Научная статья на тему 'Диагностика бруцеллёза методом полимеразной цепной реакции (ПЦР)'

Диагностика бруцеллёза методом полимеразной цепной реакции (ПЦР) Текст научной статьи по специальности «Ветеринарные науки»

CC BY
1778
237
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
БРУЦЕЛЛЁЗ / ПРАЙМЕРЫ / ДНК / АГОРОЗА / ПЦР / PCR (POLYMERAZE CHAIN REACTION) / BRUCELLOSIS / PRIMERS / DNA / AGAROSE

Аннотация научной статьи по ветеринарным наукам, автор научной работы — Кушалиев Кайсар Жалитович, Зулхарнаева Раушан Гафуровна, Сивожелезова Нина Александровна

В статье даны основные принципы диагностики бруцеллёза методом ПЦР. Описана оптимизация условий ПЦР. Подобраны праймеры, специфичные к ДНК бруцеллёза.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по ветеринарным наукам , автор научной работы — Кушалиев Кайсар Жалитович, Зулхарнаева Раушан Гафуровна, Сивожелезова Нина Александровна

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

DIAGNOSTICS OF BRUCELLOSIS BY POLYMERAZE CHAIN REACTION

The main principles of brucellosis diagnostics by the PCR method are suggested. The PCR method of diagnostics is described. Specific primers for brucellosis DNA are selected.

Текст научной работы на тему «Диагностика бруцеллёза методом полимеразной цепной реакции (ПЦР)»

Диагностика бруцеллёза методом полимеразной цепной реакции (ПЦР)

К.Ж. Кушалиев, д.в.н., профессор, Р.Г. Зулхарнаева,

соискатель, Западно-Казахстанский АТУ; НА Сивоже-лезова, д.с.-х.н., профессор, Оренбургский ГАУ

Бруцеллёз животных широко распространён в Казахстане, наносит огромный ущерб животноводству и представляет большую угрозу здоровью людей.

Предотвращение эпизоотии позволяет поддерживать и развивать необходимые межхозяй-ственные, межрегиональные и государственные связи, а успешная борьба с болезнями животных, опасных для человека, обеспечивает охрану здоровья населения страны [1, 2].

Цель исследований — провести анализ на бруцеллёз методом ПЦР.

Объекты, методы и результаты исследований.

Работа выполнялась на базе НИИ (лаборатории биотехнологии инженерного профиля) ЗападноКазахстанского АТУ.

Использовали следующие реактивы и расходные материалы: агароза (ДиаэМ, Россия); бромид димидия (RT193993, ICN, США); бром феноловый синий (B5525, Sigma, Германия); ди-оксинуклеозидтрифосфаты — смесь dATP, dTTP, dCTP, dGTP (2 мм), R0241 (Ферментас, Литва; Сибэнзим, Россия); таq-полимераза (5 ед/мкл) (Синтол, Россия); тригидроксиметиламинометан (Трис, USB, Великобритания); этиловый спирт (Россия).

Применяли оборудование: автоматические дозаторы переменного объёма (0,1—20 м, 20—200 м,

200—1000 м); анализатор-термоциклир (ампли-фикатор) для детекции нуклеиновых кислот методом ПЦР iCycler IQ5; бокс абактериальной воздушной защиты БАВп-01-«Ламинар-С»-1,2(01); бокс для проведения GWH работ UVC/T-M-AR; гельдокументирующая система Geldoc XR system PC; источник тока PowerPac basic; центрифуга Heraeus Pico 17.

Выделение ДНК проводили при помощи коммерческого набора «Амплисенс» «ДНК-сорб-Б». Вначале лизирующий раствор прогрели при температуре 65 °С до полного растворения кристаллов.

К сыворотке крови животных добавили 300 мкл лизирующего раствора, тщательно перемешивали смесь на вортексе и прогревали 5 мин при температуре 65 °С, затем ещё раз перемешивали на вортексе. В каждую пробирку вносили 25 мкл суспензии сорбента, перемешивали и оставляли на 2 мин для осаждения сорбента. Затем повторно проводили перемешивание на вортексе и оставляли на 5 мин для осаждения сорбента. Сорбент осаждали на микроцентрифуге при 5 тыс. об./мин в течение 30 с и отбирали супернатант из каждой пробирки отдельным наконечником. Вносили по 300 мкл раствора для отмывки № 1, тщательно перемешивали смесь на вортексе и вновь осаждали в прежнем режиме. Вносили по 500 мкл раствора для отмывки № 2, ресуспендировали на вортексе, осаждали микроцентрифугированием 10000 об./мин в течение 30 сек и удаляли супертанант. Повторяли процедуру отмывки раствором № 2. Элюцию проводили при помощи 50 мкл ТЕ-буфера. Качество выделения ДНК определяли при помощи метода электрофореза в агарозном геле.

При подключении к источнику тока отрицательно заряженная ДНК начинает двигаться в геле от катода к аноду. При этом более короткие молекулы ДНК движутся быстрее, чем длинные. На скорость движения ДНК в геле влияют концентрация агарозы, напряжённость электрического поля, температура, состав электрофорезного буфера. Все молекулы одного размера движутся с одинаковой скоростью. Краситель встраивается плоскостными группами в молекулы ДНК [3, 4].

После окончания электрофореза, продолжающегося около 10—20 мин при напряжении тока 90—120 В, гель помещали в камеру трансиллюминатора, излучающего свет в ультрафиолетовом диапазоне (254—310 нм).

Энергия ультрафиолета, поглощаемая ДНК в области 260 нм, передаётся на краситель, заставляя его флуоресцировать в оранжево-красной области видимого спектра (590 нм) [5].

Подбор праймеров осуществляли на основе имеющихся литературных данных по изучению

Brucella spp и данных секвенирования ДНК вакцин. В результате обработки литературных материалов были подобраны две пары праймеров для видового определения возбудителей заболевания бруцеллёза. На основе компьютерного анализа при помощи пакета программ Vector NTI проанализировали подобранные две пары праймеров. В результате анализа первая подобранная пара праймеров 24-1 (TGCAGCTCACGGATAATTTG) и 24-2 (ACACCTTGTCCACGCTCAC) строго специфична для B. abortus. Вторая пара 25-1 (ATCTGGTTCTTTCGGGTGTG) и 25-2 (CATCACCAAGAACCGTGTTG) - является маркерной для определения видов B. abortus, B. melitensis и B. suis. Праймеры были заказаны и синтезированы в компании «Бигль» (Санкт-Петербург).

Оптимизация условий проведения полимеразной цепной реакции проведена с учётом имеющихся литературных данных по изучению Brucella spp и проведению ПЦР

Была разработана программа амплификации коллекции ДНК микроорганизмов рода Brucella, состоящая из 42 циклов. Она включает в себя несколько этапов: 1-й этап «денатурации» при 95 °С в течение 3 мин; 2-ой этап — «отжига» при 63 °С в течение 1 мин; 3-й этап — «элонгации», или «синтеза», при 72 °С в течение 1 мин.

Реакционная смесь состояла из следующих компонентов: праймеров по 0,1 мкл; буфера для проведения ПЦР реакции по 2,0 мкл; MgCl 1.5 M по 1,2 мкл; смеси дизоксинуклеотидтрифосфатов dNTP в количестве 0,4 мкл и тaq-полимераза по

0.4.мкл на реакцию.

В оптимизированную реакционную смесь мы добавляли по 1 мкл ДНК, полученной из сыворотки крови животных; по 0,1 мкл праймеров 24-1 (TGCAGCTCACGGATAATTTG) и 24-2 (ACACCTTGTCCACGCTCAC).

В результате исследования ПЦР-продуктов методом электрофореза в агарозном геле мы получили специфические отчётливые полосы, означавшие, что ДНК бруцеллы содержится в сыворотке крови животных.

Литература

1. Vierstraete Andy // Principle of the PCR. University of Ghent, March 2001.

2. Фёдоров Н.А., Суханов Ю.С., Асади Мобархан А.Х. и др. Полимеразная цепная реакция (ПЦР): метод. пос. М., 1996. С. 33.

3. Сайдулдин Т.С., Уразбекова Д.С. Диагностика бруцеллеза крупного рогатого скота // Вестник сельскохозяйственной науки Казахстана. 2000. № 8. С. 37—39.

4. Wardeska B., Jaszczak K., Pierzchaza M., Parada R., Korczak M. Divergent selection for skeletal malformations in chickens alters polymorphism at microsatellite loci // J. Appl. Genet. 45(1). 2004. Pp. 61—71.

5. Wardeska B., Olszewski R., Jaszczak K., Zieba G., Pierzchaza M., Wicinska K. Relationship between microsatellite marker alleles on chromosomes 1-5 originating from the Rhode Island Red and Green-legged Partrigenous breeds and egg production and quality traits in F2 mapping population // J. Appl. Genet. 43(3). 2002. Pp. 319—329.

i Надоели баннеры? Вы всегда можете отключить рекламу.