.org/10.2478/plua-2014-0006

Gurler Z, Kuyucuoglu Y, and Pamuk S (2013). Chemical and microbiological quality of Anatolian Buffalo milk. African Journal of Microbiological Research, 7(16): 1512-1517. DOI: https://www.doi.org/10.5897/AJMR12.1014

Haasnoot W, Sajic N, Essers KD, Streppel L, and Verheijen R (2014). ELISA for raw and heat-treated cow's and buffalo's milk in the milk of other species and sources. Advances in Dairy Research Journal, 2(2): 118-125. Available at: https://www.semanticscholar.org/paper/ELISA-for-Raw-and-Heat-Treated-Cows-and-Buffalos-in-Haasnoot-Sajic/038e97cd2eaa084f669704c2a51b14a2c15fc653

Han BZ, Meng Y, Li M, Yang YX, Ren FZ, Zeng QK, and Nout MJR (2007). A survey on the microbiological and chemical composition of buffalo milk in China. Food Control, (18): 742-746. DOI: https://www.doi.org/10.1016/j.foodcont.2006.03.011

Hayes MC, and Boor K (2001). Raw milk and: Fluid milk products. In applied dairy microbiology. CRC Press, pp. 79-96. Available at: https://www.routledge.com/Apphed-Dairv-Microbiologv/Marth-Steele/p/book/9780824705367

Ilhak OI, and Arslan A (2007). Identification of meat species by polymerase chain reaction (PCR) Technique. Turkish Journal of Veterinary and Animal Sciences, 31(3): 159-163. Available at: https://citeseerxist.psu.edu/viewdoc/download?doi=10.1.1.1021.6773&rep=rep1&type=pdf

Ismaili MA, Saidi B, Zahar M, Hamama A, and Ezzaier R (2016). Composition and microbial quality of raw camel milk produced in Morocco. Journal of the Saudi Society of Agricultural Science, 18(1): 17-21. Available at: https://www.semanticscholar.org/paper/Composition-and-microbial-quahtv-of-raw-camel-milk-Ismaih-Saidi/76d1ce1fb5c0dc85343d04793e3712209708b9dc

Kapoor V, Smith C, Santo Domingo JW, Lu T, and Wendell D (2013). Correlative assessment of fecal indicators using human mitochondrial DNA as a direct marker. Environmental Science and Technology, 47(18): 10485-10493. DOI: https://www.doi.org/10.1021/es4020458

Kesmen Z, Sahin F, and Yetim H (2007). PCR assay for the identification of animal species in cooked sausages. Meat Science, 77(4): 649-653. DOI: https://www.doi.org/10.1016/j.meatsci.2007.05.018

Kesmen Z, Yetim H, and §ahin F (2010). Identification of different meat species used in sucuk production by PCR assay. Gida, 35: 81-87. Available at: https://www.semanticscholar.org/paper/Identification-of-Different-Meat-Species-Used-In-Bv-Kesmen-

Yetim/c9ad0cfd7f471955339ee9ddb1d9a7e38b98ff4c

Kounelli ML, Despina P, and Kalogianni DP (2017). A sensitive DNA based fluorometric method for milk authenticity of dairy products based on spectrally distinct microspheres. European Food Research and Technology, 243: 1773-1781. DOI: https://www.doi.org/10.1007/s00217-017-2882-6

Lancette GA, and Bennett RW (2001). Staphylococcus aureus and staphylococcal enterotoxins. In: Downes, F.P. and Ito, K., Eds., compendium of methods for the microbiological examination of foods, 4th edition. APHA, Washington DC, 387-403. DOI: https://www.doi.org/10.2105/9780875531755ch39

Lavoie K, Touchette M, St-Gelais D, and Labrie S (2012). Characterization of the fungal microflora in raw milk and specialty cheeses of the province of Quebec. Dairy Science and Technology, 92(5): 455-468. DOI: https://www.doi.org/10.1007/s13594-011-0051-4

Liao J, Liu YF, Ku T, Liu MH, and Huang Y (2017). Qualitative and quantitative identification of adulteration of milk powder using DNA extracted with a novel method. Journal of Dairy Science, 100(3): 1657-1663. DOI: https://www.doi.org/10.3168/jds.2016-11900

Lingathurai S, and Vellathurai P (2010). Bacteriological quality and safety of raw cow milk in Madurai, South India. Webmed Central, 1(10): 1-10. Available at: https://www.webmedcentral.com/wmcpdf/Article WMC001029.pdf

Lovelady CA, Dewey KG, Picciano MF, and Dermer A (2002). Guidelines for collection of human milk samples for monitoring and research of environmental chemicals. Journal of Toxicology and Environmental Health, 65(22): 1881-1891. DOI: https://www.doi .org/10.1080/00984100290071775

Lues JFR, Venter P, and Van der Westhuizen H (2003). Enumeration of potential microbiological hazards in milk from a marginal urban settlement in central South Africa. Food Microbiology, 20: 321-326. Available at:

https://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.1071.1616&rep=rep 1 &type=pdf

17

Machado SG, Bagliniere F, Marchand S, Van Coillie E, Vanetti MC, De Block J, and Heyndrickx M (2017). The biodiversity of the microbiota producing heat-resistant enzymes responsible for spoilage in processed bovine milk and dairy products. Frontiers in Microbiology, 8: 302. DOI: https://www.doi.org/10.3389/fmicb.2017.00302

Makadiya J, and Pandey A (2015). Quality assessment and detection of adulteration in buffalo milk collected from different areas of Gandhinagar by physicochemical method. International Journal of PharmTech Research, 8(4): 602-607. Available at: https://www. sphinxsai.com/2015/ph_vol8_no4/ph01 .htm

Martin NH, Ranieri ML, Murphy SC, Ralyea RD, Wiedmann M, and Boor KJ (2011). Results from raw milk microbiological tests do not predict the shelf-life performance of commercially pasteurized fluid milk. Journal of dairy science, 94(3): 1211-1222. DOI: https://www.doi.org/10.3168/jds.2010-3915

Massouras T, Bitsi N, Paramithiotis S , Manolopoulou E, Drosinos EH and Triantaphyllopoulos KA (2020). Microbial profile antibacterial properties and chemical composition of raw donkey milk. Animals, 10(11): 2001. DOI: https://www.doi.org/10.3390/ani10112001

Matsunaga T, Chikuni K, Tanabe R, Muroya S, Shibata K, Yamada J, and Shinmura Y (1999). A quick and simple method for the identification of meat species and meat products by PCR assay. Meat Science, 51: 143-148. DOI: https://www.doi .org/10.1016/s0309-1740(98)00112-0

Mehta BM (2015). Chemical composition of milk and milk products. P.C.K. Cheung, B.M. Mehta (eds.), Handbook of food chemistry. SpringerVerlag Berlin Heidelberg, pp. 16-42. DOI: https://www.doi.org/10.1007/978-3-642-36605-5 31

Minj AK, and Behera N (2012). A comparative microbiological quality assessment of rural and urban milk samples African Journal of Food Science, 6(21): 519-523. DOI: https://www.doi.org/10.5897/AJFS12.132

Muhammad K, Altaf I, Hanif A, Anjum AA, and Tipu MY (2009). Monitoring of hygienic status of raw milk marketed in Lahore City, Pakistan. The Journal of Animal and Plant Sciences, 19(2): 74-77. Available at: http://www.thejaps.org.pk/docs/19-2-%202009/09-923.pdf

Murphy MA, Shariflou MR, and Moran C (2002). High quality genomic DNA extraction from large milk samples. Journal of Dairy Research, 69(4): 645-649. DOI: https://www.doi.org/10.1017/s0022029902005848

Murphy SC, and Carey NR (2007). Dairy food science notes. The laboratory pasteurization count- Thermoduric bacteria in raw milk. Milk quality improvement program. Cornell University, pp. 1-2. Available at:

https://foodsafety.foodscience.comell.edu/search/?s=The+Laboratory+Pasteurization+Count+-+Thermoduric+Bacteria+in+Raw+Milk+&search site=Food+Safety+MQIP

Nurwantoro, and Mulyani S (2003). Dasar Teknologi Hasil Ternak (Semarang: Diponegoro University). Available at: http://eprints .undip.ac .id/21237/

Oliver SP, Jayarao BM, and Almeida RA (2005). Foodborne pathogens in milk and dairy farm environment. Food safety and public health environment. Foodborne Pathogens and Disease, 2(2): 115-129. DOI: https://www.doi.org/10.1089/fpd.2005.2.115

Ombarak R, and Elbagory A (2015). Bacteriological quality and safety of raw cow's and buffalo's milk sold in Menoufia governorate, Egypt. Minufiya Veterinary Journal, 9: 101-113. DOI: https://www.doi.org/10.21608/JCVR.2015.34836

Ombarak RA, and Elbagory AM (2017). Bacteriological quality and occurrence of some microbial pathogens in goat's and ewe's milk in Egypt. International Food Research Journal 24(2): 847-851. Available at: http://www.ifrj.upm.edu.my/24%20(02)%202017/(53).pdf

Parekh TS, and Subhash R (2008). Molecular and bacteriological examination of milk from different milch animals with special reference to coliforms. Current Research in Bacteriology, 1(2): 56-63. DOI: https://www.doi.org/10.3923/crb.2008.56.63

Park YW, and Haenlein GFW (2006). Overview of milk of non-bovine mammals. In Handbook of milk of non-bovine mammals. Ames: Blackwell Publishing Professional, pp. 3-9. Available at: https://www.wiley.com/en-af/Handbook+of+Milk+of+Non+Bovine+Mammals%2C+2nd+Edition-p-9781119110279

Pellegrino L, De Noni I, Tirelli A, and Resmini P (1991). Detection of bovine milk in cheese from minor species by HPLC of whey proteins. Note 1 -application to water buffalo Mozzarella cheeses. Scienza e Tecnica Lattiero-Casearia (Italy), 42: 87-101. Available at: https://agris.fao.org/agris-search/search.do?recordID=IT9260496

Pokorska J, Kulaj D, Dusza M, Zychlinska-Buczek J, and Makulska J (2016). New rapid method of DNA isolation from milk somatic cells. Animal Biotechnology, 27(2): 113-117. DOI: http://www.dx.doi.org/10.1080/10495398.2015.1116446

Psifidi A, Dovas CI, and Banos G (2010). A comparison of six methods for genomic DNA extraction suitable for PCR-based genotyping applications using ovine milk samples. Molecular and Cellular Probes, 24(2): 93-98. DOI: https://www.doi.org/10.1016/j.mcp.2009.11.001

Pyz-Lukasik R, Paszkiewicz W, Tatara MR, Brodzki P, and Belkot Z (2015). Microbiological quality of milk sold directly from producers to consumers. Journal of Dairy Science, 98(7): 4294-4301. DOI: https://www.doi.org/10.3168/jds.2014-9187

Quigley L, McCarthy R, O'Sullivan O, Beresford TP, Fitzgerald GF, Ross RP, Stanton C, and Cotter PD (2013). The microbial content of raw and pasteurized cow milk as determined by molecular approaches. Journal of dairy science, 96(8): 4928-4937. DOI: https://www.doi.org/10.3168/jds.2013-6688

Quinn PJ, Markey BK, Carter ME, Donnelly WJC, and Leonard FC (2002). Veterinary microbiology and microbial disease. Oxford, England: Wiley-Blackwell, pp. 10-24. Available at: https://www.book-info.com/isbn/0-632-05525-1.htm

Quinn PJ, Markey BM, Leonard FC, FitzPatrick ES, Fanning S, and Hartigan PJ (2011). Veterinary Microbiology and Microbial Disease 2th edition. Oxford, Wiley-Blackwell, p. 912. Available at: https://vetbooks.ir/veterinary-microbiology-and-microbial-disease-2nd-edition/

Rajapaksha WRAKJS, Thilakaratne IDSIP, Chandrasiri and, and Niroshan TD (2003). Development of PCR assay for identification of buffalo meat. Asian-Australasian Journal of Animal Sciences, 6(7): 1046-1048. DOI: https://www.doi.org/10.5713/ajas.2003.1046

Roy D, Ye A, Moughan PJ, and Singh H (2020). Composition, structure, and digestive dynamics of milk from different species - A review. Frontiers in Nutrition, 7: 1-17. DOI: https://www.doi.org/10.3389/fnut.2020.577759

Soliman MMH, Ata NS, El-Shafei HM, and Kandil MMA (2019). Prevalence of toxigenic Aspergillus flavus in meat and meat products. Bioscience Research, 16(1): 822-829. Available at: https://www.isisn.org/BR 16 1 2019.htm