CC BY
33For citation: Badamsuren B., Batjargal D., Baatartsogt O. Genetic diversity analysis of Mongolian native sheep and other sheep breeds based on microsatellite marker //
URL: http://rectors.altstu.rU/ru/periodical/archiv/2021/1/articles/2_2.pdf DOI: 10.25712/ASTU.2410-485X.2021.01.010
UDK 636.082
Genetic diversity analysis of Mongolian native sheep
AND OTHER SHEEP BREEDS BASED ON MICROSATELLITE MARKER*
B. Badamsuren1, D. Batjargal1, O. Baatartsogt1 *
1 Department of Biotechnology and Breeding, Mongolian University of Life Sciences, Ulaanbaatar, Mongolia.
E-mail: baatartsogt.muls.edu.mn
1. Materials and methods
Experiment in the laboratory: Animal material and DNA isolation
We selected four Mongolian indigenous and five imported sheep populations for investigation in this study. Blood samples were randomly collected from 270 sheep belonging to nine different sheep breeds reared in Mongolia. Approximately 4.5ml blood samples were gathered from the vena jugular in K3-EDTA tubes and transferred -20°C freezer. The location and sample sizes of these 9 breeds are given in Figure 1. Total genomic DNA was extracted from blood samples using a DNeasy Blood &Tissue Kit (Qiagen) protocol in the accompanying handbook. Purity and concentration of each sample was quantified using spectrophotometer NanoDrop 2000, spectrophotometer (Thermo Scientific, USA). DNA quality was tested using 1% agarose gel electrophoresis.
We applied three methods as follow
Microsatellite polymorphism detection and genotyping
The selected microsatellites were amplified with PCR using genomic DNA extracted from individual animals (in total 25^l). The mixture included 5^l of PCR buffer, 4^l of dNTP mix, 1.6^l of Taq DNA polymerase, 1.8^l of D.W and 6^l of template DNA. The reaction conditions were 95°C for 15min; 36 cycles of 94°C for 1min; annealing temperature, different for each primer (Table1), for 72°C for 1min 15s; and final extension at 65°C for 30min. Animals were genotyped using 7 DNA markers (CSRD2108, CSRD2105, CSRD129, CSRD2148, MCM527, CSRD247 and MCM147).
* The study was carried out with the financial support of the Russian Foundation for Basic Research and the Ministry of Culture, Education, Science and Sports of Mongolia in the framework of the scientific project №19-510-44011 Mong_t «Development of the concept of organic agriculture based on progressive methods and technologies» // fflyrx(0Xy)-2019/02, «Development of a concept for the development organic agriculture, based on the advanced methods and technologies», Mongolian-Russian joint project, Mongolian Science and Technology Foundation.
J
„J"" т.
Native Mongolian n=30
... „_ Suffolk Edclbay Berithon du Cher Romanov Merino, n=30 _ ,n
J |_n=30_| |_n=30 | |_n= 30_J _n=30_
Figure 1. Breeds of sheep examined in this study
Table 1. Primer sequences of the 7 microsatellites
Number of primer pair Ch.no Direction of primer Primer sequence (5 '^3 ') Annealing temperature (°C) Range of allele size (bp)
CSRD2108 l Forward Reverse CATGGAATCACAAAGAGTTGACA CCTGGTAAGACAGTCAGTATACAA 55 ll7-l27
CSRD2105 2 Forward Reverse AGTAGTGGAACCCAGATTGAAACC CAGGAATTTTACAGGCACAGAATC 55 162-190
CSRD129 8 Forward Reverse CAGCACATTAGTCAGTTTGGCATC ATAAGGAGAATCTGAAGAGCCAAG 55 148-170
CSRD2148 23 Forward Reverse GAGAAGTGGTCAACAGAGGATGAG TACAGAGAAGCACAAAGAGATGGG 55 400-500
MCM527 5 Forward Reverse GTCCATTGCCTCAAATCAATTC AAACCACTTGACTACTCCCCAA 56 l65-l87
CSRD247 l4 Forward Reverse GGACTTGCCAGAACTCTGCAAT CACTGTGGTTTGTATTAGTCAGG 55 220-246
MCM147 2 Forward Reverse TCCGATGTTAGATGACTTTTGTGC AGCTGGTATCTGTGTCTGTCATCC 55 l77-223
The amplified DNA was genotyped using an automated Genetic Analyzer 3130xl (Applied Biosystems, USA). The genotyping reaction contained of PCR products, 8.9^l of Hi-Di formamide and 0.1^1 of GeneScan-500LIZ size standard in 10^1 total volume. The genotyping results were obtained using Genemapper V4.0 (Applied Biosystems, USA).
PCR-RFLP genotyping
The DNA amplification of the CAST gene was achieved by PCR-RFLP. Two primer pairs CAST1C [5'-TGGGGCCCAATGACGCCATCGATG-3'(forward) and CAST1D [5'-GGTGGAGCAGCACTTCTGATCACC-3' (reverse)] targeting a fragment of 622bp were employed as for identification of the A and B alleles of CAST. The PCR amplification reaction solution was performed in total volume 10^l containing 6.7^l ddHiO, 0.8^l of dNTP, DNA (20ng/^L), 0.2^l of each primer,
Barga n=30
1 ^l of PCR buffer and 0.1^l of Taq DNA polymerase. The PCR cycling condition was carried out in the following conditions of 95°C for 10 min, followed by 1 cycle of denaturing at 95°C for 30s, annealing at 56°C for 40s, and extension at 72°C for 1 min followed by 30 cycles and 10 min at 72°C as a final extension. The amplified fragment of CAST was digested by the restriction MspI. Digestion was conducted at 37°C for 3h and in 20^l reaction solution including 7.5^l ddH2O, 2^l of 10X buffer Tango, 0.5^l of MspI and 10^l PCR product. The PCR and digestion products were electrophoresed on 4% methapor gel in 1X TBE and visualized by staining for 90min at 150 V. Association of CAST genotypes with body weight.
PCR amplification and mt-DNA sequencing
A segment of 1180 basepairs (bp) was amplified by the polymerase chain reaction (PCR) containing the mtCR (positions 15,437-16,616 GenBank accession number AF010406, Hiendleder et al. 2002). The amplification reactions were performed in 2^l containing 20ng of total sheep DNA, 0.8^l for each of the forward primer Mit3 (5'ATATACTGGTCTTGTAAACC3'positions 15,320-15,339) and reverse primer Mit4 (5'AGGCATTTT CAGTGCCTTG3'positions 24-42), 1.6 of dNTPs and 0.6^l of TaqDNA Polymerase. The amplification conditions included an initial step at 95 °C for 11min, followed by 30 cycles of 94 °C for 40s, 58°C for 40s and 72°C for 1min and a final step of 60°C for 3 min. The amplified mtCR fragments were purified with silica beads after electrophoresis in 1% agarose gel. The purified DNA fragments were quantified and 1180 bp of nucleotide sequence was obtained from both DNA strands using a commercial kit following the manufacturer's protocol (BigDye Terminator v3.1 Cycle Sequencing Kit PE Applied Biosystems, Foster, CA).
Statistical analysis
The genotyped data was analyzed using Excel MS toolkit version 3.1 (Park, 2001), Association of CAST gonotypes locus MspI with body weight were analyzed with the using Anova, Phylogenetic tree were constructed with neighbor-joining (Saitou&Nei 1987) software Mega7 and seqman software.
Research results
Result of genetic diversity analysis of Mongolian sheep breeds using microsatellite markers
In this result sheep breeds showed the most diverse to be Barga, which had 65 alleles, while
Edilbay red showed the least diversity with a total of 43 alleles.
Table 2. Number of alleles of each polymorphic microsatellite
in the different sheep breeds.
Population CSRD129 CSRD2105 CSRD247 CSRD2148 MCM527 MCM147 CSRD2108
SF 8 6 6 7 6 8 4
BD 8 8 6 8 6 6 3
MR 10 6 9 10 8 9 2
ER 7 7 8 6 5 8 2
Population CSRD129 CSRD2105 CSRD247 CSRD2148 MCM527 MCM147 CSRD2108
EB 10 7 7 5 9 11 5
Ro 7 9 6 7 6 8 5
TS 10 10 7 9 6 15 4
UZ 10 6 8 12 7 14 5
Ba 11 7 11 12 9 12 3
Mo 10 6 9 11 7 11 3
Total (mean) 9.1 7.2 7.7 8.7 6.9 10 3.6
(Hexp and Hobs) and PIC ranged from (Ro) 0.699 to 0.822 (Ts), 0.695 (Ro) to 0.806 (ER), and 0.644 (Ro) to 0.778 (TS), respectively. The main values of Hexp, Hobs and PIC overall loci and breeds 0.747, 0.735 and 0.698 respectively. Ts and ER breeds showed the most probable heterozygosity, and the Ro breed showed the lowest known heterozygosity among each of the 9 breeds (Table2).
Table 3. Hexp and Hobs for microsatellite markers in the 9 sheep breeds.
Population No.of samples Hexp Hobs PIC
SF 25 0.704 0.674 0.658
BD 26 0.705 0.659 0.648
MR 24 0.73 0.779 0.678
ER 15 0.758 0.806 0.686
EB 15 0.77 0.738 0.718
Ro 28 0.699 0.695 0.644
TS 25 0.822 0.772 0.778
UZ 26 0.781 0.751 0.744
Ba 26 0.764 0.727 0.73
Mo 23 0.738 0.752 0.694
Total 233 0.747 0.735 0.698
PIC value across the 7 microsatellite markers ranged from 0.386 (CSRD2108) to 0.803 (MCM147). MCM147 and CSRD2148 marker seem the most effective of those tested for analyzing polymorphism in the sheep populations. The Hobs per locus ranged from 0.520 (CSRD2108) to 0.963 (MCM147) with an average of 0.735 (Table3).
Table 4. Hexp and Hobs, PIC for 7 microsatellite markers in the sampled population
Marker No.of Alleles Hexp Hobs PIC
CSRD129 14 0.804 0.787 0.763
CSRD2105 15 0.778 0.777 0.727
CSRD247 16 0.783 0.677 0.733
CSRD2198 17 0.822 0.725 0.776
MCM527 12 0.749 0.698 0.697
MCM147 18 0.845 0.963 0.803
CSRD2180 5 0.450 0.520 0.386
Mean 13.8 0.747 0.735 0.698
The phylogenetic tree showed the closest genetic distance was between EB and TS breeds and the most distance between EB and MR breeds. Also showed the closest genetic distance was between BD and MR, UZ and Mo.
Figure 2. Genetic differentiation among populations
Phylogenetic tree showing the genetic distances among the 9 breeds using Nei's DA genetic distance on the basis of alleles frequencies from the 7 microsatellite loci. The number on the branches indicate percentage occurrence in 1000 bootstrap replicates.
Result of polymorphism of CAST gene in sheep using PCR-RFLP
The amplified CAST resulted in DNA fragment with 622bp. CAST locus MspI had three genotypes including in AA, AB and BB with frequencies of 0.6, 0.3, and 0.04 respectively. In population of sheep it was detected three genotypes. The homozygous genotype AA (336 bp, 286 bp) was detected in 136 sheep. The heterozygous genotype AB (622 bp, 336 bp, 286 bp) was detected in 94 sheep. The homozygous genotype BB (622 bp) was detected in 1 sheep.
622bp
Figure 3. PCR product of CAST gen analyzed by electrophoresis (622 bp)
Ml 2 3 4 5 6 7 8 9 10 1112 13 14 1516 17 18 19 M
Figure 4. Representatively results of analysis PCR-RFLP for CAST gene by restriction enzyme MspI on 1% agarose gel. L=ladder 100 bp (Fermentas), MM genotype (622 bp), MN genotype
(622 bp, 336 bp, 286 bp)
There was no significant effects (P>0.05) of CAST locus MspI genotype on body weight of sheep breeds.
The present data did not show any influences of CAST genotypes on the body weight of sheep, but may have influence for meat quality.
Table 5. The result of association analysis of CAST gene with bodyweight
df SS MS F-value P-value R2
Breed 9 53458 5939.8 80.275 2.20E-16 0.789
CAST MSP1 2 238 119.2 1.61 0.2022
Sex 1 6569 6569 88.785 2.20E-16
Residuals 218 16131
s -
U AS il»
CAST_MSP*
Figure 5. The association between the bodyweight of the sheep and the calpastatin gene (Coefficient Plot with Boxplot)
Result of genetic diversity of Mongolian sheep based on mtDNA D-loop sequences
>112 3 4 5 6 7 8 9 10 II 12 13 14 15 16 17 18 19 20
Figure 6. PCR product analyzed by electrophoresis (1100 bp)
Tsagaan-Uul
Berichon Du Cher
Suffolk
^^tSMJijjjjlg'
Suffolk
Romanov
Figure 7. Neighbor-joining tree of 98 sequences of 9 breeds including MNS and other foreign sheep breeds in Mongolia
In this study, the genetic diversity and phylogenetic relationship of 270 individual Mongolian sheep from nine populations were assessed using 96 complete sequences of the mtDNA D-loop. The fragment at 1100bp from sheep mtDNA were amplified using specific primers for sheep mtDNA.
Table 6. Proportions of the haplogroups in the sheep breeds
Breed Haplotype number Haplogroup Nucleotide diversity tt Haplotype diversity Hd±SD
A B C
Barga 24 15 (60.0%) 6 (24.0%) 4 (16.0%) 0.018 0. 997±0.023
Mongol 24 10 (41.7%) 8 (33.3%) 6 (25.0%) 0.021 0.996±0.023
Tsagaan-Uul 23 10 (43.5%) 11 (47.8%) 2(8.7%) 0.017 1 ±0.027
Uzemchin 25 21 (73.3%) 1 (6.67%) 3 (20.0%) 0.032 0.981 ±0.031
Edelbay 26 20 (62.5%) 2 (12.5%) 4 (25.0%) 0.035 0.992±0.025
Suffolk 21 11 (50.0%) 11 (50.0%) 0 (0.0%) 0.016 0.996±0.023
Merino 24 19 (64.2%) 5 (35.6%) 0 (0.0%) 0.036 0.989±0.031
Berichon-Ducher 25 10 (40%) 12 (48%) 3 (12%) 0.038 0.983±0.028
Romanov 24 5 (20%) 18 (72%) 2 (8%) 0.036 0.978±0.035
Total 216 121 (55.2%) 74 (33.7%) 24(10.9%) 0.0276 0.991+0.027
This tree declared the presence of mixing haplotypes between the 96 individual populations but still there are some separated haplotypes especially Suffolk, Tsagaan-Uul and Romanov sheep in contrast to other sheep haplotypes which mixed with each other. In this study most of the sheep breeds haplotypes do not show a clear relationship with the phylogeny; haplotypes found in a particular breed are scattered all over the dendrogram.
We determined three well-resolved haplogroups (A, B and C) in the sheep breeds. Haplogroup A dominated (n=121 of 216 animals), followed by haplogroups B (n=74), and C (n=24) (Table 6).
Conclusions
Tsagaan-Uul breed has high genetic diversity and genetically distinct from other breeds. MCM147 and CSRD2148 marker seem the most effective of those tested for analyzing polymorphism in the sheep populations. Gene of CAST locus MspI were polymorphic in these sheep breeds. The CAST locus MspI had three genotypes AA, AB and BB with frequencies of 0.6, 0.3 and 0.04 respectively. The genotypes of CAST gene locus MspI did not significantly effect on body weight of sheep. Haplogroups A, B and C of sheep, with a high level of haplotype diversity and moderate to high nucleotide diversity.
