Научная статья на тему 'ФИЗИОЛОГИЧЕСКОЕ И МЕТАБОЛИЧЕСКОЕ ЗНАЧЕНИЕ ФИТОБИОТИКОВ В КОРМЛЕНИИ ЖВАЧНЫХ ЖИВОТНЫХ (ОБЗОР)'

ФИЗИОЛОГИЧЕСКОЕ И МЕТАБОЛИЧЕСКОЕ ЗНАЧЕНИЕ ФИТОБИОТИКОВ В КОРМЛЕНИИ ЖВАЧНЫХ ЖИВОТНЫХ (ОБЗОР) Текст научной статьи по специальности «Животноводство и молочное дело»

CC BY
76
29
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
КОРМЛЕНИЕ ЖВАЧНЫХ ЖИВОТНЫХ / ФИТОБИОТИКИ / РАСТИТЕЛЬНЫЕ ЭКСТРАКТЫ / МЕТАБОЛИЗМ ЖВАЧНЫХ ЖИВОТНЫХ

Аннотация научной статьи по животноводству и молочному делу, автор научной работы — Цис Е.Ю.

Актуальность. В последние годы применение в составе рациона сельскохозяйственных животных растительных экстрактов, стимулирующих жизненно важные функции организма для предотвращения негативного влияния, связанного с современными технологиями содержания животных в условиях животноводческих комплексов, имеет большой исследовательский интерес. Кроме этого, несмотря на выпуск новых антибиотических препаратов, применение оптимальных схем лечения при заболеваниях крупного рогатого скота различной этиологии, а также лечение осложнений, вызываемых этими препаратами, по-прежнему являются наиболее сложной и трудноразрешимой проблемой в животноводстве. В этой связи возникает необходимость изучения эффективности применения растительных компонентов, не вызывающих лекарственной устойчивости и обладающих антимикробной способностью и при этом обеспечивающих нормализацию обмена веществ, увеличение и сохранение полезной микрофлоры кишечника для получения экологически безопасной продукции. Целью настоящего обзора является оценка современного состояния эффективности применения растительных компонентов на физиологические процессы, метаболизм, продуктивность крупного рогатого скота. Материалы и методы. На основе анализа рецензируемых научных публикаций ведущих российских (https://www.elibrary.ru) и зарубежных баз данных (Scopus, Web of Science Core Collection, Viley Online Library), базы данных авторефератов и диссертаций (disserCat), монографий, рекомендаций с применением общепринятого метода консолидации данных ряда различных исследований, изучающих состав, свойства растительных компонентов, а также современных научных разработок были проведены анализы: сравнительный и экономико-статистический и обобщение результатов использования этих компонентов в кормлении жвачных животных. Результаты и выводы. Возможности использования растительных компонентов разнообразны. Несмотря на существенную разницу в химическом составе экстрактов из разных сегментов растений, они проявляли сходные, но значительные антибактериальные эффекты в отношении грамположительных и грамотрицательных бактерий, что подчеркивает важность их применения для лечения различных бактериальных инфекций и обосновывают широкое применение в качестве нормализации микрофлоры желудочно-кишечного тракта, повышения резистентности организма. Их применение не влечет за собой столь серьезных последствий, как применение антибиотиков. Растительные компоненты и их более широкое практическое применение, несомненно, станут предметом дальнейших исследований и будут иметь решающее значение, доказывая главным образом эффективность их применения, а также обеспечивая безопасность в отношении здоровья животных, качества продуктов животного происхождения и окружающей среды.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по животноводству и молочному делу , автор научной работы — Цис Е.Ю.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

PHYSIOLOGICAL AND METABOLIC SIGNIFICANCE OF PHYTOBIOTICS IN RUMINANTS (REVIEW)

Introduction. In recent years, the use of plant extracts in the diet of farm animals that stimulate vital functions of the body to prevent the negative effects associated with modern technologies of keeping animals in livestock complexes has great research interest. In addition, despite the release of new antibiotic drugs, the use of optimal treatment regimens for diseases of cattle of various etiologies, as well as complications caused by them, is still the most difficult and intractable problem in animal husbandry. In this regard, there is a need to study the effectiveness of the use of herbal components that do not cause drug resistance and have antimicrobial ability, while ensuring the normalization of metabolism, increasing and preserving the beneficial intestinal microflora to obtain organically safe products. The purpose of this review is to assess the current state of the effectiveness of the use of plant components on physiological processes, metabolism, productivity of cattle. Materials and methods. Based on the analysis of peer-reviewed scientific publications of leading Russian (https://www.elibrary.ru) and foreign databases (Scopus, Web of Science Core Collection, Viley Online Library), databases of abstracts and dissertations (disserCat), monographs, recommendations using the generally accepted method of consolidating data from a number of different studies studying the composition, properties of plant components, as well as modern scientific developments were analyzed: comparative and economic-statistical analysis and generalization of the use of these components in the feeding of ruminants. Results and conclusions. The possibilities of using plant components are diverse, despite the significant difference in the chemical composition of extracts from different plant segments, they showed similar but significant antibacterial effects against gram-positive and gram-negative bacteria, which emphasizes the importance of their use for the treatment of various bacterial infections and justify their widespread use as normalization of the microflora of the gastrointestinal tract, increasing the body's resistance. Their use does not entail as many serious dangers as the use of antibiotics. Plant components and their wider practical application will undoubtedly become the subject of further research and will be crucial, proving mainly the effectiveness of their use, as well as safety in relation to animal health, the quality of animal products and the environment.

Текст научной работы на тему «ФИЗИОЛОГИЧЕСКОЕ И МЕТАБОЛИЧЕСКОЕ ЗНАЧЕНИЕ ФИТОБИОТИКОВ В КОРМЛЕНИИ ЖВАЧНЫХ ЖИВОТНЫХ (ОБЗОР)»

№ 2 (66) 2022

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

biotic drugs, the use of optimal treatment regimens for diseases of cattle of various etiologies, as well as complications caused by them, is still the most difficult and intractable problem in animal husbandry. In this regard, there is a need to study the effectiveness of the use of herbal components that do not cause drug resistance and have antimicrobial ability, while ensuring the normalization of metabolism, increasing and preserving the beneficial intestinal microflora to obtain organically safe products. The purpose of this review is to assess the current state of the effectiveness of the use of plant components on physiological processes, metabolism, productivity of cattle. Materials and methods. Based on the analysis of peer-reviewed scientific publications of leading Russian (https://www.elibrary.ru) and foreign databases (Scopus, Web of Science Core Collection, Viley Online Library), databases of abstracts and dissertations (disserCat), monographs, recommendations using the generally accepted method of consolidating data from a number of different studies studying the composition, properties of plant components, as well as modern scientific developments were analyzed: comparative and economic-statistical analysis and generalization of the use of these components in the feeding of ruminants. Results and conclusions. The possibilities of using plant components are diverse, despite the significant difference in the chemical composition of extracts from different plant segments, they showed similar but significant antibacterial effects against gram-positive and gram-negative bacteria, which emphasizes the importance of their use for the treatment of various bacterial infections and justify their widespread use as normalization of the microflora of the gastrointestinal tract, increasing the body's resistance. Their use does not entail as many serious dangers as the use of antibiotics. Plant components and their wider practical application will undoubtedly become the subject of further research and will be crucial, proving mainly the effectiveness of their use, as well as safety in relation to animal health, the quality of animal products and the environment.

Key words: animal feeding, phytobiotics, plant extracts, metabolism, resistance, productivity.

Citation. Tsis E. Yu. Physiological and metabolic significance of phytobiotics in ruminants (review). Proc. of the Lower Volga Agro-University Comp. 2022. 2(66). 290-298 (in Russian). DOI: 10.32786/2071-9485-2022-02-36.

Author's contribution. Author of this research paper have directly participated in the planning, execution, or analysis of this study. All authors of this paper have read and approved the final version submitted.

Conflict of interest. The author declare no conflict of interest.

УДК 636.087.7/.8+636.085.25

ФИЗИОЛОГИЧЕСКОЕ И МЕТАБОЛИЧЕСКОЕ ЗНАЧЕНИЕ ФИТОБИОТИКОВ В КОРМЛЕНИИ ЖВАЧНЫХ ЖИВОТНЫХ (ОБЗОР)

Е. Ю. Цис, кандидат сельскохозяйственных наук ФГБНУ Федеральный исследовательский центр - ВИЖ им. Л. К. Эрнста, г. Москва Дата поступления в редакцию 11.02.2022 Дата принятия к печати 13.05.2022

Представленные материалы подготовлены в рамках выполнения НИР 2022 г по теме государственного задания 0445-2021-0002

Актуальность. В последние годы применение в составе рациона сельскохозяйственных животных растительных экстрактов, стимулирующих жизненно важные функции организма для предотвращения негативного влияния, связанного с современными технологиями содержания животных в условиях животноводческих комплексов, имеет большой исследовательский интерес. Кроме этого, несмотря на выпуск новых антибиотических препаратов, применение оптимальных схем лечения при заболеваниях крупного рогатого скота различной этиологии, а также лечение осложнений, вызываемых этими препаратами, по-прежнему являются наиболее сложной и трудноразрешимой проблемой в животноводстве. В этой связи возникает необходимость изучения эффективности применения растительных компонентов, не вызывающих лекарственной устойчивости и обладающих антимикробной способностью и при этом обеспечи-

290

№ 2 (66) 2022

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

вающих нормализацию обмена веществ, увеличение и сохранение полезной микрофлоры кишечника для получения экологически безопасной продукции. Целью настоящего обзора является оценка современного состояния эффективности применения растительных компонентов на физиологические процессы, метаболизм, продуктивность крупного рогатого скота. Материалы и методы. На основе анализа рецензируемых научных публикаций ведущих российских (https://www.elibrary.ru) и зарубежных баз данных (Scopus, Web of Science Core Collection, Viley Online Library), базы данных авторефератов и диссертаций (disserCat), монографий, рекомендаций с применением общепринятого метода консолидации данных ряда различных исследований, изучающих состав, свойства растительных компонентов, а также современных научных разработок были проведены анализы: сравнительный и экономико-статистический и обобщение результатов использования этих компонентов в кормлении жвачных животных. Результаты и выводы. Возможности использования растительных компонентов разнообразны. Несмотря на существенную разницу в химическом составе экстрактов из разных сегментов растений, они проявляли сходные, но значительные антибактериальные эффекты в отношении грамположительных и грамотрицательных бактерий, что подчеркивает важность их применения для лечения различных бактериальных инфекций и обосновывают широкое применение в качестве нормализации микрофлоры желудочно-кишечного тракта, повышения резистентности организма. Их применение не влечет за собой столь серьезных последствий, как применение антибиотиков. Растительные компоненты и их более широкое практическое применение, несомненно, станут предметом дальнейших исследований и будут иметь решающее значение, доказывая главным образом эффективность их применения, а также обеспечивая безопасность в отношении здоровья животных, качества продуктов животного происхождения и окружающей среды.

Ключевые слова: кормление жвачных животных, фитобиотики, растительные экстракты, метаболизм жвачных животных.

Цитирование. Цис Е. Ю. Физиологическое и метаболическое значение фитобиотиков в кормлении жвачных животных (обзор). Известия НВ АУК. 2022. 2(66). 290-298. DOI: 10.32786/20719485-2022-02-36.

Авторский вклад. Автор настоящего исследования принимал непосредственное участие в планировании, выполнении и анализе результатов данного исследования. Автор настоящей статьи ознакомился и одобрил представленный окончательный вариант.

Конфликт интересов. Автор заявляет об отсутствии конфликта интересов.

Введение. В последние годы применение в составе рациона сельскохозяйственных животных растительных экстрактов, стимулирующих жизненно важные функции организма для предотвращения негативного влияния, связанного с современными технологиями содержания животных в условиях крупных животноводческих комплексов имеет большой исследовательский интерес [1]. Воздействие ряда технологических факторов приводит к увеличению нагрузки на адаптационные способности организма сельскохозяйственных животных, которые сопровождаются значительным физиологическим и метаболическим нарушениям и, как следствие, снижаются качественные показатели получаемой животноводческой продукции [2].

Одним из направлений современной науки является производство и использование растительных биоактивных компонентов в качестве натуральных кормовых лечебно-профилактических добавок, полученных биотехнологическим путем для кормления сельскохозяйственных животных. Значение ароматических растений в животноводческой промышленности стимулировало научный интерес исследовать эфирные масла, получаемые из этих растений, и их биологические свойства для альтернативной замены антибиотиков с целью снижения воздействия на окружающую среду и обеспечения

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

экономичного производства продуктов животноводства [3, 4]. Кроме этого, несмотря на выпуск новых лекарственных препаратов и оптимальных схем лечения с применением антибиотических препаратов микробиологического синтеза при заболеваниях органов дыхания и желудочно-кишечного тракта молодняка крупного рогатого скота, а также осложнений, вызываемых этими препаратами, по-прежнему являются наиболее сложной и трудноразрешимой проблемой в животноводстве [14]. В этой связи возникает необходимость изучения эффективности применения растительных компонентов, не вызывающих лекарственной устойчивости и обладающих антимикробной способностью, при этом обеспечивающих нормализацию обмена веществ, увеличение и сохранение полезной микрофлоры кишечника для получения экологически безопасной продукции в соответствии с Федеральным законом от 01.01.2020 г. № 280-ФЗ «Об органической продукции и о внесении изменений в отдельные законодательные акты Российской Федерации». Целью настоящего обзора является оценка современного состояния эффективности применения растительных компонентов на физиологические процессы, метаболизм, продуктивность крупного рогатого скота.

Материалы и методы. На основе анализа рецензируемых научных публикаций ведущих российских (https://www.elibrary.ru) и зарубежных баз данных (Scopus, Web of Science Core Collection, Viley Online Library), базы данных авторефератов и диссертаций (disserCat), монографий, рекомендаций с применением общепринятого метода консолидации данных ряда различных исследований, изучающих состав, свойства растительных компонентов, а также современных научных разработок, были проведены анализы: сравнительный и экономико-статистический, обобщение результатов использования этих компонентов в кормлении жвачных животных. С помощью поиска по базам данных в метанализ были включены в общей сложности 27 исследований, на 1789 коровах. Экспериментальные дозы растительных компонентов в исследованиях варьировали 0,5 мг до 40 г/кг СВ рациона. Около 45 % изученных экспериментов были проведены с использованием побочных продуктов, содержащих растительные экстракты, в то время как 55 % исследований добавляли в состав рациона непосредственно сами экстракты.

Результаты и обсуждение. На отрасль скотоводства влияет ряд как внешних, так и внутренних факторов, одним из них является сбалансированное кормление животных. Значительный интерес представляют растительные компоненты, которые в зависимости от действия биологически активного вещества, выделенного из растения многофункциональны и могут использоваться в кормлении молочного скота как противомикробные, противовоспалительные, антиоксидантные средства, поскольку они усиливают ряд важных процессов в организме животных. Растительные компоненты с помощью их специфически эффективных веществ могут быть включены в число кормовых добавок, оказывающих положительное влияние на качество корма, здоровье животных, животноводческую продукцию. По биологическому происхождению различают следующие группы растительных компонентов: органолептические (влияющие на запах и вкусовые качества корма, красители), технологические (антиокислители, вещества снижения контаминации микотоксинами кормов, и т. д.), зоотехнические (иммуномодуляторы, пищеварительные стимуляторы, стимуляторы роста немикробного происхождения, вещества, увеличивающие продуктивность или качество получаемой продукции, и т. д.), при этом сообщается, что они могут также восполнять дефицит микроэлементов и витаминов. Однако следует учесть, что растительные компоненты оказывают более одного положительного эффекта и не могут быть строго отнесены только к одной из указанных групп [4]. Ряд работ авторов указывает, что биологическое свойство растительного экстракта зависит от времени сбора, фазы цвете-

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

ния, используемой части растения (стебель, корень, лист), географической зоны прорастания, метода получения (экстракция/дистилляция и стабилизация), дозировки и совместимости с кормовыми ингредиентами рациона [17].

Механизм действия эфирных масел не очень хорошо известен, но, по мнению некоторых авторов, эфирные масла могут действовать через различные биологические механизмы; например, на уровне клеточной мембраны микроорганизмов, объясняя их антимикробные свойства [7] или путем отбора и ингибирования микроорганизмов рубца для сокращения выбросов метана [8].

Современные системы животноводства с применением высококонцентрированных рационов для обеспечения высокой продуктивности и интенсивности роста молодняка оказывают негативное влияние на популяцию микроорганизмов в рубцовом содержимом. По мнению многих исследователей, с помощью эфирных масел можно регулировать микробиологическую ферментацию в кишечнике с целью улучшения использования питательных веществ и снижения воздействия внешних факторов на окружающую среду [7-9].

В молочной и мясной отрасли пищевой промышленности существует заинтересованность в использовании растительных экстрактов: карвакрола, тимола, циннамаль-дегида и эвгенола. Установлено, что тимол и карвакрол из-за их фенольной структуры могут разрушать клеточную мембрану микроорганизмов, а антимикробная активность циннамальдегида, скорее всего, обусловлена реакционной способностью его карбонильной группы и взаимодействием с белками [7]. Известны также и другие сочетания растительных компонентов, применение которых способствовало повышению иммунитета, приростов живой массы, увеличению сохранности молодняка [7, 13, 16].

Однако большой практический интерес среди растительных компонентов в молочном скотоводстве имеет корица, основными соединениями которой являются коричная кислота, циннамальдегид и эвгенол [17]. Представленные данные по использованию вышеуказанных соединений свидетельствуют об иммуномодулирующем, противовирусном действии. Также предполагается, что экстракты корицы могут оказывать антигипергликемическое действие и улучшать кровяное давление [17, 18].

На отечественном рынке растительных экстрактов производится препарат Инте-био@Форте («БИОТРОФ», Россия), представляющий смесь эфирных масел и отобранных фракций фитонцидов. Преимуществом данного фитобиотического препарата в кормлении высокопродуктивных коров было значительное улучшение показателей конверсии корма, развитие в рубцовом содержимом целлюлозолитических и амилоли-тических микроорганизмов, что позволило снизить риск развития лактатного ацидоза и увеличить продуктивность животных [1].

В последние десятилетия исследования с использованием растительных добавок коры корицы, содержащей как эфирное масло, так и водную фазу продемонстрировали положительное влияние в новотельный период у высокопродуктивных коров за счет улучшения ферментации в рубце, и большего количества пропионата, а также восполнения дефицита глюкозы. Anderson et al. (2004) полагают, что водные экстракты корицы особенно перспективны с точки зрения улучшения метаболического стресса [13]. Однако у жвачных животных неизвестны ни биодоступность, ни фармакокинетика соединений корицы. Hallier et al. (2013) изучали влияние переноса соединений корицы в молоко при перораль-ном введении 60 и 120 мг циннамальдегида/гол./сутки в течение 4 недель, при этом концентрация циннамальдегида в крови была ниже порога обнаружения (50 мкг/л), что не исключает того, что соединения корицы и образующиеся из них метаболиты действительно попадают в кровоток. Эти результаты согласуются с ранее опубликованными результата-

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

ми Ferme et al. (2007), которые сообщают, что в молоке коров, получавших эфирные масла циннамальдегида и диаллилдисульфида при пероральном введении, не было обнаружено остатков [10]. McPhee et al., (2011) в исследовании, проведенном на молочных козах с применением инъекций тимола, изучали выведение растительного компонента эфирного масла из молока. Авторами установлено, что все остатки тимола выводились в течение 24 часов. Эти данные также подтверждаются данными, полученными Peters and Caldwell (1994), которые сообщают, что циннамальдегид, карвакрол, тимол и их метаболиты почти полностью выводятся с мочой после полного метаболизма и в моче не остается ни одного исходного соединения. Более того, они установили, что это выведение в основном происходит в первые 24 часа, а их элиминация происходит в течение первых 24 ч и завершается через 48 ч. [7, 10].

Wall E. H. и др. (2014) в опытах на голштинизированных высокопродуктивных коровах изучали эффективность применения различных уровней инкапсулированной смеси коричного альдегида и эвгенола на показатели молочной продуктивности в разные стадии лактации. Авторы сообщают, что скармливание 350 мг/гол/сут. смеси экстрактов во вторую фазу лактации стимулировало процессы пищеварения, при этом отмечено незначительное увеличение продуктивности. Тогда как скармливание повышенных уровней (400; 600 мг/гол./сут.) инкапсулированной смеси коричного альдегида и эвгенола в первую фазу лактации привело к снижению суточного удоя коров.

Tekippe J. A. и соавторы (2013) в результате исследований на фистульных голштинизированных коровах по определению влияния фитобиотика на усвояемость в пищеварительном тракте, выбросы метана, потери азота, установили, что при скармливании лактирующим коровам 525 мг/гол./сут эвгенола и коричневого альдегида наблюдалось умеренное влияние на ферментацию в рубце, с постепенным повышением концентрации изобутирата и, как следствие, повышалась общая усвояемость нейтральной детергентной клетчатки в желудочно-кишечном тракте. Концентрации мочевины в плазме крови, молоке и потери азота с мочой были увеличены у животных, получавших фитобиотическую добавку.

Использование в кормлении лактирующих коров коричневого альдегида, полученного в результате паровой дистилляции масла коры корицы, оказывало влияние на физиологические процессы в организме животных. Результаты исследований in vitro показали, что коричный альдегид обладает спазмолитическим действием, блокируя кальциевые каналы, что может обеспечить фармакологическую основу для его лекарственного применения при диарее и спазмах, при этом он обладает ярко выраженным противомикробным и сосудорасширяющим действием [5].

В исследованиях Calsamiglia et al. (2007) также сообщается, что растительные экстракты циннамальдегида и эвгенола влияют на ферментацию рубца in vitro. Таким образом, может существовать потенциал для использования этих экстрактов в молочной промышленности для повышения эффективности ферментации рубца с целью оптимизации производства молока.

Применение комплексной фитобиотической добавки содержащей экстракты: тимола, эвгенола, ванилина, гваякола, и лимонена - способствовало увеличению потребления и усвоения питательных веществ рациона лактирующими молочными коровами при скармливании им средней концентрации - 600 мг/сут), в то время как в скармливание высокой концентрации (750 мг/сут.) не оказало влияния на эффективность кормления, но способствовало увеличению рН рубца [5]. В другом исследовании кормление высокой дозой (1,2 г/сут) той же смеси экстрактов было связано со снижением переваримости кормов рациона и не оказывало влияния на молочную продуктивность [16-18].

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

Oliveira H. B. N. с соавторами (2014) изучали влияние смеси эфирных масел (капсаицина, эвгенола, коричного альдегида и карвакрола) микрокапсулированных с увеличивающимися включениями (0, 1,5, 3,0 и 4,0 г/день), на потребление, усвояемость питательных веществ, продуктивность, состав молока 20 голштинизированных коров-первотелок и не установили никакой взаимосвязи на потребление, усвояемость, а также на выработку и состав молока голштинских коров-первотелок. При этом ими отмечено значительное снижение количества соматических клеток.

Данные, полученные Santos et al. (2010), свидетельствуют о том, что скармливание молочным коровам растительных экстрактов эвгенола, геранилацетата и кориандра способствовало увеличению выхода молочного жира, что указывает на изменение использования энергии для синтеза молочного жира[9]. Добавка для лактирующих молочных коров со смесью циннамальдегида, тимола и апельсиновой корки, скармливаемая в количестве 640 мг/сут, способствовала увеличению содержание жира и белка в молоке, но не оказывала влияния на потребление питательных веществ и молочную продуктивность [12, 16]. Включение в рацион смеси коричневого альдегида и эвгенола низкой концентрации (менее 500 мг/гол./сут) не влияло на потребление и продуктивность лакти-рующих коров, а при очень высокой концентрации (10 г/сут), оказывало негативное влияние на процессы рубцового брожения [15]. Очевидно, что многие из этих экспериментов подтверждают потенциальное влияние растительных экстрактов на показатели лактации молочных коров, но они также подтверждают результаты других экспериментов in vitro о том, что источник и дозировка используемого растительного компонента оказывают значительное влияние на физиологическую реакцию животного [17].

В настоящее время растительные экстракты широко применяются в кормлении молочного скота для поддержания и восстановления микроэкологического статуса в качестве альтернативы синтетическим антиоксидантам и препаратам микробиологического синтеза [12]. Oliver S. P. и соавторы (2011) подвергают тщательному рассмотрению целесообразность применения ионофорных антибиотиков из-за потенциала остатков антибиотиков и устойчивых штаммов бактерий.

По данным И. О. Ломовского и соавторов (2021), сравнительное изучение бактерицидного действия ряда растительных компонентов с использованием в качестве тест-культур штаммов и полевых изолятов условно-патогенных микроорганизмов: Salmonella typhimurium, Shigella sonnei, Esherichia coli, Pasteurella multocida, Yersinia pseudotuberculosis, Streptococcus pyogenes, Staphylococcus aureus, Staphylococcus epidermidis, Proteus vulgaris, Proteusmirabilis, установлено селективное воздействие экстрактов, полученных механохимической обработкой смеси порошков растительного компонента и щелочи на несколько видов болезнетворных микроорганизмов, характерных для конкретного заболевания, что может использоваться для профилактики или лечения этого заболевания.

В качестве основы при создании фитобиотических препаратов широко используют экстракты, полученные из побочных продуктов, которые также обладают антибактериальной активностью против штаммов (Escherichia coli, Pseudomonas aeruginosa, Candida albicans, Cryptococcus neoformans, methicillin-resistant Staphylococcus aureus (MRSA), Aspergillus fumigatus and Mycobacterium intracellular) с множественной лекарственной устойчивостью и могут использоваться в ветеринарии для лечения заболеваний [12]. Например, при производстве гранатового сока из побочного продукта были выделены и очищены экстракты, богатые дубильными веществами, эллагитанинами и фенольными кислотами, с помощью колоночной хроматографии XAD-16 и Sephadex LH-20, которые оказали положительное влияние на антиоксидантный статус и усиле-

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

ние антимикробной активности против Escherichia coli, Pseudomonas aeruginosa, Candida albicans, Cryptococcus neoformans, methicillin-resistant Staphylococcus aureus (MRSA) и внутриклеточной микобактерии.

Silva S. N. S. E. и др. (2021) провели исследование по оценке влияния ионофорных антибиотиков (монензин в дозе 24 мг/кг) отдельно и в сочетании с растительными экстрактами: пажитника (2000 мг/кг); и смесью - карвакрола (2500 мг/кг), коричного альдегида (5600 мг/кг) и лимонена (3000 мг/кг) на потребление и переваримость питательных веществ, ферментацию рубца, микробную популяцию, азотистый баланс, синтез микробного белка в рубце, метаболиты крови, качественный состав молока, профиль жирных кислот и продуктивность у фистульных половозрастных джерсейских коров. Авторы сообщают, что монензин сократил потребление питательных веществ и не оказал влияния на молочную продуктивность, при этом отмечено снижение концентрации жирных кислот молока C4 : 0, C6 : 0, C8 : 0 и C18 : 1 (Р<0,05). У животных, получавших смесь растительных экстрактов в сочетании с экстрактом пажитника и без него, наблюдается благоприятное влияние на физиологические процессы в организме коров, такие как нормализация метаболизма, более высокая относительная доля целлюлолитических бактерий рода Fibrobacter (Р = 0,04) по сравнению с аналогами, получавшими антибиотик.

При скармливании фитопробиотиков (ООО «Биотроф») «Провитол» и «Микс-Ойл» сообщается о положительном влиянии на процессы пищеварения за счет выработки эндогенных ферментов, улучшающих усвоение и переваримость питательных веществ рациона, при этом отмечено повышение среднесуточного удоя дойных коров на 6,9 и 13,3 % соответственно. Кроме этого, концентрация глюкозы в крови, мочевины, креатинина, триглицеридов, холестерина была ниже в группе животных, получавших фитобиотики. Экономическая эффективность применения указанных препаратов за период эксперимента составила 2762 руб. и 6961 руб. на 1 гол. [2].

Экономический ущерб, причиняемый заболеванием коров - эндометритом, складывается из затрат на покупку препаратов, потери продуктивности, недополучения приплода и вынужденного убоя. В странах ЕС заболевания эндометритом регистрируют у 40 % коров, а наносимый ими ущерб составляет более 500 евро на 1 голову [18]. В Центральном экономическом округе России заболеваемость эндометритами у коров составляет от 34,4-87,7 % [2]. Получены новые данные о положительном влиянии растительных экстрактов (розмарина, корицы, гвоздики, эвкалипта, лимона, орегано и тимьяна) для лечения и профилактики заболевания эндометрита. Химический состав семи эфирных масел был проанализирован методом GC-MS, а их антибактериальная активность в отношении бактерий: штамма кишечной палочки (ATCC 25922), Fusobacterium necrophorum (ATCC 25286), Trueperella pyogenes (ATCC 19411) и золотистого стафилококка (ATCC 29213) оценена методом дисковой диффузии. Результаты исследований Braga Paiano и др. (2020) показали, что антибактериальная активность растительных экстрактов масла корицы, гвоздики, орегано и тимьяна показали наилучшие результаты по сравнению с тремя другими эфирными маслами, демонстрируя наибольшую зону инги-бирования против всех оцениваемых бактерий. Эти результаты доказывают, что растительные экстракты являются потенциальным средством, которое можно использовать в качестве альтернативы для лечения эндометрита крупного рогатого скота [6, 17].

Выводы. Приведенный обзор, включающий сравнительный анализ и обобщение результатов экспериментов, касающийся состава, свойств, эффективности применения фи-тобиотиков в кормлении жвачных животных указывает на их высокую востребованность в молочном скотоводстве. Всестороннее изучение свойств растительных компонентов подтверждает, что фитобиотики нивелируют такие явления, как снижение иммунного и анти-оксидантного статуса, повышение продуктивности за счет повышения переваримости,

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

усвояемости питательных веществ рациона, нормализации микрофлоры желудочно-кишечного тракта, воздействует на азотистый обмен молочных коров, уменьшая деградацию азота в рубце. Помимо получения прямой экономической выгоды производителям молочной продукции, растительные экстракты могут представлять экологический интерес, доказывая главным образом их безопасность в отношении качества получаемой продукции животного происхождения и окружающей среды. Следовательно, использование современных технологий для получения и стандартизации этих компонентов, их экспериментальная и производственная апробация позволят использовать растительные экстракты в качестве биологически активных добавок природного происхождения.

Библиографический список

1. Изучение действия препаратов, модифицирующих состав микрофлоры рубца у коров, с использованием метода T-RFLP / А. А. Лебедев [и др.] // Проблемы биологии продуктивных животных. 2013. № 2. С. 110-116.

2. Лебедев А. А., Дуборезов В. М. Эффективность использования фитопробиотиков в рационах молочных коров// Кормление сельскохозяйственных животных и кормопроизводство. 2014. № 4. С. 25-33.

3. Механохимически полученные фитобиотики, подавляющие развитие болезнетворных микроорганизмов / И. О. Ломовский [и др.] // Журнал Сибирского федерального университета. Серия: Химия. 2021. Т. 14. № 1. С. 91-99. https://doi.org/10.17516/1998-2836-0219.

4. Фитобиотики в кормлении сельскохозяйственных животных / О. А. Багно [и др.] // Сельскохозяйственная биология. 2018. Т. 53. № 4. С. 687-697. https://doi.org/10.15389/agrobiology.2018.4.687rus.

5. Alireza Arbati, Masoud Maham, Bahram Dalir-Naghadeh. The effect of cinnamaldehyde on the contractility of bovine isolated gastrointestinal smooth muscle preparations. 2021. № 12 (3). Р. 313-318 https://doi.org/10.30466/VRF.2020.112185.2670.

6. Braga P. R., Bonilla J. Chemical composition and antibacterial activity of essential oils against pathogens often related to cattle endometritis // J Infect Dev Ctries. 2020. № 14. Р. 177-183. https://doi.org/10.3855/jidc.12076.

7. Calsamiglia S. Invited review: essential oils as modifiers of rumen microbial fermentation // Journal of dairy science. 2007. № 90 (6). Р. 2580-2595. https://doi.org/10.3168/jds.2006-644.

8. Fraser G. R. Assessment of the effects of cinnamon leaf oil on rumen microbial fermentation using two continuous culture systems // Journal of dairy science. 2007. V. 1. No 90 (5). P. 23152328. https://doi.org/10.3168/jds.2006-688.

9. Guild-Guerrero J. L. Plant-food by-products to improve farm-animal health // Anim Feed Sci Technol. 2016. V. 220. H. 121-135. https://doi.org/10.1016/j.anifeedsci.2016.07.016.

10. Hallier A. Development of a method to determine essential oil residues in cow milk // Journal of Dairy Science. 2013. V. 96. (3). P. 1447-1454. https://doi.org/10.3168/jds.2012-6152.

11. Oliveira H. B. N. Desempenho de vacas em lacta^ao consumindo dietas contendo misturas de óleos essenciais // Revista Brasileira de Saúde e Produjo Animal. 2014. V. 15 (3). P. 670-678. https://doi.org/10.1590/s1519-99402014000300014.

12. Oliver S. P., Murinda S. E., Jayarao B. M. Impact of antibiotic use in adult dairy cows on antimicrobial resistance of veterinary and human pathogens: a comprehensive review // Foodborne pathogens and disease. 2011. V. 8 (3). P. 337-355. https://doi.org/ 10.1089/fpd.2010.0730.

13. Sadri H. Cinnamon: does it hold its promises in cows? Using non-targeted blood serum metabolomics profiling to test the effects of feeding cinnamon to dairy cows undergoing lactation-induced insulin resistance // Metabolomics. 2017. V. 13. https://doi.org/10.1007/s11306-016-1151-1

14. Silva e S. N. S. Effects of plant extract supplementations or monensin on nutrient intake, digestibility, ruminal fermentation and metabolism in dairy cows // Animal Feed Science and Technology. 2021. V. 275. 114886. https://doi.org/10.1016/j.anifeedsci.2021.114886.

15. Tekippe J. A. Effect of essential oils on ruminal fermentation and lactation performance of dairy cows // Journal of Dairy Science. 2013. V. 96 (12). P. 7892-7903. https://doi.org/10.3168/jds.2013-7128.

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

16. Wall E. H. The effects of supplementation with a blend of cinnamaldehyde and eugenol on feed intake and milk production of dairy cows // JOURNAL OF DAIRY SCIENCE. 2014. V. 97 (9). P. 5709-5717.https://doi.org/10.3168/jds.2014-7896.

17. Yazdanpanah Z. Effects of cinnamon supplementation on body weight and composition in adults // A systematic review and meta-analysis of controlled clinical trials. 2020. V. 34 (3). P. 448463. https://doi.org/10.1002/ptr.6539.

18. Yesilbag D. Effects of juniper essential oil on growth performance, some rumen protozoa, rumen fermentation and antioxidant blood enzyme parameters of growing Saanen kids // Anim Physiol Anim Nutr. 2017. V. 101. P. e67-e76.https://doi.org/10.1111/jpn.12560.

Информация об авторе

Цис Елена Юрьевна, кандидат сельскохозяйственных наук, научный сотрудник отдела кормления сельскохозяйственных животных Федеральное государственное бюджетное научное учреждение «Федеральный исследовательский центр животноводства - ВИЖ имени академика Л.К. Эрнста» (142132, Московская область, г.о. Подольск, пос. Дубровицы, д.60), тел. 8(916)277-47-27, e-mail: tsis-elen@yandex.ru_ORCID https://orcid.org/0000-0003-1988-1189

DOI: 10.32786/2071-9485-2022-02-37

EFFECT OF MC4R GENE POLYMORPHISM ON GROWTH AND MEAT

TRAITS OF PIGS

12 2 A. E. Svyatogorova , O. L. Tretyakova , L. V. Getmantseva ,

N. A. Svyatogorov 2, A. I. Klimenko3

1North-Caucasus Zonal Veterinary Research Institute - branch of FSBSC FRASC, Novocherkassk 2Don State Agrarian University, Rostov region, Oktyabrsky district, v. Persianovsky 3Federal Rostov Agrarian Scientific Center, Rostov region, Aksai district, v. Dawn

Received 30.03.2022 Submitted 25.05.2022

Summary

The article presents an analysis of the influence of gen MC4R on growth and meat performance of pigs Duroc. The frequency of alleles and genotypes of said marker gene and its relationship to productivity traits.

Abstract

Introduction. The prospect of using genomic selection technologies that allow deciphering the genotype of pigs at the stage of birth and selecting the best animals for breeding has led to the need to study productivity marker genes. This will increase the breeding accuracy and reliability of the breeding value of pigs and will help in the early stages of life to diagnose the breeding value of animals, improve existing and derive new specialized paternal lines that will be used at the final stage of hybridization to obtain commercial hybrids. In increasing productive qualities, the melanocortin-4 receptor gene (MC4R) is of great interest, as one of the links of a complex system of eating behavior, it participates in the metabolism of adipose tissue. The main functional feature of the MC4R is the control of body weight and regulation of eating behavior. Thus, the main purpose and objective of the experiment was to study the relationship of the polymorphism of the MC4R marker gene of Duroc pigs with their meat and fattening qualities. Object. The objects of the study were Duroc pigs (n=55 of them 45 pigs and 10 boars) of the Closed Joint Stock Company «Breeding Plant-Jubilee». Materials and methods. The direct material for the study was tissue samples from the auricle of pigs with an area of 1 cm2 (ear plucking). The analysis was carried out by PCR-PDRF (polymerase chain reaction - restriction fragment length polymorphism) Amplification of a fragment (226 bp) of the MC4R gene was carried out using primers: 5'- TACCCTGACCATCTTGATTG - 3'; 5' -ATAGCAACAGATGATCTCTTTG - 3'. Results and conclusions. Based on the results of a molecular genetic study, the presence and frequency of alleles and genotypes were determined by the MC4R gene. Experimental studies on DNA genotyping of agricultural animals were carried out in the laboratory of molecular diagnostics and biotechnology of agricultural animals in the Don State Agrarian University. According to the conducted studies, the pigs had a «desirable» AA genotype in terms of precocity, trunk

i Надоели баннеры? Вы всегда можете отключить рекламу.