Научная статья на тему 'ЭКСПРЕССИЯ ГИПОКСИЯ-ИНДУЦИБЕЛЬНОГО ФАКТОРА HIF1α КАК КРИТЕРИЙ РАЗВИТИЯ ГИПОКСИИ ТКАНЕЙ'

ЭКСПРЕССИЯ ГИПОКСИЯ-ИНДУЦИБЕЛЬНОГО ФАКТОРА HIF1α КАК КРИТЕРИЙ РАЗВИТИЯ ГИПОКСИИ ТКАНЕЙ Текст научной статьи по специальности «Фундаментальная медицина»

CC BY
927
132
i Надоели баннеры? Вы всегда можете отключить рекламу.
Журнал
Биомедицина
ВАК
RSCI
Ключевые слова
ГИПОКСИЯ / ГИПОКСИЯ-ИНДУЦИБЕЛЬНЫЙ ФАКТОР / ЛАБОРАТОРНЫЕ ЖИВОТНЫЕ / ЭКСПРЕССИЯ / HIF1α / ПЦР В РЕАЛЬНОМ ВРЕМЕНИ / HYPOXIA / HYPOXIA-INDUCIBLE FACTOR / LABORATORY ANIMALS / EXPRESSION OF HIF1A / REAL-TIME PCR

Аннотация научной статьи по фундаментальной медицине, автор научной работы — Шустов Е.Б., Каркищенко Н.Н., Дуля М.С., Семенов Х.Х., Оковитый С.В.

Целью исследования была оценка пригодности применения уровня экспрессии гипоксия-индуцированного фактора HIF1α для диагностики степени тяжести гипоксии тканей. Экспрессия HIF1α является типовой ответной реакцией генома клеток на гипоксическое воздействие, запускающей многоплановые механизмы адаптации к гипоксии и повышения способности тканей к переживанию неблагоприятных воздействий. Экспериментальная гипоксия создавалась подъемом лабораторных крыс Wistar в барокамере на высоты 6, 8, 10, 11 и 12 км. Длительность экспозиции варьировала от 30 до 5 минут в зависимости от высоты. Сразу же после спуска животных забирались биологические материалы (цельная кровь, почки, печень, сердце, мозг), в которых методом ПЦР в реальном времени определялась экспрессия HIF1α. В качестве гена стандартизации использовался ген «домашнего хозяйства» TSPO (митохондриальный транслокаторный белок). Показано, что и HIF1α, и TSPO обладают выраженной тканеспецифичностью. В условиях гипоксии экспрессия TSPO по высотам характеризуется высокой вариативностью. Динамика экспрессии HIF1α по высотам показывает принципиальную возможность использования этого показателя для оценки выраженности тканевой гипоксии, не зависящей от способа моделирования гипоксического воздействия.

i Надоели баннеры? Вы всегда можете отключить рекламу.
iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

The expression of hypoxia-inducible factor HIF1α as a criterion for the development of tissue hypoxia

The aim of the study was to evaluate the suitability of the use of the expression level of hypoxia-inducible factor HIF1α to diagnose the severity of tissue hypoxia. Expression HIF1α is a typical response of the genome of the cells in the hypoxic effects, triggering multidimensional mechanisms of adaptation to hypoxia, and improve the ability of tissues to experience adverse effects. Experimental hypoxia was created by the rise of laboratory Wistar rats in the chamber at a height of 6, 8, 10, 11 and 12 km. Duration of exposure varied from 30 to 5 minutes depending on altitude. Immediately after the descent of animals climbed the biological materials (whole blood, kidney, liver, heart, brain), in which method the real-time PCR determined the expression of HIF1a. As the standardization gene used was the gene "household" TSPO. It is shown that HIF1a, and TSPO have pronounced tissue-specific. Under hypoxic conditions the expression of TSPO elevation is characterized by high variability. Dynamics of expression of HIF1a elevation shows the possibility of using this indicator to assess the severity of tissue hypoxia-independent method of modeling hypoxic exposure.

Текст научной работы на тему «ЭКСПРЕССИЯ ГИПОКСИЯ-ИНДУЦИБЕЛЬНОГО ФАКТОРА HIF1α КАК КРИТЕРИЙ РАЗВИТИЯ ГИПОКСИИ ТКАНЕЙ»

Биомедицина • № 4, 2015, С. 4-15

НОВЫЕ БИОМЕДИЦИНСКИЕ ТЕХНОЛОГИИ

Экспрессия гипоксия-индуцибельного фактора HIF1a как критерий развития гипоксии тканей

Е.Б. Шустов1, H.H. Каркищенко1, М.С. Дуля1, Х.Х. Семенов1, C.B. Оковитый2, С.В. Радько2

1 - ФГБУН «Научный центр биомедицинских технологий ФМБА России», Московская область

2 - ФГБОУ ВПО «Санкт-Петербургская химико-фармацевтическая академия МЗ РФ», Санкт-Петербург

Контактная информация: д.м.н. Шустов Евгений Борисович, shustov-msk@mail.ru

е

Целью исследования была оценка пригодности применения уровня экспрессии гипоксия-инду-цированного фактора ШШа для диагностики степени тяжести гипоксии тканей. Экспрессия ШР1а является типовой ответной реакцией генома клеток на гипоксическое воздействие, запускающей многоплановые механизмы адаптации к гипоксии и повышения способности тканей к переживанию неблагоприятных воздействий. Экспериментальная гипоксия создавалась подъемом лабораторных крыс в барокамере на высоты 6, 8, 10, 11 и 12 км. Длительность экспозиции варьировала от

30 до 5 мин в зависимости от высоты. Сразу же после спуска животных забирались биологические материалы (цельная кровь, почки, печень, сердце, мозг), в которых методом ПЦР в реальном времени определялась экспрессия ШР1а. В качестве гена стандартизации использовался ген «домашнего хозяйства» ТБРО (митохондриальный транслокаторный белок). Показано, что и Н1Б1а, и ТБРО обладают выраженной тканеспецифичностью. В условиях гипоксии экспрессия ТБРО по высотам характеризуется высокой вариативностью. Динамика экспрессии НШа по высотам показывает принципиальную возможность использования этого показателя для оценки выраженности тканевой гипоксии, не зависящей от способа моделирования гипоксического воздействия.

Ключевые слова: гипоксия, гипоксия-индуцибельный фактор, лабораторные животные, экспрессия, НШа, ПЦР в реальном времени.

Введение

Несмотря на достаточное количество работ по моделированию гипокси-ческих состояний, единых критериев оценки степени тяжести гипоксиче-ских состояний, а также единых подходов к соотнесению результатов разных методов создания гипоксии друг с дру-

гом в настоящее время не создано. Однако необходимость разработки таких критериев, особенно в рамках развития медицины экстремальных состояний и фармакологии защиты профессиональной деятельности человека в неблагоприятных условиях, является весьма высокой.

Мы предположили, что универсальный критерий тяжести гипоксического состояния может быть разработан на основе анализа интенсивности генного ответа тканей на гипоксическое воздействие. Несоответствие между потребностями организма в кислороде и его доставкой приводит к активации ряда стабилизационных механизмов. Наиболее типичным и важнейшим стабилизационным механизмом геномного ответа на гипоксическое воздействие является экспрессия транскрипционного гипоксия-индуцибельного фактора HIFla, вовлеченного в такие процессы, как гликолиз, гематопоэз, ангиоге-нез, регуляцию сосудистого тонуса [23], и ряд других адаптационных механизмов.

HIF представляет собой гетеродимер, состоящий из экспрессируемой конститутивно HIF-ip субъединицы (также известной как ARNT-ядерный транслокатор арил-углеводного рецептора) [27], и одной из трех различных кислородза-висимых и транскрипционно активных a-субъединиц, среди которых HIF-la и -2a являются промоторами адаптации к гипоксии. У HIF-3a отсутствует С-кон-цевой домен трансактивации, и некоторые из HIF-3a ингибируют HIF-la и функцию HIF-2a [15].

В условиях нормоксии гетеродимер-ный комплекс HIF-1, состоящий из 2 белковых цепей (HIF-la и HIF-ip), в цитоплазме ассоциируется с белком теплового шока HSP70 и кошапероном CHIP (С terminus of HSP70 Interacting Protein), которые обеспечивают убиквитирова-ние белка и его деградацию в протеа-сомах. В условиях гипоксии в клетке появляются денатурированные белки, к которым, в силу более высокого сродства, присоединяется HSP70, диссоциируя из комплекса с HIF-1, что ведет к пре-

кращению убиквитирования и последующей протеасомной деградации HIF-1. Накапливающийся в цитоплазме HIF-1 мигрирует к ядру клетки, транслоциру-ется в него и выполняет свои функции трансляционного фактора [1].

Сотни HIF-1-регулируемых генов идентифицированы на сегодняшний день. Белковые продукты этих генов играют ключевую роль в ангиогенезе, сосудистом ремоделировании, энергетическом метаболизме, пролиферации клеток и их выживании, эритропоэзе и гомеоста-зе железа. HIF-1 увеличивает экспрессию эритропоэтина [22], трансферрина, который транспортирует в клетки Fe3+ [21] и его рецепторов, которые связываются с трансферином и позволяют клеткам его поглощать [2, 13, 26], церулоплазмина (также известного как ферроксидаза), который необходим для окисления Fe2+ в Fe3+ [17]. Увеличение активности этих генов обеспечивает поступление железа в эритроидные ткани.

Под влиянием HIF-1 повышается экспрессия VEGF, являющегося самым мощным эндотелиальным митогеном и непосредственно участвующим в ангиогенезе путем привлечения эндотелиаль-ных клеток в гипоксические и аваску-лярные области и стимулирующим их пролиферацию [4, 18]. Таким образом, индуцирование VEGF и других различных проангиогенных факторов приводит к увеличению плотности сосудов и, следовательно, к уменьшению недостатка кислорода. Кроме того, HIF-1 регулирует гены, участвующие в управлении сосудистым тонусом, такие как синтазы оксида азота (NOS2) [16], гемоксигене-за-1 [12], эндотелин-1 (ET1) [9], адрено-медуллин (ADM) [19], а также гены a1B-адренергических рецепторов [5].

5

Biomedicine • № 4, 2015

Н1Б-1 увеличивают содержание практически всех ферментов гликолиза, а также переносчиков глюкозы 1 и 3 (вЬШ, вьи3) [3]. Кроме того, продукты метаболизма гликолиза, такие как лактат и пируват, как показали исследования, вызывают накопление Н1Б-1а при нормоксии и регулируют экспрессию гипоксия-индуцируемых генов, следовательно, создавая потенциальную положительную обратную связь [14].

Н1Б-1 индуцируют факторы роста, такие как инсулин-подобный фактор ро-ста-2 (ЮР2) и трансформирующий фактор роста-а (ТОБ-а) [6, 11]. Связывание подобных факторов роста с родственными им рецепторами активирует пути передачи сигналов, которые приводят к клеточной пролиферации/выживанию, и стимулирует экспрессию Н1Б-1а [24].

Н1Б1а и Н1Б2а могут модулировать экспрессию изоформ цитохрома с ок-сидазой так, чтобы максимизировать эффективность электрон-транспортной цепи [8]. Дефекты в этой реакции приводят к нарушению продукции АТФ и повышенной продукции окислителей при гипоксии.

Регулирование обмена веществ является главной и изначальной функцией Н1Б-1. В условиях гипоксии Н1Б-1 опосредует переход от окислительного метаболизма в гликолитический путем регулирования четырех факторов: РБК1, ЬБНА, ВМР3 иВМРЗЬ. РБК1 кодирует киназу-1 пируватдегидрогеназы (РБН), которая фосфорилирует и инактивирует РБН, тем самым препятствуя превращение пирувата в ацетил-коэнзим А, вступающего в цикл трикарбоновых кислот [10, 20]. ЬБНА кодируетлактатдегидро-геназу А, которая преобразует пируват

в лактат [23]. Н1Б-1 также опосредует переключатель субъединиц цитохром С-оксидазы, что повышает эффективность переноса электрона в условиях гипоксии [7].

В работе [25] иммуногистохимиче-скими методами и методами иммуно-блоттинга было показано, что в условиях нормоксии Н1Б-1 определяется практически во всех тканях (хотя в некоторых органах - например, в печени и легких -на пределе чувствительности методик). При формировании гипоксических состояний (нормобарическая гипоксия, снижение содержания кислорода во вдыхаемом воздухе с 21 до 6%) отмечено нарастание содержания Н1Б-1. Интересным является выявленный авторами факт, что даже кратковременная реоксигенация (4-8 мин) способна вызвать резкое снижение содержания Н1Б-1, вероятно, за счет его быстрой деградации.

Целью исследования была оценка пригодности применения уровня экспрессии гипоксия-индуцированного фактора Н1Б1а для диагностики степени тяжести гипоксии тканей.

Материалы и методы

Для оценки влияния гипоксии на экспрессию гена НШ-Ы был выполнен следующий эксперимент. Лабораторные животные (белые крысы-самцы популяции линий "^81аг) массой 180220 г подвергались барокамерному подъему на высоту 6000, 8000, 10000, 11000 и 12000 м со средней скоростью подъема 150 м/с. По достижению заданной высоты удерживалась площадка с продолжительностью воздействия 30 мин для высот 6 и 8 км, 20 мин -для высоты 10 км, 10 мин - для высоты

11 км и 5 мин - для высоты 12 км, после чего животные спускались с высоты до уровня моря с той же скоростью (150 м/с). Сразу же после прекращения гипоксического воздействия животные выводились из эксперимента и у них забирались образцы цельной крови, почек, печени, сердца и головного мозга. Пробы замораживались в жидком азоте и хранились до выполнения исследования в низкотемпературном холодильнике при температуре -140°С. Контролем служили аналогичные животные, помещаемые в работающую барокамеру без ее герметизации и создания гипоксии («холостой прогон», позволяющий снизить значимость стрессового фактора на животных). В каждой группе было по 5 животных. Условия, характеризующие гипоксическое воздействие, представлены в табл. 1.

Из исследуемого материала выделяли тотальную РНК методом аффинной сорбции на частицах силикагеля согласно протоколу производителя к комплекту реагентов для экстракции

РНК/ДНК из клинического материала «АмплиПрайм РИБО-сорб» («Интер-ЛабСервис», Москва). Синтез первой цепи кДНК проводили согласно инструкции «Комплекта реагентов для получения кДНК на матрице РНК РЕВЕР-ТА-L» («ИнтерЛабСервис», Москва).

Амплификацию с последующим определением уровня экспрессии гена HIF-la крыс проводили методом ПЦР с детекцией накопления продуктов реакции в режиме реального времени (RealTime PCR) с помощью детектирующего амплификатора CFX-96 («Bio-Rad», США) и специфических праймеров и зондов к гену HIF-la крыс («ДНК-Синтез», Россия). Праймеры для последовательностей HIF-la и TSPO (гену «домашнего хозяйства», митохондри-альный белок-переносчик) были подобраны с помощью программы Vector NTI. Последовательности мРНК HIF-la и TSPO были взяты в базе данных NCBI GenBank и синтезированы фирмой ЗАО «ДНК-Синтез» (Москва) (табл. 2).

Группа 1 2 3 4 5 6

Высота, км 0 6 8 10 11 12

Парциальное давление кислорода, мм рт.ст. 159 75 56 43 36 30

Эквивалентное содержание кислорода, % 21 9,9 7,3 5,6 4,8 4

Насыщение гемоглобина, % 98 65 38 18 10 2

Дефицит парциального давления кислорода, мм рт.ст. 0 84 103 116 120 126

Экспозиция, мин 30 30 20 10 5

Доза гипоксии, мм рт.ст.*мин 2520 3090 2320 1200 630

Таблица 1

Характеристика гипоксического воздействия на лабораторных животных по экспериментальным группам

7

Biomedicine • № 4, 2015

Таблица 2

Праймеры и зонды для Real-Time PCR

Исследуемая мишень Олигонуклеотидные праймеры и зонды

Ген HIF-1 HIF 1a F: 5- ACTCATCATGACATGTTTACTAAAGGAC -3 HIF 1a R: 5-TGTCAAACGGAAGATGGCAG-3 Z HIF 1a: 5-ROX-TCACCACAGGACAGTACAGGATGCTTGC-BHQ1-3

Ген «домашнего хозяйства» крысы TSPO TSPO F: 5- AGGCTGTGGATCTTTCCAGAAC -3 TSPO R: 5- GGCTGGGCACCAGAGTGA-3 ZTSPO: 5-FAM-CAATCACTATGTCTCAATCCTGGGTACCCG-BHQ1-3

Стадию амплификации кДНК HIF-1а крыс в режиме реального времени проводили в 25 мкл смеси: ПЦР-бу-фер (х10): 700 тМ Трис-HCl, pH 8,6; 25°С, 166 тМ (NH4)2S04, 25 тМ MgCl2, 0,2 тМ dNTPs, Taq-полимераза, на детектирующем амплификаторе CFX-96 («Bio-Rad», США).

Условия проведения амплификации кДНК HIF-1a с праймерами HIF-1a_F/ HIF-1a_R и зонда Z HIF-1a: 95°С - 15 мин, затем 50 циклов: 95°С - 30 с, 65°С -50 с, 72°С - 30 с.

Количество исследуемых кДНК (ко-пийных ДНК, полученных из РНК путем обратной транскрипции) в образцах рассчитывали путем определения пороговых

циклов ПЦР. Для оценки уровня экспрессии гена HIF-la в качестве стандарта сравнения использовался ген TSPO, экспрессия которого считается стабильной для животного. Нормализация количества изучаемых транскриптов к общему количеству кДНК в пробе проводилась с помощью отношения HIF-la/TSPO.

Результаты и их обсуждение

Первичным показателем экспрессии генов в реакции Real-Time PCR является количество циклов амплификации, необходимое для детектирования продукта анализируемого гена (Cq). Типичная картина выполнения исследования представленанарис. 1.

Рис. 1. Результаты амплификации генов НШ-1а и ТБРО в образце мозга лабораторных животных.

Для исследования возможности применения экспрессии гена ТБРО для оценки уровня экспрессии гена НШ-Ы был выполнен однофакторный дисперсионный анализ по трем независимым контролируемым факторам: тканеспе-цифичности, чувствительности к гипоксии и ее уровням. Результаты дисперсионного анализа представлены в табл. 3.

Однофакторный дисперсионный анализ экспрессии гена ТБРО показал, что анализируемый ген характеризуется высокой тканеспецифичностью (73% всей вариации его экспрессии определяется тканевой принадлежностью пробы, р=1*10-7) и низкой чувст-

вительностью к гипоксическому воздействию (только 4% всей вариации его экспрессии определяется фактом гипоксического воздействия, р=0,92; и 2% - его выраженностью, р=0,82). Следовательно, в пределах тканевой специфичности ген ТБРО может быть использован для оценки уровня экспрессии гена НШ-Ы в условиях гипоксического воздействия.

Тканеспецифичность экспрессии гена ТБРО в условиях нормоксии отражена на рис. 2. Показателем уровня экспрессии гена при этом было число тысяч копий продукта гена, накопленного к концу процесса амплификации.

Таблица 3

Результаты дисперсионного анализа факторов тканеспецифичности и чувствительности к гипоксии на экспрессию гена ТБРО

Фактор D* F** Fcr*** P****

Тканеспецифичность 0,73 16,01 2,53 1*10-7

Чувствительность к гипоксии 0,04 0,27 2,53 0,92

Уровень гипоксии 0,02 0,20 3,35 0,82

Примечание: *-D- коэффициент детерминации модели, **-F- критерий Фишера, *** -Fer - критическое значение F для оценки достоверности, **** - р - достоверность модели (уровень значимости).

кровь почки печень сердце

Рис. 2. Тканеспецифичность экспрессии гена ТБРО в условиях нормоксии.

9 БюшеШете • № 4, 2015

Таким образом, ген ТБРО в условиях нормоксии на максимальном уровне экспрессируется в почках, на высоком уровне экспрессируется в сердце, на среднем уровне - в печени, на низком уровне - в клетках крови и мозга. В плазме крови экспрессия гена ТБРО выявляется на следовом уровне, вероятно, переходя из клеток крови в процессе центрифугирования цельной крови.

Анализ вариативности экспрессии гена ТБРО в условиях воздействия гипоксии не выявляет закономерных изменений (рис. 3).

Анализ рис. 3 показывает, что экспрессия гена ТБРО на разных высотах может отличаться более чем в 10 раз (например, для миокарда - от 14 до 233% от уровня нормоксии, для печени - от 27 до 243% от уровня нормоксии), что делает некорректным нормирование экспрессии в условиях гипоксии других генов по уровню экспрессии ТБРО.

Т.к. предварительный анализ показал возможность использования гена ТБРО для оценки динамики уровня экспрессии гена НШ-Ы в условиях нормоксии в качестве тканеспецифического стандарта, то дальнейший анализ результатов проводился для показателя относительного уровня экспрессии. Особенности экспрессии гена НШ-Ы в разных тканях в условиях нормоксии представлены на рис. 4.

Анализ рис. 4 показывает, что уровень экспресии гена НШ-Ы в крови и почках соответствует базовому уровню экспрессии генов «домашнего хозяйства» лабораторных животных, в сердце - идет в 3 раза более интенсивно, в печени - в 17 раз более интенсивно, а в тканях мозга - в 272 раза интенсивнее. Можно предположить, что столь интенсивная экспрессия гена НШ-Ы в мозге даже в обычных условиях связана с его высокой чувствительностью к

Рис. 3. Вариативность экспрессии гена ТБРО в условиях воздействия гипоксии (на примере печени и сердца).

кровь почки печень сердце мозг

Рис. 4. Особенности экспрессии гена ШР-1а в разных тканях в условиях нормоксии.

гипоксическому воздействию и необходимостью создания определенного «резерва» генной регуляции на случай экстремального воздействия. Ракже высоко чувствительными к гипоксии являются ткани печени и миокарда, о чем свидетельствует повышенный уровень экспрессии этого гена. Обращает на себя внимание тот факт, что в плазме крови экспрессия гена ШШ-1а определяется на уровне гематокрит-ного показателя цельной крови, т.е. соответствует ее клеточной фракции и может быть исключена из дальнейшего анализа.

Данные, отражающие относительный уровень экспрессии гена ШШ-1а в условиях гипоксии, нормированный по соответствующим гипоксическим значениям экспрессии гена ТБРО, представлены в табл. 4.

При анализе табл. 4 обращают на себя внимание «выпадающие» из общей динамики отдельные показатели (например, экспрессия гена в крови на высотах 10 и 12 км, в почках - на высоте 12 км, в печени - на высотах 6 и 12 км, в сердце - на высотах 10 и 12 км, в мозге - на высотах 11 и 12 км). Сопоставление данных для этих точек с динамикой экс-

Раблица 4

Относительный уровень экспрессии гена Н1Р-1а в условиях гипоксии, нормированный по соответствующим гипоксическим значениям экспрессии гена

ТБРО (отн. ед.)

Ткань Высота, км

0 6 8 10 11 12

Кровь 1 31 27 10 44 0,3

Почки 1 0,1 1 1,4 3 34

Печень 17 7 58 43 47 2

Сердце 3 1,4 3 0,4 5 20

Мозг 272 30 40 50 1 119

прессии гена ТБРО (табл. 5) показывает, что зачастую они находятся в противо-фазе и отражают не столько собственно экспрессию гена НШ-Ы в условиях гипоксии, сколько вариативность экспрессии нормирующего гена ТБРО в условиях гипоксии. Так, например, резкое снижение (в 10 раз) относительной экспрессии гена НШ-Ы в почках на высоте 6 км на самом деле отражает рост в 30 раз уровня экспрессии гена ТБРО в этих условиях, а рост в 34 раза на высоте 12 км включает в себя компонент, связанный со снижением в 7 раз экспрессии гена ТБРО. Аналогичная картина наблюдается и для других тканей.

В связи с этим возникает методическая задача корректного нормирования

изменения экспрессии гена Н1Р-1а в условиях гипоксии, которая бы учитывала как высокую тканеспецифичность экспрессии этого гена (фактор ткане-специфичности описывает 95% всей вариативности показателя, р=5*10-19), так и само гипоксическое воздействие. Мы считаем целесообразным использование следующего методического подхода: для учета тканеспецифичности все данные об экспрессии гена Н1Р-1а первоначально нормируются по экспрессии гена ТБРО в условиях нормок-сии, а затем, для выявления динамики в условиях гипоксического воздействия, анализируются в % относительно нор-моксических условий. Полученные результаты отражены в табл. 6ина рис. 5.

Таблица 5

Динамика экспрессии гена ТБРО в разных тканях по высотам гипоксического воздействия (% от уровня нормоксии)

Высота, км 0 6 8 10 11 12

Кровь 100 4,8 0,7 15,0 5,7 350,6

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Сердце 100 195,9 45,1 232,9 44,1 13,6

Печень 100 195,9 215,8 27,2 27,2 242,8

Почки 100 2924,3 204,2 80,1 50,3 13,1

Мозг 100 92,7 11,7 88,9 6139,3 52,9

Высота Кровь Почки Печень Сердце Мозг

6 153 172 86 100 10

8 19 209 757 55 17

10 154 111 70 34 16

11 260 133 78 87 24

12 125 445 30 99 23

Таблица 6

Динамика по высотам относительного уровня экспрессии гена Н1Р-1а, нормированного по тканеспецифической экспрессии гена ТБРО в условиях нормоксии (% к условиям нормоксии)

800

0 6 8 10 11 12 высота, км

Рис. 5. Динамика относительного уровня экспрессии гена Н1Р-1а, нормированного по тка-неспецифической экспрессии гена ТБРО в условиях нормоксии, по высотам гипоксическо-го воздействия.

Анализ табл. 6 и рис. 5 показывает, что на гипоксическое воздействие разной интенсивности формируются тка-неспецифические ответные реакции экспрессии гена НШ-1а.

Наиболее своеобразная картина формируется в отношении ткани мозга. Напомним, что в условиях нормоксии именно для мозга была характерна максимальная экспрессия гена НШ-1а (в 272 раза интенсивнее, чем для гена «домашнего хозяйства» клетки). В условиях гипоксии практически однотипно для разных высот происходит резкое снижение экспрессии гена НШ-1а (до уровня 10-25% для разных высот). Вероятно, при гипоксии происходит резкое изменение программ генетического ответа на гипоксию, возможно, реализуемое по Н1Р-1а-независимому механизму. При этом в тканях мозга происходит эффективное расходование предварительно накопленного в силу высокого уровня экспрессии в нормок-сических условиях этого транскрипционного фактора.

В сердце происходит снижение экспрессии гена Н1Р-1а в условиях гипоксии. Вероятно, что на выраженной гипоксии (точки 11 и 12 км) в силу короткой гипок-сической экспозиции (10 мин на высоте 11 км и 5 мин на высоте 12 км) такое снижение экспрессии не успевает развиться.

В печени при переходе от умеренной (6 км) к средней выраженности гипокси-ческого воздействия (8 км) отмечается резкое повышение (в 7,5 раз) экспрессии гена НШ-1а с последующим снижением на критических высотах (12 км).

В почках гипоксическое воздействие вызывает умеренное усиление экспрессии гена НШ-1а (в 1,7-2,1 раза) для высот 6-8 км, затем - ее снижение до уровня, характерного для нормоксических условий (для высот 10-11 км), и резкое повышение (в 4,5 раза) на критической высоте.

Для клеток крови также характерно умеренное (примерно в 1,5 раза) повышение уровня экспрессии гена НШ-1а для высот 6-10 км, и более выраженное (в 2,5 раза) повышение экспрессии для высоты 11 км.

Заключение

Проведенное исследование показало, что экспрессия гена HIF-la отражает специфический тканевой ответ на ги-поксическое воздействие, оценка уровня экспрессии гена HIF-la может быть использована для диагностики выраженности гипоксии тканей. Т.к. генетический ответ на гипоксию не зависит от способа формирования гипоксии, предложенный методический подход может рассматриваться как универсальный, не зависящий от способа моделирования гипоксии у данного вида лабораторных животных.

Для гипоксии умеренной степени (высота 6 км) характерна умеренная активация экспрессии гена HIF-la (в 1,5-1,7 раза) при сохранении на уровне, близком к нормоксическим условиям, экспрессии HIF-la в печени и миокарде, и резком снижении (в 10 раз) в тканях мозга. Типичным признаком гипоксии средней тяжести (высота 8 км) является резкая активация экспрессии гена HIF-la в почках (в 7,5 раз по сравнению с условиями нормоксии) и менее выраженная (в 2,1 раза) - в почках. Для выраженной гипоксии (высота 11 км) типичным признаком служит высокий уровень экспрессии гена HIF-la в клетках крови (более чем в 2,5 раза). Признаком критического (но менее длительного) гипоксического воздействия является выраженная активация экспрессии гена HIF-la в почках (в 4,5 раза) при снижении уровня экспрессии этого гена в печени (в 3 раза).

Список литературы

1. Малышев И.Ю. Стресс-белки в биологии и медицине. - М.: ГЕОТАР-Медиа, 2012. - 176 с.

2. Bianchi L., Tacchini L., Cairo G. HIF-1-mediated activation of transferrin receptor gene transcription by iron chelation // Nucleic Acids Res., 1999; 27: 4223-4227.

3. Chen J., Zhao S., Nakada K., Kuge Y., Tamaki N., Okada F., Wang J., Shindo M., Higashino

F., Takeda K. Dominant-negative hypoxia-inducible factor-1 alpha reduces tumorigenicity ofpancreatic cancer cells through the suppression of glucose metabolism // Am. J. Pathol., 2003; 162: 1283-1291.

4. Conway E.M., Collen D., Carmeliet P. Molecular mechanisms of blood vessel growth // Cardiovasc. Res., 2001; 49: 507-521.

5. Eckhart A.D., Yang N., Xin X., Faber J.E. Characterization of the alpha1B-adrenergic receptor gene promoter region and hypoxia regulatory elements in vascular smooth muscle // Proc. Natl Acad. Sci. USA, 1997; 94: 94879492.

6. Feldser D., Agani F., Lyer N. V., Pak B., Ferreira

G., Semenza G.L. Reciprocal positive regulation of hypoxia-inducible factor 1alpha and insulinlike growth factor 2 // Cancer. Res., 1999; 59: 3915-3918.

7. Fukuda R., Zhang H., Kim J.W., Shimoda L., Dang C.V., Semenza G.L. HIF-1 regulates cytochrome oxidase subunits to optimize efficiency of respiration in hypoxic cells // Cell, 2007; 129: 111-122.

8. Gordan J.D., Thompson C.B., Simon M.C. HIF and c-Myc: Sibling rivals for control of cancer cell metabolism and proliferation // Cancer. Cell, 2007; 12: 108-113.

9. Hu J., Discher D.J., Bishopric N.H., Webster K.A. Hypoxia regulates expression of the endothelin-1 gene through a proximal hypoxia-inducible factor-1 binding site on the antisense -strand // Biochem. biophys. res. commun., 1998; 245: 894-899.

10. Kim J.W., Tchernyshyov I., Semenza G.L., Dang C.V. HIF-1-mediated expression of pyruvate dehydrogenase kinase: a metabolic switch required for cellular adaptation to hypoxia // Cell Metab., 2006; 3: 177-185.

11. Krishnamachary B., Berg-Dixon S., Kelly B., Agani F., Feldser D., Ferreira G., Iyer N., LaRusch J., Pak B., Taghavi P. Regulation of colon carcinoma cell invasion by hypoxia-inducible factor 1 // Cancer. Res., 2003; 63: 1138-1143.

12. Lee P.J., Jiang B.H., Chin B.Y., Iyer N.V., Alam J., Semenza G.L., Choi A.M. Hypoxia-inducible factor-1 mediates transcriptional activation of the hemeoxygenase-1 gene in response to hypoxia // J. Biol. Chem., 1997; 272: 5375-5381.

13. Lok C.N., Ponka P. Identification of a hypoxia response element in the transferrin receptor gene //J. Biol. Chem., 1999; 274: 24147-24152.

14. LuH., ForbesR.A., VermaA. Hypoxia-inducible factor 1 activation by aerobic glycolysis implicates the Warburg effect in carcinogenesis // J. Biol. Chem., 2002; 277: 23111-23115.

15. Makino Y., Cao R., Svensson K., Bertilsson G., Asman M., Tanaka H. Inhibitory PAS domain protein is a negative regulator of hypoxia-inducible gene expression//Nature, 2001; 414: 550-554.

16. Melillo G., Musso T., Sica A., Taylor L.S., Cox G.W., Varesio L. A hypoxiaresponsive element mediates a novel pathway of activation of the inducible nitric oxide synthase promoter // J. Exp. Med., 1995; 182: 1683-1693.

17. Mukhopadhyay C.K., Mazumder B., Fox P.L. Role of hypoxia-inducible factor-1 in transcriptional activation of ceruloplasmin by iron deficiency // J. Biol. Chem. 2000; 275: 21048-21054.

18. Neufeld G., Cohen T., Gengrinovitch S., Poltorak Z. Vascular endothelial growth factor (VEGF) and its receptors // FASEB J., 1999; 13: 9-22.

19. Nguyen S.V., Claycomb W.C. Hypoxia regulates the expression of the adrenomedullin and HIF-1 genes in cultured HL-1 cardiomyocytes // Biochem. Biophys. Res. Commun., 1999; 265: 382-386.

20. Papandreou I., Cairns R.A., Fontana L., Lim A.L., Denko N.C. HIF-1 mediates adaptation to hypoxia by actively downregulating mitochondrial oxygen consumption // Cell Metab.,2006; 3: 187-197.

21. Rolfs A., Kvietikova I., Gassmann M., Wenger

R.H. Oxygen-regulated transferrin expression is mediated by hypoxia-inducible factor-1 // J. Biol. Chem., 1997; 272: 20055-20062.

22. Semenza G.L., Nejfelt M.K., Chi S.M., Antonarakis S.E. Hypoxia-inducible nuclear factors bind to an enhancer element located 3 to the human erythropoietin gene // Proc. Natl Acad. Sci. USA, 1991; 88: 5680-5684.

23. Semenza G.L., Jiang B.H., Leung S. W., Passantino R., Concordet J.P., Maire P., Giallongo A. Hypoxia response elements in the aldolase A, enolase 1, and lactate dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1 // J. Biol. Chem., 1996; 271: 3252932537.

24. Semenza G.L. Targeting HIF-1 for cancer therapy // Nat. Rev. Cancer., 2003; 3: 721-732.

25. Stroka D.M., Burkhardt T., Desbaillets I., Wenger R.H., NeilD.A.H., Bauer C., Gassmann M., Candinas D. HIF-1 is expressed in normoxic tissue and displays an organ-specific regulation under systemic hypoxia // FASEB J., 2001. V. 15. N. 11. P. 2445-2453.

26. Tacchini L., Radice L., Bernelli-Zazzera A. Differential activation of some transcription factors during rat liver ischemia, reperfusion, and heat shock // J. Cell Physiol., 1999; 180: 255-262.

27. Wang G.L., Semenza G.L. Purification and characterization of hypoxia-inducible factor 1 // J. Biol. Chem., 1995; 270: 1230-1237.

The expression of hypoxia-inducible factor HIF1a as a criterion for the development of tissue hypoxia

E.B. Shustov, N.N. Karkischenko, M.S. Dulya, Kh.Kh. Semenov, S.V. Okovitiy, S.V. Radko

The aim of the study was to evaluate the suitability of the use of the expression level of hypoxia-inducible factor HIF1a to diagnose the severity of tissue hypoxia. Expression HIF1a is a typical response of the genome of the cells in the hypoxic effects, triggering multidimensional mechanisms of adaptation to hypoxia, and improve the ability of tissues to experience adverse effects. Experimental hypoxia was created by the rise of laboratory Wistar rats in the chamber at a height of 6, 8, 10, 11 and 12 km. Duration of exposure varied from 30 to 5 minutes depending on altitude. Immediately after the descent of animals climbed the biological materials (whole blood, kidney, liver, heart, brain), in which method the real-time PCR determined the expression of HIF1a. As the standardization gene used was the gene "household" TSPO. It is shown that HIF1a, and TSPO have pronounced tissue-specific. Under hypoxic conditions the expression of TSPO elevation is characterized by high variability. Dynamics of expression of HIF1a elevation shows the possibility of using this indicator to assess the severity of tissue hypoxia-independent method of modeling hypoxic exposure.

Key words: hypoxia, hypoxia-inducible factor, laboratory animals, expression ofHIF1a, real-time PCR.

15 Biomedicine • № 4, 2015

i Надоели баннеры? Вы всегда можете отключить рекламу.