Научная статья на тему 'Клеточные модели для исследования роли экстрацеллюлярного домена муцина MUC1 человека в метастазировании'

Клеточные модели для исследования роли экстрацеллюлярного домена муцина MUC1 человека в метастазировании Текст научной статьи по специальности «Фундаментальная медицина»

CC BY
380
112
i Надоели баннеры? Вы всегда можете отключить рекламу.
Журнал
Acta Naturae (русскоязычная версия)
WOS
Scopus
ВАК
RSCI
PubMed
Ключевые слова
КЛЕТОЧНЫЕ МОДЕЛИ / МЕТАСТАЗИРОВАНИЕ / МУЦИН / ОНКОЛОГИЧЕСКИЕ ЗАБОЛЕВАНИЯ / MUC1 / HT-29

Аннотация научной статьи по фундаментальной медицине, автор научной работы — Сыркина М. С., Рубцов М. А., Поташникова Д. М., Кондратенко Ю. Д., Докрунова А. А.

На основе экспрессионного вектора pEGFP-N3 получены генетические конструкции, кодирующие различные комбинации функциональных фрагментов муцина MUC1 человека, а также маркеры для идентификации синтезируемых химерных белков (FLAG-эпитоп, располагающийся в N-концевой области синтезируемых белков, и EGFP, имеющий С-концевую локализацию). Этими конструкциями трансфицировали клетки линии HT-29. Стабильно трансфицированные клетки были охарактеризованы с использованием проточного цитофлуориметра. Высокий уровень экспрессии рекомбинантных белков на фоне низкого уровня эндогенного муцина MUC1 в полученных клетках был подтвержден методом ПЦР в реальном времени. При помощи флуоресцентной микроскопии была показана мембранная локализация химерных белков. Полученные клетки могут служить моделью MUC1-экспрессирующей формы рака, а также использоваться для исследования роли различных функциональных фрагментов муцина MUC1 в метастазировании.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по фундаментальной медицине , автор научной работы — Сыркина М. С., Рубцов М. А., Поташникова Д. М., Кондратенко Ю. Д., Докрунова А. А.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

Текст научной работы на тему «Клеточные модели для исследования роли экстрацеллюлярного домена муцина MUC1 человека в метастазировании»

УДК 576.524+576.532+576.535

Клеточные модели для исследования роли экстрацеллюлярного домена муцина MUC1 человека в метастазировании

М. С. Сыркина1,4*, М. А. Рубцов1, Д. М. Поташникова2, Ю. Д. Кондратенко1,

А. А. Докрунова3, В. П. Вейко4

Московский государственный университет им. М.В. Ломоносова, биологический факультет, кафедра молекулярной биологии, 119234, Москва, Ленинские горы, 1, стр. 12 2Московский государственный университет им. М.В. Ломоносова, биологический факультет, кафедра клеточной биологии и гистологии, 119234, Москва, Ленинские горы, 1, стр. 12 3Московский государственный университет им. М.В. Ломоносова, биологический факультет, кафедра физиологии человека и животных, 119234, Москва, Ленинские горы, 1, стр. 12 4Институт биохимии им. А.Н. Баха РАН, 119071, Москва, Ленинский просп., 33, корп. 2 *E-mail: krimsy@yandex.ru Поступила в редакцию 02.12.2013 После доработки 20.03.2014

РЕФЕРАТ На основе экспрессионного вектора pEGFP-N3 получены генетические конструкции, кодирующие различные комбинации функциональных фрагментов муцина MUC1 человека, а также маркеры для идентификации синтезируемых химерных белков (FLAG-эпитоп, располагающийся в N-концевой области синтезируемых белков, и EGFP, имеющий С-концевую локализацию). Этими конструкциями трансфицировали клетки линии HT-29. Стабильно трансфицированные клетки были охарактеризованы с использованием проточного цитофлуориметра. Высокий уровень экспрессии рекомбинантных белков на фоне низкого уровня эндогенного муцина MUC1 в полученных клетках был подтвержден методом ПЦР в реальном времени. При помощи флуоресцентной микроскопии была показана мембранная локализация химерных белков. Полученные клетки могут служить моделью MUCl-экспрессирующей формы рака, а также использоваться для исследования роли различных функциональных фрагментов муцина MUC1 в метастазировании. КЛЮЧЕВЫЕ СЛОВА клеточные модели, метастазирование, муцин, MUC1, HT-29, онкологические заболевания.

СПИСОК СОКРАЩЕНИЙ БСА - бычий сывороточный альбумин; GAPDH - глицеральдегид-3-фосфат-дегидрогеназа; ДФСБ - фосфатно-солевой буфер в модификации Дульбекко; ДЭПК - диэтилпирокарбонат; ПЦР - полимеразная цепная реакция; ОТ-ПЦР - полимеразная цепная реакция с обратной транскрипцией; ФСБ - фосфатно-солевой буфер.

ВВЕДЕНИЕ

Метастазирование - процесс, характеризующийся повышенной способностью клеток к инвазии и трансэндотелиальной миграции, является одним из ключевых в развитии онкологических заболеваний. Появление у опухолевых клеток способности к метастазированию, как правило, ассоциировано с неблагоприятным прогнозом [1]. Молекулярные механизмы процессов, приводящих к изменению метастатического потенциала клеток, активно исследуются на протяжении нескольких десятилетий. Установлено, что в данном процессе принимают участие молекулы, взаимодействующие с внеклеточным матриксом [2, 3] или с молекулами клеточ-

ной адгезии [4, 5]. Одна из таких молекул - муцин МиС1 человека. Экспериментальные данные, указывающие на то, что повышение экспрессии МиС1 коррелирует со снижением способности клеток в культуре к агрегации [6], послужили основанием для предположения об участии данного гликопротеида в увеличении метастатического потенциала опухолевых клеток.

Мембранный гликопротеид МиС1 в норме располагается на апикальной поверхности эпителиальных клеток, выстилающих дыхательные пути и протоки желез, и выполняет функцию их увлажнения и лу-брификации. При злокачественной трансформации клеток экспрессия гена МиС1 [7-9] увеличивается,

изменяются клеточная локализация [10, 11] и характер гликозилирования муцина MUC1 [12].

В структуре муцина MUC1 можно выделить несколько функциональных доменов - экстрацел-люлярный, трансмембранный и цитоплазматический. Накопленные к настоящему времени данные, касающиеся влияния различных доменов MUC1 на метастатический потенциал опухолевых клеток, весьма противоречивы [13-15]. Достаточно однозначно установлена лишь роль цитоплазматического домена - идентифицированы сигнальные пути, в которых принимает участие данный фрагмент, и внутриклеточные молекулы, с которыми он взаимодействует [16-18]. Однако функциональная роль экстрацеллюлярного домена MUC1 в данном процессе выяснена не до конца, хотя известно, что изменения, происходящие с молекулой муцина при злокачественной трансформации клетки, затрагивают в основном его экстрацеллюлярную область. Изменение характера гликозилирования внеклеточной части муцина MUC1 в опухолевых клетках приводит к формированию опухоль-специфичных антигенных эпитопов. Предполагается, что характер гликозили-рования муцина может существенно влиять на инвазивные характеристики опухолевых клеток. Так, например, было показано, что углеводные компоненты опухоль-ассоциированного (но не «нормального») муцина MUC1 способны связываться с селектинами, продуцируемыми клетками активированного эндотелия [19]. Селектины, в свою очередь, опосредуют взаимодействие с рецепторами на поверхности эндотелиальных клеток, что, по всей видимости, способствует прикреплению метастазирующей клетки к стенке сосуда и ее последующей инвазии. Более того, для метастазирующих клеток характерно наличие определенных гликозидных эпитопов [20, 21]. В случае MUC1 были идентифицированы гликозид-ные эпитопы syalil Lewisa (sLea) и syalil Lewisx (sLex), присутствие которых ассоциировано со способностью клеток к метастазированию. В частности, показано, что во время неопластической трансформации клеток кишечника содержание sLea постепенно увеличивается [22]. Повышенные количества димерных форм sLex обнаружены также в субпопуляциях клеток аденокарциномы легкого, обладающих высокой способностью формировать колонии в легких бести-мусных мышей [23]. Приведенные данные косвенно указывают на участие экстрацеллюлярного домена муцина MUC1 в повышении метастатического потенциала клеток злокачественных новообразований млекопитающих.

Тем не менее изучение влияния экстрацел-люлярного домена MUC1 на метастазирование опухолевых клеток невозможно без создания адекватных

клеточных моделей. Клеточные модели агрессивной формы MUd-экспрессирующего рака могли бы использоваться для тестирования как противоопухолевых препаратов, так и диагностических средств, направленных на распознавание экстрацеллюляр-ной области муцина MUC1. Поскольку экспрессия муцина MUC1 характерна для клеток большинства эпителиальных опухолей, разработка таких агентов позволит охватить широкий спектр онкологических заболеваний.

экспериментальная часть

Материалы

В работе использовали соли производства компании Merck (Германия), а также отечественного производства категории «ос.ч.»; компоненты для получения микробиологических сред (Difco, США); агарозу, ферменты и наборы для проведения ПЦР, ОТ-ПЦР, ПЦР в реальном времени, экстракции фрагментов ДНК из агарозного геля и выделения плазмид-ной ДНК, а также ДНК- и РНК-маркеры (Thermo Scientific, США), TRIzol (Sigma, США), ДЭПК (Sigma, США).

Для культивирования клеточных линий использовали модифицированную Дульбекко среду Игла (DMEM), раствор Версена, раствор трипсина («ПанЭко», Россия), фетальную сыворотку теленка (Hyclone, США), антибиотики генетицин (G418), пенициллин и стрептомицин (Sigma-Aldrich, США).

Бактериальные штаммы и клеточные культуры

Штамм JM110 Escherichia coli (e14- [F' traD36 proAB+ laclq lacZAM15] hsdR17(rK-mK+)) был получен из музея ФГУП ГосНИИ генетика.

В работе были использованы культуры клеток рака молочной железы (MCF-7), рака шейки матки (HeLa) и колоректальной аденокарциномы (HT-29) человека.

Синтетические олигонуклеотиды

Олигонуклеотиды, использованные в работе, синтезированы ООО «ДНК-Синтез»; их нуклеотидные последовательности представлены в табл. 1.

Выделение РНК из культуры клеток

Промытые раствором ДФСБ клетки осаждали центрифугированием (4 мин, 1000 об/мин) и ресуспен-дировали в 1 мл реактива TRIzol. Затем добавляли 200 мкл хлороформа, перемешивали, инкубировали в течение 2-3 мин при комнатной температуре, после чего центрифугировали (15 мин, 13000 об/мин, +4°С) и отбирали верхнюю водную фазу в чистую пробирку. Добавляли равный объем изопропанола,

инкубировали в течение 10 мин при комнатной температуре и осаждали нуклеиновые кислоты центрифугированием (10 мин, 13000 об/мин, +4°С). Осадок промывали 75% этанолом, высушивали и растворяли в воде, содержащей 0.1% ДЭПК. ДНК удаляли при помощи ДНКазы I, следуя рекомендациям фирмы-изготовителя.

Синтез кДНК

кДНК синтезировали методом обратной транскрипции с использованием набора RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, США), следуя рекомендациям изготовителя.

Для наработки кДНК с целью получения фрагментов, кодирующих функциональные фрагменты муцина MUC1, использовали РНК, выделенную из клеток линии MCF-7, и специфические праймеры: USTR_R - для кДНК(^^) и CT_R -для кДНК(^й).

Для наработки кДНК использовали РНК, выделенную из клеток линии HeLa и HT-29. кДНК(GAPDH) получали с использованием олигонуклеотида GAPDH_R. кДНК(MUC1) получали с использованием олигонуклеотида TM_R, кДНК(rMUC1) - с использованием олигонуклеотида FLAG_R.

Получение фрагментов ДНК, кодирующих функциональные фрагменты муцина MUC1

Олигонуклеотиды для получения фрагментов гена муцина выбирали с учетом анализа нуклеотидной последовательности кДНК муцина MUC1 человека [24].

Фрагмент ustr получали при помощи ПЦР с кДНК(ш^) c использованием праймеров USTR_F и USTR_R; фрагмент tmct получали при помощи ПЦР с кДНК(tmct) с использованием праймеров TM_F и CT_R; фрагмент tm получали при помощи ПЦР с кДНК(tmct) с использованием праймеров TM_F(2) и TM_R. Продукты ПЦР разделяли при помощи электрофореза в 1% агарозном геле и очищали из агарозного геля с использованием набора GeneJET Gel Extraction Kit (Thermo Scientific, США). Полученные фрагменты клонировали в составе векторов pUC18 - ustr по сайтам Xhol и HindIII, tm - по сайтам HindIII и BamHI и tmct - по сайту BamHI. В результате были получены плазмиды: pUC18-USTR, pUC18-TM и pUC18-TMCT. Соответствие нуклеотидных последовательностей клонированных фрагментов ожидаемым подтверждали секвенированием.

Фрагмент tr21 получен по методике, разработанной для получения фрагментов, содержащих различное число тандемных повторов из области VNTR гена MUC1 человека [25], и клонирован в векторе pUC18-TR21 (по сайтам HindIII и BamHI).

Создание экспрессионных конструкций, содержащих различные фрагменты гена муцина MUC1

Сборку конструкций осуществляли на основе вектора pEGFP-N3 (Clontech, США). Фрагмент f получен путем отжига олигонуклеотидов FLAG_F и FLAG_R.

Вектор pUSTR-TR-TMCT-EGFP получен в результате последовательного клонирования фрагментов ustr (по сайтам XhoI и HindIII), tr21 (по сайтам

Таблица 1. Олигонуклеотиды, использованные в работе

Название Последовательность 5'^3'

FLAG_F AGCTTGACTACAAGGACGATGACGATAAGA

FLAG_R AGCTTCTTATCGTCATCGTCCTTGTAGTCA

USTR_F ACGTCTCGAGATGACACCGGGCACCCAGT

TM_F TGGGGGATCCGTGCCAGGCTGGGGCAT

TM_F(2) AAGCTTGTGCCAGGCTGGGGCAT

CT_R ACGTGGATCCCCAAGTTGGCAGAAGTGGC

TM_R GCTAGGATCCGCACTGACAGACAGCCAAGGC

USTR_R TGACAAGCTTCCCCAGGTGGCAGCTGAA

GAPDH_F CAAGGTCATCCATGACAACTTTG

GAPDH_R GTCCACCACCCTGTTGCTGTAG

Сайт

автопротеолиза

ШШШШЖ 1

L VNTR DSTR TM CT

Схематическое изображение предшественника природного муцина MUC1

/

\

ШШШ 1 — 1

L U — » TR21 x • TM CT

USTR

EGFP Л

USTR-TR-TMCT-EGFP

USTR USTR-TM-EGFP

EGFP

-г?

Схематическое изображение предшественников рекомбинантных слитых белков

Рис. 1. Расположение основных функциональных доменов в составе природного муцина МиС1 человека и рекомбинантных слитых белков. L - лидерный пептид; VNTR - область вариабельных тандемных повторов; TR21 -21 тандемный повтор из области VNTR; USTR и DSTR - области нерегулярных повторов, расположенные до и после VNTR соответственно; F - FLAG-эпитоп, ТМ - трансмембранный домен, СТ - цитоплазматический домен

F

F

HindIII и BamHI), tmct (по сайту BamHI) и f (по сайту HindIII). Вектор pUSTR-TM-EGFP получен в результате последовательного клонирования фрагментов ustr (по сайтам XhoI и HindIII), tm (по сайтам HindIII и BamHI) и f (по сайту HindIII). Необходимые фрагменты получали рестрикцией векторов pUC18-USTR, pUC18-TM, pUC18-TMCT и pUC18-TR21 с последующей экстракцией из агарозного геля. Таким образом, были получены экспрессионные векторы puSTR-TM-EGFP и pUSTR-TR-TMCT-EGFP, содержащие гены слитых белков uSTR-TM-EGFP и uSTR-TR-TMCT-EGFP соответственно. Схематическое изображение взаимного расположения доменов в составе рекомбинантных белков в сравнении со структурой природного муцина представлено на рис. 1.

Трансфекция

Для трансфекции клеток использовали вектор pEGFP-N3, а также плазмиды pUSTR-TM-EGFP и puSTR-TR-TMcT-EGFP. Трансфекцию клеток линии HT-29 осуществляли методом электропорации с использованием прибора Gene Pulser Xcell Total System (Bio-Rad, США). В двухмиллиметровую кювету для электропоратора вносили 20 мкл раствора плазмидной ДНК (0.4 мкг/мкл) и 180 мкл клеточной суспензии (5 млн клеток/мл), перемешивали и подвергали действию электрического поля

(500 В/см, 10 импульсов по 1 мс). Клетки высевали в культуральные чашки и растили в полной среде DMEM в течение 3 дней, затем промывали раствором ДФСБ, добавляли свежую среду DMEM, содержащую антибиотик G418 (700 мкг/мл), и культивировали в течение 10-14 дней. Наиболее ярко светящиеся колонии отбирали и помещали в лунки 96-луночного планшета. Стабильно трансфицированные клетки анализировали при помощи проточного цитофлуориметра (BD FACS AriaIII, США).

Проточная цитофлуориметрия

Для анализа на проточном цитофлуориметре клетки трижды промывали раствором ДФСБ и ресу-спендировали в растворе ДФСБ в количестве около 1 млн клеток/мл.

Флуоресцентная микроскопия

Клетки высевали на стекла и спустя 24 ч анализировали при помощи флуоресцентного микроскопа Nikon Eclipse Ts100 (Nikon, Япония) либо LSM 510 Meta (Carl Zeiss, Германия).

ПЦР в реальном времени

ПЦР проводили с использованием готового мастер-микса Maxima SYBR Green qPCR Master Mix 2X (Thermo Scientific, США), содержащего

Таблица 2. Результаты ПЦР в реальном времени, отражающие содержание мРНК эндогенного муцина в клетках НТ-29 и HeLa

мРНК/линия клеток Средний предельный цикл Среднее начальное количество % по отношению к GAPDH

GAPDH / HeLa 25.42 3214.1 100

GAPDH/ HT-29 24.19 11795.4 100

MUC1 / HeLa 25.35 4007.57 125

MUC1 / HT-29 28.24 265.28 2.25

интеркалирующий агент SYBR Green. Концентрация праймеров в смесях составляла 0.03 мкмоль/л. Для калибровки использовали четыре разведения образцов кДНК - 10, 100, 1000 и 10000 раз. В качестве контроля проводили реакции в отсутствие кДНК, а также со смесью для обратной транскрипции без обратной транскриптазы M-MuLV. Все реакции проводили в трех повторах.

Уровень экспрессии эндогенного MUC1 в нетранс-фицированных клетках определяли с использованием кДНК MUC1 и пары праймеров TM_F/CT_R; уровень экспрессии рекомбинантного муцина MUC1 анализировали с использованием кДНК rMUC1 и праймеров uSTR_F/FLAG_R.

Результаты нормировали по уровню экспрессии гена GAPDH, используя кДНК (GAPDH) и праймеры GAPDH_F/GAPDH_R.

Определение характера роста клеток, экспрессирующих рекомбинантные белки

Клетки каждой стабильной линии - HT-29_EGFP, HT-29_USTR-TM-EGFP и HT-29_USTR-TR-TMCT-EGFP - высевали в культуральные чашки диаметром 3.5 см по 500000 клеток на чашку. После культивирования в течение 3 дней клетки промывали раствором ДФСБ и анализировали характер роста при помощи микроскопа. Количество клеток определяли методом подсчета в камере Горяева.

результаты и обсуждение

Выбор клеточной линии

При выборе клеточной линии для создания необходимых моделей следует учитывать ряд требований.

Поскольку клеточные модели предполагается использовать для изучения свойств молекулы, предположительно, увеличивающей метастатический потенциал клеток, для создания таких моделей следует выбирать клетки с исходно невысокой способностью к метастазированию.

Кроме того, в идеальном случае в клетках не должен экспрессироваться эндогенный муцин MUC1, чтобы избежать неоднозначности результатов. Однако клетки около 90% злокачественных новообразований содержат муцин MUC1, что предполагает использование линии опухолевых клеток с существенно пониженным уровнем экспрессии эндогенного MUC1.

Для выбора клеток важен также тип гликозилиро-вания муцина. В работе, выполненной M.D. Burdick и соавт. в 1997 г. [20], были проанализированы формы гликозилирования рекомбинантного муцина MUC1, выделенного из клеток четырех различных линий. По результатам гибридизации гликопротеида с моноклональными антителами, полученными к наиболее распространенным опухоль-ассоциированным глико-зидным эпитопам, встречающимся у природного муцина, было установлено, что только рекомбинантный муцин, выделенный из клеток линии HT-29, содержит эпитопы sLea и sLex [20], характерные для клеток агрессивных форм опухолей эпителиального происхождения. Согласно опубликованным данным [2], клетки линии HT-29 обладают также низким метастатическим потенциалом.

Мы сравнили уровни экспрессии эндогенного муцина в клетках линий HT-29 и HeLa методом ПЦР в реальном времени.

Известно, что в результате альтернативного сплайсинга мРНК муцина MUC1 в клетках может образоваться несколько изоформ муцина MUC1, в том числе секретируемые [26]. В нашем случае существенной была оценка уровня экспрессии только мембранно-связанных форм данного гликопротеида, поэтому для постановки реакции мы использовали праймеры TM_F и TM_R, отжигающиеся в области кДНК, кодирующей трансмембранный домен MUC1. Результаты определения уровня экспрессии гена MUC1 в клетках линий HT-29 и HeLa представлены в табл. 2.

Результаты ПЦР в реальном времени показывают, что количество мРНК муцина MUC1 в клетках ли-

USTR

TR21

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

(показано 5 повторов)

TSAPD|TRPAGSTAPPAHGVTSAPDIRPAP. . .

TM

KLGWGIALLVLVCVLVALAIVYLIALAVgia®

СТ

ККЮЇУЄОЬОІЕРАКОТУНРМЗЕУРТЇНТНЄРУУРРЗЗТОРЗРУЕКУЗАЄКССЗЗІїЗЇТНРАУААТЗАШі

Рис. 2. Первичная структура фрагментов муцина МиС1, использованных при создании конструкций. Голубым цветом выделены потенциальные сайты О-гликозилирования, зеленым - последовательность, закрепляющая белок в плазматической мембране. Красным шрифтом выделена последовательность лидерного пептида

нии НТ-29 приблизительно на два порядка ниже, чем в клетках линии HeLa. Это свидетельствует о невысоком базовом уровне экспрессии гена МиС1 в клетках линии НТ-29.

Таким образом, на основании опубликованных данных и результатов собственных экспериментов для создания моделей опухолевых клеток, экспрессирующих рекомбинантные белки, содержащие определенные функциональные фрагменты муцина МиС1 человека, мы выбрали линию клеток НТ-29.

Создание модельных конструкций

При изучении роли различных функциональных фрагментов МиС1 большинство исследователей, как правило, используют ДНК, кодирующую природный МиС1 [27-29]. Однако природный МиС1 представляет собой гетеродимер, в котором экстра-целлюлярная П-концевая субъединица соединена с мембранно-связанной при помощи стабильных нековалентных взаимодействий. Данные взаимодействия могут нарушаться, что приводит к «сбрасыванию» П-концевой субъединицы с поверхности клетки [30]. Диссоциация в ходе исследования субъединицы белка, содержащей область экстрацеллюлярного домена муцина, может приводить к искажению получаемых результатов. Таким образом, нам нужно было сконструировать гены рекомбинантных белков, которые не имеют сайтов автопротеолиза, но содержат необходимые функциональные фрагменты.

Основное отличие опухоль-ассоциированного муцина МиС1 заключается в наличии определенных

гликозидных эпитопов на поверхности экстрацел-люлярного домена: углеводные компоненты молекулы, как предполагается, вовлечены во взаимодействие с молекулами внеклеточного матрикса и, как следствие, участвуют в процессе метастази-рования. Следовательно, конструируемый рекомбинантный белок обязательно должен содержать фрагменты внеклеточного домена, несущие сайты О-гликозилирования. Большое количество остатков Ser и Thr, к которым, предположительно, присоединяются олигосахариды, располагается в области тандемных повторов (VNTR) - каждый повтор, содержащий 20 аминокислотных остатков, включает в себя пять потенциальных сайтов О-гликозилирования. Следуя методике, разработанной для конструирования фрагментов, кодирующих различное количество повторов из области VNTR муцина MUC1 человека [25], был получен фрагмент, кодирующий 21 тандемный повтор (рис. 2).

Кроме того, большое количество потенциальных сайтов О-гликозилирования характерно для областей вырожденных повторов (USTR и DSTR). Поскольку область DSTR содержит сайт автопротеолиза, этот фрагмент при конструировании не использовали. В то же время для создания конструкций необходимо было получить фрагмент ДНК, кодирующий последовательность USTR (см. рис. 2).

Наконец, для того чтобы экстрацеллюлярный домен MUC1, входящий в состав рекомбинантных белков, был экспонирован во внеклеточное пространство, он должен содержать, по меньшей мере, трансмем-

бранный домен (ТМ) и последовательность CQC, обеспечивающую мембранную локализацию гликопротеида [31]. Аминокислотная последовательность трансмембранного домена приведена на рис. 2.

Нуклеотидная последовательность, кодирующая цитоплазматический домен (СТ, см. рис. 2), необходима для конструирования гена «полноразмерного» муцина, лишенного только области, кодирующей сайт автопротеолиза и часть вырожденных повторов.

Фрагменты, кодирующие USТR, ТМ и СТ муцина МиС1 человека, были амплифицированы с кДНК муцина МиС1, синтезированной на суммарной мРНК из клеток рака молочной железы MСF-7.

С использованием перечисленных выше фрагментов были созданы две экспрессионные конструкции, содержащие гены химерных белков, слитых на С-конце с EGFP, - «полноразмерного» МиС1 (pUSТR-ТR-ТMСТ-EGFP) и лишенного тандемных повторов и цитоплазматического домена (pUSТR-ТM-EGFP) (рис. 1).

Между областью тандемных повторов и фрагментом, кодирующим вырожденные повторы, мы дополнительно ввели последовательность, кодирующую FLAG-эпитоп, чтобы иметь возможность выявлять П-концевую область рекомбинантных белков при помощи специфических антител.

Получение и характеристика клеточных моделей

Экспрессию рекомбинантных белков анализировали при помощи проточной цитофлуориметрии в стабильно трансфицированных клетках линии НТ-29 по флуоресценции EGFP (рис. 3).

Уровень экспрессии рекомбинантного муцина (гМиС1) в стабильно трансфицированных клетках определяли методом ПЦР в реальном времени и сравнивали с экспрессией гена домашнего хозяйства GAPDH. Результаты определения уровня экспрессии генов рекомбинантных белков в стабильно трансфицированных клетках линии НТ-29 представлены в табл. 3.

Показано, что содержание мРНК рекомбинантных белков USТR-ТM-EGFP и USТR-ТR-ТMСТ-EGFP в стабильно трансфицированных клетках НТ-29_ USТR-ТM-EGFP и HТ-29_USТR-ТR-ТMСТ-EGFP составляет приблизительно 20% от содержания мРНК GAPDH. Учитывая, что содержание мРНК эндогенного муцина МиС1 в клетках линии НТ-29 составляет 2.25% (табл. 2), можно сделать вывод, что в стабильно трансфицированных клетках линии НТ-29 мРНК рекомбинантного муцина составляет примерно 85% всей мРНК МиС1 (рекомбинантного и эндогенного).

Анализ локализации рекомбинантных белков методом флуоресцентной микроскопии показал, что в клетках HТ-29_EGFP наблюдается цитоплазма-

о

и

HT-29 EGFP

; HT-29

102 1 1 1 1 Ml| 103 FITC-A 11 ■ > | 104 mf i 105

FITC-A FITC-A FITC-A FITC-A

Population #Events %Parent Min Max Median %CV

P2 8,215 62,6 -211 157,977 13,138 70,8

P3 8,182 99,6 92 157,977 13,178 70,4

. .PS 19 0,2 5 177 96 44,6

о

и

102 103 FITC-A 1 1111 I 104 і і і і i ТТ| Г- 105

FITC-A FITC-A FITC-A FITC-A

Population #Events %Parent Min Max Median %CV

P2 10,501 71,2 2 20,860 4,088 56,7

P3 10,402 99,1 91 20,860 4,109 55,6

P5 68 0,6 2 199 61 58,2

о

и

о 102 103 FITC-A 104 105

FITC-A FITC-A FITC-A FITC-A

Population #Events %Parent Min Max Median %CV

P2 10,444 65,3 22 34,166 4,045 54,4

P3 10,395 99,5 84 34,166 4,058 53,9

P5 40 0,4 22 126 60 38,8

Л

Рис. 3. Флуоресценция клеток НТ-29, стабильно трансфицированных векторами pEGFP-N3 (А), pUSTR-TM-EGFP (Б), pUSTR-TR-TMCT-EGFP (В)

тическая и ядерная локализация сигнала в зеленой области спектра (рис. 4А), в то время как в клетках HТ-29_USТR-ТM-EGFP и HТ-29_USТR-ТR-ТMСТ-EGFP сигнал преимущественно локализуется в области плазматической мембраны (рис. 4Б,В).

Б

В

' z

x

10 мкм torn*. у

Л

Б

В

Рис. 4. Локализация флуоресценции EGFP в стабильно трансфицированных клетках линии НТ-29. А - HT-29_EGFP, Б - HT-29_USTR-TM-EGFP, В - HT-29_USTR-TR-TMCT-EGFP. Верхняя и боковая панели каждого изображения показывают оптический срез трехмерного изображения в плоскости xz и yz соответственно

Таблица 3. Результаты ПЦР в реальном времени, отражающие содержание мРНК рекомбинантных белков в стабильно трансфицированных клетках линии №-29

мРНК/линия клеток Средний предельный цикл Среднее начальное количество % по отношению к GAPDH

GAPDH / HT-29_EGFP 14.30 730.65 100

GAPDH / HT-29_USTR-TM-EGFP 1 12.76 1922.36 100

GAPDH / HT-29_USTR-TR-TMCT-EGFP 13.21 1347.97 100

rMUC1 / HT-29_EGFP-N3 22.62 0.94 0.129

rMUC1 / HT-29_USTR-TM-EGFP 1 14.34 373.82 19.446

rMUC1/HT-29_USTR-TR-TMCT-EGFP 14.75 278.03 20.626

Анализ трехмерных изображений, полученных с применением конфокальной микроскопии, показал, что белки, содержащие фрагменты муцина, слитые с EGFP, имеют преимущественно периферическую мембранную локализацию, в отличие от белка EGFP, ожидаемо детектируемого как в цитоплазме, так и в ядре (рис. 4, верхняя и боковая панели каждого изображения).

Наконец, нами установлено различие в характере роста клеток полученных линий. В то время как клетки HТ-29_EGFP по мере роста формируют монослой (рис. 5А), клетки HТ-29_USТR-ТM-EGFP и НТ-29_ USТR-ТR-ТMСТ-EGFP склонны к формированию обособленных «островков» (рис. 5Б,В). Учитывая, что в данном эксперименте на чашки высевали оди-

наковое количество клеток (500000), а после 3 дней культивирования их число также отличалось незначительно, различие в скорости деления можно исключить. Наблюдаемая нами картина является свидетельством различия адгезионных характеристик клеток полученных линий, вызванного присутствием на их поверхности рекомбинантных белков, содержащих фрагменты муцина МиС1.

заключение

На базе клеток линии НТ-29 получены клеточные модели, экспрессирующие слитые с EGFP белки, представляющие на внешней поверхности клеток фрагменты экстрацеллюлярного домена муцина МиС1 человека, несущие сайты О-гликозилирования.

А Б В

Рис. 5. Влияние экспрессии рекомбинантных белков на характер роста стабильно трансфицированных клеток линии №-29 в культуре. А - клетки, экспрессирующие EGFP, Б - клетки, экспрессирующие USTR-TM-EGFP,

В - клетки, экспрессирующие USTR-TR-TMCT-EGFP

Основное различие полученных нами моделей заключается в наличии или отсутствии в структуре рекомбинантных белков области, содержащей 21 тандемный повтор. Эти модели отличаются высоким уровнем экспрессии рекомбинантных белков на фоне низкой экспрессии эндогенного муцина МиС1. Характер роста модельных клеток отличается от роста клеток, экспрессирующих EGFP.

Авторы выражают благодарность И.А. Воробьеву (кафедра клеточной биологии и гистологии биологического факультета МГУ им. М.В. Ломоносова), а также А.Ю. Архиповой, А.А. Рамоновой и М.М. Мойсеновичу (кафедра

биоинженерии биологического факультета

МГУ им. М.В. Ломоносова) за содействие и помощь в проведении экспериментов.

Работа выполнена с использованием оборудования, приобретенного за счет средств программы развития МГУ им. М.В. Ломоносова (клеточный сортер FACSAria SORP (BD), конфокальный микроскоп Carl Zeiss LSM 510 Meta).

Работа поддержана Министерством образования и науки РФ (соглашение № 8800) и РФФИ (гранты № 12-04-33031, 12-04-31338, 12-04-31721,13-04-01875).

СПИСОК ЛИТЕРАТУРЫ

1. Wyld L., Gutteridge E., Pinder S.E., James J.J., Chan S.Y., Cheung K.L., Robertson J.F., Evans A.J. // Br. J. Cancer. 2003. V. 89. № 2. P. 284-290.

2. Haier J., Nasralla M., Nicolson G.L. // Br. J. Cancer. 1999. V. 80. № 12. P. 1867-1874.

3. Doerr M.E., Jones J.I. // J. Biol. Chem. 1996. V. 271. № 5.

P. 2443-2447.

4. Varki A. // Proc. Natl. Acad. Sci. USA. 1994. V. 91. № 16.

P. 7390-7397.

5. Qi J., Chen N., Wang J., Siu C.H. // Mol. Biol. Cell. 2005. V. 16.

№ 9. P. 4386-4397.

6. Hilkens J., Ligtenberg M.J., Vos H.L., Litvinov S.V. // Trends Biochem. Sci. 1992. V. 17. № 9. P. 359-363.

7. Dong Y., Walsh M.D., Cummings M.C., Wright R.G., Khoo S.K., Parson P.G., McGuckin M.A. // J. Pathol. 1997. V. 183. № 3. P. 311-317

8. Hinoda Y., Ikematsu Y., Horinochi M., Sato S., Yamamoto K., Nakano T., Fukui M., Suehiro Y., Hamanaka Y., Nishikawa Y., et al. // J. Gastroenterol. 2003. V. 38. № 12. P. 1162-1166.

9. McGuckin M.A., Walsh M.D., Hohn B.G., Ward B.G., Wright R.G. // Hum. Pathol. 1995. V. 26. № 4. P. 432-439.

10. Li Y., Ren J., Yu W., Kuwahara H., Yin L., Carraway K.L. 3rd, Kufe D. // J. Biol. Chem. 2001. V. 276. № 38. P. 35239-35242.

11. Schroeder J.A., Adriance M.C., Thompson M.C., Camenisch T.D., Gendler S.J. // Oncogene. 2003. V. 22. № 9. P. 1324-1332.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

12. Burchell J., Taylor-Papadimitriou J., Boshell M., Gendler S., Duhig T. // Int. J. Cancer. 1989. V. 44. № 4. P. 691-696.

13. Rahn J.J., Chow J.W., Horne G.J., Mah B.K., Emerman J.T., Hoffman P., Hugh J.C. // Clin. Exp. Metastasis. 2005. V. 22. № 6. P. 475-483.

14. Bernier A.J., Zhang J., Lillehoj E., Shaw A.R., Gunasekara N., Hugh J.C. // Mol. Cancer. 2011. V. 10. № 93. P. 1295-1304.

15. Roy L.D., Sahraei M., Subramani D.B., Besmer D., Nath S., Tinder T.L., Bajaj E., Shanmugam K., Lee Y.Y., Hwang S.I., et al. // Oncogene. 2011. V. 30. № 12. P. 1449-1459.

16. Bafna S., Kaur S., Batra S.K. // Oncogene. 2010. V. 29.

№ 20. P. 2893-2904.

17. Ren J., Bharti A., Raina D., Chen W., Ahmad R., Kufe D. // Oncogene. 2006. V. 25. № 1. P. 20-31.

1B. Wei X., Xu H., Kufe D. // Cancer Cell. 2005. V. 7. № 2.

P. 1б7—178.

19. Nakamori S., Kameyama M., Imaoka S., Furukawa H., Ishikawa O., Sasaki Y., Izumi Y., Irimura T. // Dis. Colon. Rectum. 1997. V. 40. № 4. P. 420-431.

20. Burdick M.D., Harris A., Reid C.J., Iwamura T., Hollingsworth M.A. // J. Biol. Chem. 1997. V. 272. № 39.

P. 2419B—24202.

21. Julien S., Lagadec C., Krzewinski-Recchi M.A., Courtand G., Le Bourhis X., Delannoy P. // Breast Cancer Res. Treat. 2005. V. 90. № 1. P. 77—84.

22. Gong E., Hirohashi S., Shimosato Y., Watanabe M., Ino Y., Teshima S., Kodaira S. // J. Natl. Cancer Inst. 19B5. V. 75. № 3. P. 447—454.

23. Inufusa H., Kojima N., Yasutomi M., Hakomori S. // Clin. Exp. Metastasis. 1991. V. 9. № 3. P. 245—257.

24. Gendler S.J., Lanscater C.A., Taylor-Papadimitriou J., Duhig T., Peat N., Burchell J., Pemberton L., Lalani E.N., Wilson D. // J. Biol. Chem. 1990. V. 2б5. № 25. P. 1528б—15293.

25. Гулько Л.Б., Павлова О.В., Дьяков Н.А., Окорокова Н.А., Ратманова К.И., Логунова Н.Н., Бобренева Р. А., Макаров В.А., Юрин В.Л., Вейко В.П. и др. // Биоорган. химия. 2000. Т. № б. С. 423—432.

26. Imbert Y., Darling D.S., Jumblatt M.M., Foulks G.N., Couzin E.G., Steele P.S., Young W.W. Jr. // Exp. Eye Res. 200б. V. 83. № 3. P. 493—501.

27. Ligtenberg M.J., Kruijshaar L., Buijs F., van Meijer M., Litvinov S.V., Hilkens J. // J. Biol. Chem. 1992. V. 2б7. № 9.

P. б171—б177.

2B. Schroeder J.A., Thompson M.C., Gardner M.M., Gendler S.J. // J. Biol. Chem. 2001. V. 27б. № 1б. P. 13057—130б4.

29. Rahn J.J., Shen Q., Mah B.K., Hugh J.C. // J. Biol. Chem.

2004. V. 279. № 2B. P. 2938б—29390.

30. Julian J., Dharmaraj N., Carson D.D. // J. Cell. Biochem.

2009. V. 10B. № 4. P. 802—815.

31. Pemberton L.F., Rughetti A., Taylor-Papadimitriou J., Gendler S.J. // J. Biol. Chem. 199б. V. 271. № 4. P. 2332—2340.

i Надоели баннеры? Вы всегда можете отключить рекламу.