CC BY
61
8
OPEN /VI ACCESS
Altai State University
www.asu.ru
ISSN 2412-1908
Acta Biologica Sibirica, 2019, 5(1), 71-76
Slctft T3iolofltca Sibirica
Journal of HiubjJy
Founded in 2DI5
RESEARCH ARTICLE
http/urn:lsid:zoobank.org:pub:864221 F5-A9ED-44F5-8DF0-1E5D2AB8F97E
Description of a new species of Chrysina Kirby, 1828 (Coleoptera: Scarabaeidae: Rutelinae) from resplendensgroup, based on morphological characters and mtDNA COX I molecular marker
A.S. Zubov1, N.V. Ivshin2, A. Yu. Titarenko3, B.V. Andrianov2
1 Bolotnikovskaya 6BB, ap. 103, Moscow, 117556, Russia. E-mail: [email protected] 2Laboratory of Insects Genetics, Vavilov Institute of General Genetics Gubkina-3, Moscow, 119333, Russia. E-mail:[email protected];[email protected] 3Morfo Absoloni Ltd, Roschinskyproezd, 4, building2, apartment44 Moscow, 115419, Russia. E-mail: [email protected]
A new species of the genus Chrysina Kirby, 1828 is decribed from Panama. Chrysina kalininisp.n. is related to Chrysina resplendens (Boucard, 1875) in habitus, male genitalia morphology and mtDNA COX I molecular marker). The two closely related species differ in the shape of pronotum, mesosternal process and male genitalia. mtDNA COI molecular marker analysis gives a reliable distance for the compared species. Key words: Scarabaeidae; Rutelini; Chrysina; Plusiotis; new species; Panama
Introduction
The genus Chrysina Kirby, 1828 (Coleoptera: Scarabaeidae: Rutelinae) contains about 120 species (Hawks, 2017; Moore et al., 2017). The genus is widespread in the North of C. America (starting from Texas, Usa) to the North-West of South America (Columbia, Ecuador). Some contemporary Chrysina were previously known as Plusiotis and Pelidnotopsis. Currently these genera are placed into synonymy under the older name, Chrysina (Hawks, 2001). According to D.C. Hawks (2006), there is a group of species morphologically closely related to Chrysina resplendens (Boucard, 1875): Chrysina chalcothea (H. W. Bates, 1888), Chrysina cupreomarginata (F. Bates, 1904), Chrysina resplendens (Boucard, 1875) and Chrysina tapantina (Morón, 1992). We assumed that new species belongs to this group and is similar to C. resplendens (Fig. 1-3). C. resplendens was described from Costa Rica, San Jose. The species is also known from other localities of Cordillera de Talamanca from Costa Rica and Panama. New species and C. resplendens occur in Panama sympatrically. In this article we compare the new species with C. resplendens and C. cupreomarginata because they appear to be the closest morphologically.
Material and methods
About 70 specimens from the resplendens group were available for the study in research collections of the first and the third authors, the "Museum für Naturkunde - Leibniz Institute for Evolution and Biodiversity Science" (Berlin, Germany) and private collection of V.A. Kalinin (Russia, Moscow). For morphological examination the authors used stereo microscope Zeiss Stemi 2000-C. Tissue samples (abdomen tergites) were taken from 14 specimens of Chrysina for DNA analysis, and for comparison and estimation of the pairwise distances. The results were deposited in BOLD public project data records - see the Published Projects section of BOLD (Ratnasingham & Hebert, 2007; www.barcodinglife.org).
DNA was extracted using the standard phenol-chloroform method (Sambrook, Fritsch, & Maniatis, 1989). Amplification reactions were carried out according to BOLD protocol with minor improvements in PCR thermal regime algorythm in the final volume of 25 pL with 12.5 pmol (or 0,5 pmol/pL) of the primer LCO1490 (5'-G GTCAACAAATCATAAAGATATTG G-3') and 12.5 pmol (or 0.5 pmol/pL) of the primer HCO2198 (5'-TAAACTTCAGGGTGACCAAAAAATCA-3') (Folmer, Black, Hoeh, Lutz, & Vrijenhoek, 1994), 0.1g of the isolated DNA and the
universal Encyclo Plus PCR kit (Evrogen, Moscow) following the manufacturer's protocol. PCR was performed in a T100 thermal cycler (Bio-Rad, USA). The PCR thermal regime consisted of an initial denaturation of 4 min 30 sec at 94°C; five cycles of 30 sec at 94°C, 20 sec at 45°C and 1 min at 72°C; 35 cycles of 30 sec at 94°C, 20 sec at 55°C and 1 min at 72°C, and a final extension of 5 min at 72°C. Amplification success was checked by electrophoresis in 1.5% agarose gel with subsequent identification of PCR fragments under UV light after staining with ethidium bromide. The section of mtDNA is standard "barcode region" of the Cytochrome Oxidase subunit I gene was sequenced using the above primers LC01490 and HCO2198 at the Evrogen laboratory (Moscow). DNA sequences were verified, aligned and analysed using MEGA version 6.0 (Tamura, Stecher, Peterson, Filipski, & Kumar, 2013). The maximum likelihood method (Tamura-Nei model) was applied for estimating of divergence. For estimating branch support bootstraping was carried out. Bootstrap values above 70 (expressed as percentages of 500 replications) were shown at branch points of the likelihood tree. The sequences deposited in the BOLD database are shown in Table 1. Table 1. Specimen data, sequences and images deposited in the BOLD project database _(http://www.boldsystems.org)._
Taxon name BOLD sample Id
Chrysina cupreomarginata BC-Ivsh-5476-M14, BC-Ivsh-5477-M 11
BC-Ivsh-5478-PK11, BC-Ivsh-5479-PK12, BC-Ivsh-5480-PK13, BC-Ivsh-5481-PK21, BC-Chrysina kaiinini Ivsh-5482-X23, BC-Ivsh-5483-X24, BC-Ivsh-5484-PP11, BC-Ivsh-5485-PP12
Chrysina resp/endens BC-Ivsh-5472-X12, BC-Ivsh-5473-X11, BC-Ivsh-5474-CK3, BC-Ivsh-5475-R14
Abbreviations. The following abbreviations are used to indicate the location of the paratype specimens:
MNKB - Museum für Naturkunde, Leibniz Institut für Evolution und Biodiversitatsforschung (Berlin, Germany) VK - the private collection of V. Kalinin (Moscow, Russia) AT - the private collection of Andrey Yu. Titarenko (Moscow, Russia) AZ - the private collection of A.S. Zubov (Moscow, Russia)
1 2 3
Figs. 1-3. 1. C. kaiinini sp.n., male, Holotype: dorsal view. Panama, Chiriqui prov., Nueva California [08.88324, -82.68500], 1920 m., 17-19.06.2018 (BOLD sample ID BC-Ivsh-5482-X23); 2. C. respiendens, male: dorsal view. Costa Rica. Limon prov., Lomas de Guacimo, Cerro Bellavista, Atlantic steppe, h-1200.V-VI.2015; 3. C. cupreomarginata, male: dorsal view. Costa Rica. Limon prov., Lomas de Guacimo, Cerro Bellavista, Atlantic steppe, h-1200.V-VI.2015. (BOLD sample ID BC-Ivsh-5477-M11).
Chrysina kalininiZubov & Ivshin sp. n.
Holotype. S, Panama, Chiriqui prov., Nueva California [08.88324, -82.68500], 1920 m., 17-19.06.2018, Leg. Zaritskiy V. [BM], BOLD sample ID BC-Ivsh-5482-X23 (Fig. 1).
Paratypes. 30 sp. (VK), Panama, Chiriqui prov., Nueva California [08.88324, -82.68500], 1920 m., 17-19.06.2018, Leg. Zaritskiy V.; 2S,1 9 (AT), Panama Chiriqui, env. Boquete, Rio Palo Alto, 1300 m, 06.05.1980, Porion, Bertrand leg.; 1 9 (AT), Panama, Chiriqui, 06.06.1988, G. Brossard leg; 9S, 69 (AT), Panama, Chririqui prov., env. Volcan town, h-1700-1900m, 20.0520.06.2018, A. Kozlov leg; 8S, 149 (AT), Panama, Chiriqui, Bugaba distr., [8.843417N, 82.692W], h-1580m, 22.06,26.06.2017; 5S, 19 (AT), Panama, Chriqui prov., Renacimiento distr., [8.8963N, 82.74142W], h-1675m, 25.06.2017; 19 (AT), Panama, Chirirqui, Rte Gualaca Fortuna, Hornito - Valle de la Sierpe, h-1000m, 08.05.1980, Porion, Bertrand leg.; Panama, Chiriqui, env. El hato del volcan, Quebrada Tisingal, h-1400m, 02.05.1980, Porion, Bertrand leg.
Description. Body length 20-24 mm. All body parts except antennae have shiny golden coloration, abdomen mostly brownish to golden and almost mat. Antennae short, brown, antennal club small. Body shape almost oval, twice long as wide. Pronotum slightly trapezoid, approximately 1,5 times wider than long, sides slightly triangular (Fig. 4-5). Elytra almost 1,5 times longer than wide. Legs short, hind tibia slightly longer than middle tibia and approximately 1,3 times longer than foreleg tibia. Head, pronotum and elytra glabrous in small rare punctuation. Clypeus brownish. Claws long and curvy. Mesosternal process relatively short, thinned to the apex, greenish. Prosternal plate has rounded triangular shape, flat, shiny golden (Fig. 6-9). Hind femur of males and females slightly thickened.
Comparative analysis and remarks. The new species is very close to C. resplendens and has only few morphological differences from it. Clypeus of C. kalininisp.n. is slightly longer than in C. resplendens.
Pronotum in C. kalinini sp.n. is slightly longer in relation to its width than in C. resplendens, its sides have smaller angles, whereas in C. resplendens the sides of pronotum are rounded (Fig. 4-5).
Mesosternal process shiny, shorter and wider than in C. resplendens, where the process is long and narrow and its apical half is greenish-golden (Fig. 6-8).
Prosternal plate of C. kalinini sp.n. is rounded triangular and flat, in C. resplendens it is square and has a clear dent (Fig. 6-9).
Phallus of C. kalinini sp.n. is more narrow and more narrowed to the apex than in C. resplendens (Fig. 10-12).
Fig. 4-5. 4. C. kalinini sp.n., male Holotype: pronotum (BOLD sample ID BC-Ivsh-5482-X23); 5. C. resplendens, male: pronotum
In comparison by molecular markers (mtDNA COX I "barcoding region"), C. resplendens, C. cupreomarginata and C. kalininidemonstrated strong divergence. A maximum likelihood tree based on 14 DNA barcode sequences of the new taxa and those of their putative closest relatives in the genus is shown in Fig. 13. Sequences ranged from 500 to 700 bp (sequences shorter than 500 bp were excluded). In the Table 2 the number of base substitutions per site from averaging over all sequence pairs between groups are shown. Standard error estimates are shown above the diagonal. Analyses were conducted using the Maximum Composite Likelihood model (Tamura, Nei, & Kumar, 2004). The analysis involved 14 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. All positions containing gaps and missing data were eliminated. There were a total of 612 positions in the final dataset.
According to the average values of the interspecies pairwise comparisons and the tree topology (Fig. 13, Table 2), Chrysina kalinini sp.n. reliably differs from its closest relatives, and molecular divergence of these three species is in concordance with their morphological divergence.
Table 2. Interspecies pairwise distances: the average values for number of base substitutions per site between sequences estimated as the divergence over sequence pairs between groups. Standard error estimate(s) are shown above the diagonal._
Taxon name Chrysina cupreomarginata Chrysina kalinini Chrysina resplendens
Chrysina cupreomarginata - 0.036 0.026
Chrysina kalinini 0.076 - 0.021
Chrysina resplendens 0.054 0.042 -
Etymology
The species is named after the Russian collector Valentin Alexandrovich Kalinin (Russia, Moscow), who organized the research on this group and who supported a number of research expeditions which were crucial for this study.
Acknowledgements
We would like to express our heartfelt appreciation to the following colleagues: our good friend Pavel Udovichenko for valuable comments, literature and specimens for the study; Dr Vadim Krutov for reviewing the manuscript; Valentin Kalinin for lending us specimens. The work was carried out with the financial support of the Basic Research Program of the Presidium of the RAS "Biodiversity of natural systems" No. 29 Section "Genofunds of living nature and their conservation".
References
Boucard, A. (1875). Monographic list of the Coleoptera of the genus Plusiotis of America, north of Panama, with descriptions of several new species. Proceedings of the Zoological Society of London, 117-125, plate 23.
Folmer, O., Black, M., Hoeh, W., Lutz, R., & Vrijenhoek, R. (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3, 294-299.
Hawks, D. C. (2001). Taxonomic and nomenclatural changes in Chrysina and a synonymic checklist of species (Scarabaeidae: Rut.linae). Occasional Papers of the Consortium Coleopterorum, 4, 1-8.
Hawks, D. C. (2006). Checklist of Chrysina species (Scarabaeidae: Rutelinae: Rutelini). Division of Entomology. UNL State Museum. Retrieved from
http://museum.unl.edu/research/entomology/Guide/Scarabaeoidea/Scarabaeidae/Rutelinae/Rutelinae-Tribes/Rutelini/Chrysina/Chrysina-Catalog/ChrysinaC.html.
Hawks, D. C. (2017). Five new species of Chrysina Kirby (Coleoptera: Scarabaeidae: Rutelinae). Insecta Mundi, April 12, 1-12.
Moore, M.R., Jameson, M.L., Garner, B.H., Audibert, C., Smith, A.B.T., & Seidel, M. (2017). Synopsis of the pelidnotine scarabs (Coleoptera, Scarabaeidae, Rutelinae, Rutelini) and annotated catalog of the species and subspecies. ZooKeys, 666, 1-349. Doi: https://doi.org/10.3897/zookeys.666.9191
Ratnasingham, S., & Hebert, P.D.N. (2007). BOLD: The Barcode of Life Data System (http://www.barcodinglife.org). Molecular Ecology Notes, 7, 355-364. Doi: https://doi.org/10.1111 /j.1471 -8286.2007.01678.x
Sambrook, J., Fritsch, E.F., & Maniatis, T. (1989). Molecular cloning: A laboratory manual. Vols. 1 -3. 2 nd Edition. New York: Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
Tamura, K., Nei, M., & Kumar, S. (2004). Prospects for inferring very large phylogenies by using the neighbor-joining method. Proceedings of the National Academy of Sciences (USA), 101, 11030-11035. Doi: https://doi.org/10.1073/pnas.0404206101
Tamura, K., Stecher, G., Peterson, D., Filipski, F., & Kumar, S. (2013). MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution, 30, 2725-2729. Doi: https://doi.org/10.1093/molbev/mst197
Zubov, A.S
D
Chrysina Kirby.... Acta Biologica Sibirica, 2019, 5(1), 71-76
Figs. 6-9. 6. C. kalinini, male, Holotype: mesosternal process (BOLD sample ID BC-Ivsh-5482-X23); 7. C. kalinini, female: mesosternal process; 8. C. resplendens, male: mesosternal process; 9. C. cupreomarginata, male: mesosternal process (BOLD sample ID BC-Ivsh-5477-M11).
10 11 12
Figs.10-12. 10. C. kalinini, Holotype: phallus (BOLD sample ID BC-Ivsh-5482-X23); 11. C. resplendens. phallus; 12. C. cupreomarginata. phallus (BOLD sample ID BC-Ivsh-5477-M11).
Fig. 13. Maximum likelihood tree of the studied Chrysina. Bootstrap support values of > 70% are indicated near the branches (500 bootstrap replicates).
Citation:
Zubov, A.S., Ivshin, N.V. Titarenko, A.Yu., & Andrianov, B.V. (2019). Description of a new species of Chrysina Kirby, 1828 (Coleoptera: Scarabaeidae: Rutelinae) from resplendens group, based on morphological characters and mtDNA COX I molecular marker. Acta Biologica Sibirica, 5 (1), 71-76. Submitted: 23.11.2018. Accepted: 05.01.2019 ifOisref http://dx.doi.org/10.14258/abs.v5.il.5194
© 2019 by the authors. Submitted for possible open access publication under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
