CC BY
12driven by these hallmark characteristics. For example, interventions have focused on improving social communication skills, such as language skills, play, and reciprocal communication. The necessity of early intervention has been clearly indicated as a priority in autism research. Findings indicate that children who enter early intervention have a better prognosis. Research about early intervention for children with autism is ongoing, but best practice recommendations suggest: early entry, intensive instruction all day 5-days per week, year-round, and inclusive settings [2].
There are several modern methods of autism treatment.
One of the earliest documented and most widely cited early interventions for young children with ASD is applied behavioral analysis (commonly known as ABA). Positive results from this intensive 40-h per week behavioral intervention include improvements in intellectual and educational functioning. A similar, yet unique early intervention is discrete-trial training (DTT). Proponents of DTT view ASD as a multitude of unique behaviors and reject the idea of one central deficit that can be found in all individuals with ASD [3].
Early Intensive Behavioral Intervention (EIBI). This is a type of ABA for very young children with an ASD, usually younger than five, and often younger than three. Pivotal Response Training aims to increase a child's motivation to learn, monitor his own behavior, and initiate communication with others. Positive changes in these behaviors should have widespread effects on other behaviors. Verbal Behavior Intervention (VBI) is a type of ABA that focuses on teaching verbal skills [4].
Medication. Currently, there is no medication that can cure autism spectrum disorder (ASD) or all of its symptoms. But some medications can help treat certain
symptoms associated with ASD, especially certain behaviors. In 2006, the U.S. Food and Drug Administration (FDA) approved the drug risperidone for treating irritability in children with autism who are between 5 years and 16 years of age. Risperidone is currently the only FDA-approved drug for the treatment of specific autism symptoms [3]. Other drugs are often used to help improve symptoms of autism, but they are not approved by the FDA for this specific purpose.
Physical therapy. Physical therapy includes activities and exercises that build motor skills and improve strength, posture, and balance. Problems with movement are common in autism spectrum disorder (ASD), and many children with autism receive physical therapy. However, there is not yet solid evidence that particular therapies can improve movement skills in those with autism.
Conclusion. We have studied the main methods of treatment of autism spectrum disorder. We can say that early behavioral interventions and other treatment models have a positive influence on the mental and social development of the patient.
References
1. Еникеев М.И. Общая и социальная психология: учебник для вузов /
М.И. Еникеев. - М.: НОРМА-ИНФА, 1999. -624 с.
2. https://iliveok.com/health/autism-chil-dren_76867i15937.html
3.https://iliveok.com/news/new-method-diagnosing-autism-was-suggested-califor-nia_93213i15817.html
4. https://iliveok.com/health/syndrome-early-childhood-autism 94745i88403.html
Mogulevtseva J.A.
Bachelor of Science Russian State Agrarian University -Moscow Timiryazev Agricultural Academy
MezentsevA. V.
Doctor of Philosophy N.I. Vavilov Russian Institute of General Genetics - IOGen RAS
CLONING A SEQUENCE OF SMALL HARPIN RNA DIRECTED TO HUMAN GELATINASE B INTO THE EXPRESSION VECTOR pGPV-17019250
Summary. INTRODUCTION: Matrix metalloproteinases are a group of zinc-containing calcium-dependent endopeptidases that play a crucial role in the pathogenesis of hyperproliferative disorders, such as psoriasis. In psoriasis, matrix metalloproteinases contribute to epidermal remodeling due to their ability to modify the composition of the extracellular matrix and modulate the intercellular contacts. They also regulate the penetration of dermal microcapillaries by immune cells.
AIM of this study was to create a vector that would express small hairpin RNA (shRNA) specific to human gelatinase B and suppress its expression in cultured epidermal keratinocytes.
METHODS: shRNA specific to gelatinase B was designed using "RNAi-designer" online tool. The sequence encoding shRNA was cloned into the vector pGPV-17019250 using commercial T4 DNA-ligase and restriction endonucleases BamH1 and EcoRI. The integrity of the obtained expression vector pGPV-17019250-GB was confirmed by PCR amplification and DNA sequencing with vector-specific primers.
RESULTS: In this study, we selected a DNA sequence that encodes shRNA specific to human gelatinase B. We also synthesized and cloned the named sequence into the expression vector pGPV-17019250. In addition, we confirmed that the selected DNA sequence was properly cloned into the vector.
! !■
36 Wschodnioeuropejskie Czasopismo Naukowe (East European Scientific Journal) #4(44), 2019 SMI IN CONCLUSION, we obtained the expression vector pGPV-17019250-GB that encodes a sequence of shRNA directed to human gelatinase B. The named vector is designated for the experiments that aim to explore the consequences of gelatinase B silencing in cultured human cells.
Key words: psoriasis, gelatinase B, molecular cloning, expression vector, shRNA, gene silencing.
INTRODUCTION
Psoriasis is a chronic T-cell mediated skin disorder associated with systemic inflammation and overproduction of inflammatory cytokines. The prevalence of psoriasis in different populations varies from 0.91% in the United States to 8.5% in Norway [1]. In the midland Russia, the disease rate does not exceed 2.0% [2]. Although multiple treatment options are available, to date there is no cure for the disease. For this reason, search for new therapeutic approaches is needed to target the specific groups of psoriasis patients that either do not respond well to the traditional therapies or develop a drug resistance. Accomplishing this task would be hard to imagine without identification of key participants that play a decisive role in the pathogenesis of the disease and evaluation of their clinical potential. In the lab, we are studying the molecular basis of psoriasis. Particularly, we are interested in exploring the signaling pathways modulated by matrix metalloproteinases, such as gelatinase B (GB)/matrix metalloproteinase 9.
Matrix metalloproteinases (MMPs) are a group of enzymes that play a crucial role in maintenance of extracellular matrix [3]. In psoriasis, MMPs contribute to epidermal remodeling and regulate permeability of blood vessels for immune cells. Moreover, MMPs modulate the biological effects of proinflammatory cy-tokines that provoke the immune response in diseased skin. Upregulation of several MMPs, including GB, in skin lesions coincides with exacerbation of psoriasis. Furthermore, their expression correlates with disease severity [4]. For this reason, it would be important to control MMPs expression in lesional skin and develop new therapeutic approaches that would specifically target their individual isoforms.
The aim of this study was to obtain a vector that would express shRNA directed to human gelatinase B (GB shRNA) and could be used to target GB in cultured human cells.
MATERIALS AND METHODS
Design of shRNA
The sequence of GB cDNA (NM_004994.3) was downloaded from the database "NCBI Nucleotide" [5]. This sequence was used to identify target sequences in GB cDNA as described earlier [6]. The specificity of selected fragments was confirmed using "Blastn" [7]. The online application "Oligo Calc" [8] was used to verify whether the selected fragments form thermody-namically stable elements of secondary structure, such as internal dimmers and pins. The online application "RNAi designer" (Clontech) was used to obtain DNA sequences encoding GB shRNAs.
Digestion of the expression vector pGPV-17019250 by restriction endonucleases
To clone the shRNA encoding sequence into the expression vector pGPV-17019250 (Evrogen, Russia), the vector (1 ^g) was digested by restriction endonucleases BamHl and EcoRI, 1U each, for 2 h at 37°C. Then,
the obtained DNA fragments were separated by electrophoresis in 1% agarose gel.
Purification of DNA from agarose gel
At the completion of electrophoresis, the desired DNA fragment was cut from the gel by a razor blade and incubated in 6M KJ at 55°C until dissolved (5-10 min). Then, DNA was precipitated on "glassmilk", washed and eluted in a small volume of bidistilled water (~30 ^L) [9].
Annealing
Double strand DNA (dsDNA) that encodes GB shRNA was obtained by annealing of complementary single strand DNAs (ssDNA). Briefly, a water solution of the desired oligonucleotides was prepared in 1x TE buffer, incubated for 2 min at 95°C and gradually cooled down to room temperature for 30-45 min.
Ligation
To ligate GB shRNA encoding oligonucleotide with electrophoretically pure fragment of the vector, they were mixed in the ratio 10:1 in 1x ligation buffer. Then, 2.5-12.5 U of T4 DNA ligase (ThermoFisher, USA) was added per 1 ^g of total DNA and the obtained probes were kept in an ice bath overnight. Next morning, the ice bath was placed on a desk and kept at room temperature for couple of hours.
Transformation of E, coli
The ligation products were introduced into XL-1 Blue E. coli (ThermoFisher) through heat shock transformation [10]. Before the transformation, the tubes contained competent cells of the mentioned E. coli strain were cooled on ice (4°C, 30 min). Then, 10 ^L aliquots of DNA were dispersed among the cells (1 aliquot per transformation). The prepared samples were transferred to a heat block (42°C) for 2 min and then, put back on ice for 5 min. The transformed cells were mixed with LB medium, incubated for 1h at 37°C without shaking and plated on 1% LB-agar contained ampi-cillin (12 ^g/mL) for selection. Next morning, the bacterial clones resistant to ampicillin were counted using "Cell counter" plug-in of ImageJ freeware [11].
Validation of the cloning results
To check the length of the cloned fragment, samples of plasmid DNA were amplified with vector-specific primers EXT-F (ACGTGAAATGTCTTTGGATTTGGG) and EXT-R (CAGAGAGACCCAGTAGAAGCA). The amplified PCR-products were separated in 2% agarose gel. Then, samples were subjected to DNA-sequencing with the same primers in a local Evrogen service center. The sequencing results were analyzed using SnapGene Viewer (SnapGene, USA).
Statistical analysis
Data were represented as means ± SE. The statistical differences between the means were analyzed by one-way ANOVA. Multiple comparison procedures
SHsäB Wschodnioeuropejskie Czasopismo Naukowe (East European Scientific Journal) #4(44), 2019 37 were performed using the Holm Sidak method. If p values were less than 0.05, means were considered to be significantly different.
Table 1
Sequences of target DNA selected by "siDRM" online tool for the design of GB shRNA
№ Target cDNA sequence Position in Predicted
cDNA Efficacy*
1. TACCTGTACCGCTATGGTT 161-179 very high
2. TCAAGTGGCACCACCACAACA 360-379 medium
3. CATCACCTATTGGATCCAA 378-397 very high
4. CAGTTTCCATTCATCTTCCAA 883-904 very high
* The parameter "predicted efficacy" was assessed by "siDRM".
RESULTS
Selection target sequences in mRNA Analysis of mRNA encoding human GB performed with siDRM online tool [6] identified four cDNA target sequences that could be used to design GB shRNA (Table 1). Using "Primer-Blast" [7], we found that they had 75% or less sequence homology with other human protein encoding mRNAs (Table 2).
Table 2.
Analysis of target sequences for the ability to form stable elements of secondary structure and their speci-
Then, we verified whether the mentioned above fragments could form the elements of secondary structure using "OligoCalc" online tool [8]. Respectively, we found that the selected fragments formed neither stable pins nor dimers. Based on the obtained results, we concluded that all identified target sequences (Table 1) could be used to design GB shRNA.
№ cDNA target sequence Sequence Contribution to stable*
homology dimers pins
1. TACCTGTACCGCTATGGTT ARSI, 73% no no
2. TCAAGTGGCACCACCACAACA NAA35, 71% no no
3. CATCACCTATTGGATCCAA BRCA2, 73% no no
4. CAGTTTCCATTCATCTTCCAA GNG4, 75% no no
* "Blastn " online tool was used to assess sequence homology of the identified target sequences with other protein encoding mRNAs;
^ "Oligo Calc" online tool was used to verify whether the identified target sequences were capable to form the named elements of secondary structure.
Design of GB shRNA
The sequence encoding shRNA was designed for a randomly chosen cDNA target (Table 1, sequence 4) using "RNAi designer" online tool [12]. This sequence was 70 bp long (Figure 1) and it was composed of two strains flanked by half-binding sites of the restriction endonucleases EcoRI and BamH1. The mentioned halfsites were needed for proper ligation of the named dsDNA with the vector pGPV-17019250. Both DNA
strains also contained so-called "sense" sequence that was necessary for binding GB shRNA to GB mRNA, its complementary sequence ("antisense"), a 9-base sequence TTCAAGAGA that encoded the middle loop and poly-A tail. Thus, upper (+) and lower (-) cDNA strains were complementary to each other, except several terminal nucleotides that mostly belonged to the EcoRI and BamH1 binding sites.
Figure 1. dsDNA sequence encoding GB shRNA.
BamH1 and EcoRI - half-sites of the named restriction endonucleases; sense - GB mRNA binding sequence; antisense -the sequence complementary to the sense sequence; loop - the sequences encoding the middle loop (marked in bold); poly(T) - the sequence encoding poly(A) tail.
Cloning of the GB shRNA encoding sequence into the expression vector pGPV-17019250
The selected cloning strategy included several consequent steps, which were the following: digestion of the vector with restriction endonucleases EcoRI and BamH1, electrophoretic separation of the digested DNA fragments (7,852 and 59 b.p.) in 1% agarose gel (Figure 2), purification of the larger 7,852 b.p. DNA fragment from the gel, ligation of GB shRNA encoding
cDNA with the purified vector DNA and transformation of E. coli with the products of the ligase reaction.
Figure 2. Separation of DNA fragments originated from the expression vector pGPV-17019250 after its digestion with the restriction endonucleases BamH1 u EcoRI.
M- 1 kB DNA ladders; V- 7,852 b.p DNA fragment of the vector. The vector (1 ^g) was incubated in the presence of restriction endonucleases BamH1 and EcoRI (1 U) for 2h at 370C.
The results of bacterial transformation demonstrated that the highest number of transformed E. coli clones was observed in the sample prepared with 7,5 U of T4 DNA ligase per 1 ^g of total DNA (Figure 3). The differences between the respective means for the
samples obtained with 7.5, 10.0 and 12.5 U of the enzyme were insignificant (P = 0.81) when multiple comparison procedures were used. In contrast, the means were significantly different (P < 0.05) when the sample obtained with 5.0 U of the enzyme was compared with any subsequent sample. Based on these findings, we concluded that the ratio 7.5 U of the enzyme per 1 ^g of total DNA was optimal for our experiments because a further increase of enzyme activity did not produce evident changes in the number of transformed clones.
Figure 3. Transformation of E. coli with the products of ligation reaction.
The probes used in the experiments contained 2.5 -12.5 U T4 of DNA ligase per 1 ^g of total DNA. The samples were processed as described in the section "Materials and methods".
Validation of the cloning results To prove that the plasmid DNA isolated from the clones of transformed E. coli encoded GB shRNA, we
amplified the obtained DNA samples with vector-specific primers. The following separation of PCR-products in 2% agarose gel revealed a 150 bp band that could belong to the cloned DNA (Figure 4). The following DNA sequencing (Figure 5) confirmed that the mentioned above insert was the DNA sequence that we intended to clone.
M 1 2 3
Figure 4. PCR amplification ofplasmid DNA isolated from the transformed E.coli clones.
M - 50+ bp DNA ladders; 1-3 -the tested DNA samples. The sequences of PCR primers used for amplification were represented in the section "Materials and Methods".
DISCUSSION
Small interfering RNAs (siRNAs) that destroy protein-encoding mRNAs are present in any viable cell. Targeting mRNAs, siRNAs prevent their translation into proteins by the ribosomes. Respectively, even partial degradation of mRNA by siRNA decreases protein expression. For this reason, the artificially designed siRNAs, known as small hairpin RNAs (shRNAs), are often used in routine experimental practice to knock
down disease-associated genes. For instance, GB shRNA could be used to target GB in cultured mammalian cells.
To date, it is well-documented that GB expression is increased in lesional skin [4]. The previously published results suggest that GB expression level correlates with disease severity and, therefore, can be used as a biomarker of disease activity [13]. The other data indicate that GB is directly involved in epidermal remodeling that precedes the development of psoriatic plaques [3] and contributes to the activation of diseases-associated cytokines, such as TNF [14].
i-—-^
|acgtgaaatgtctttggatttggg|
ggagtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataa
■ ...I...................................................... 1111' .....................
cctcaccgcgggacgttataaacgtacagcgatacacaagaccctttagtggtatttgcactttacagaaacctaaacccttagaatatt
BamHI
I
gttCtgtatgagaccacttggatCCGCAGTTTCCATTCATCTTCCAATTCAAGAGATTGGAAGATGAATGGAAACTGTTTTTTACGCGTg
.........I.............................I.........I.............................I.........I
caagacatactctggtaaaCCtaggCGTCAAAGGTAAGTAGAAGGTTAAGTTCTCTAACCTTCTACTTACCTTTGACAAAAAATGCGCAC
aattcttcgattctgctttttgcttctactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaaccca
...................I.........I'........I.........I............ .......................... ■ I
ttaagaagctaagacgaaaaacgaagatgacccagagagaccaatctggtctagactcggaccctcgagagaccgattgatcccttgggt lACGAAGATGACCCAGAGAGACl
Figure 5. Sequence analysis ofplasmid DNA isolated from transformed E. coli.
The purified plasmid DNA was sequenced with vector-specific primers EXT-F and EXT-R. The primer sequences are described in the section "Materials and methods". The binding sites of restriction endonucle-ases are identified by their names.
In this study, we indentified and prepared dsDNA oligonucleotide that encodes GB shRNA (Figure 1) and confirmed its specificity to GB mRNA (Table 2) to minimize the possibility of so-called "off-target effects" [15]. We also cloned it into the expression vector pGPV-17019250 and sequenced a part of the vector that contained the cloned sequence (Figure 5).
The sequence that we selected for cloning was one of four possible targets in GB cDNA (see Table 1). To verify whether these sequences were already used by others to study the biological effects of GB silencing, we performed a literature search. We found that Turner N.A. et al. used sequence 1 (Table 1) to explore GB role in the stenosis of saphenous vein [16]. In their study, the authors silenced GB by 90%. In turn, Gondi C.S. et al. used sequence 2 to design the expression vector for simultaneous silencing of three genes that encoded proteases uPA, uPAR and GB [17]. After the authors infected glioma cells with the vector, the level of
the remained GB dropped by 90%, compared to the control. They also found that suppression of targeted proteases, including GB, delayed the cell migration by 15% and inhibited angiogenesis by 60%. In addition, they achieved a 25% regress of pre-established intra-cranial tumors in nude mice.
Sequence 3 was used in three different studies. Sanceau J et al used it as a part of RNA duplex (dsRNA) to prevent migration of metastatic Ewing's sarcoma cells [18]. Brule S. et al. used the same dsRNA to explore the role of GB in shedding syndecans 1 and -4 of the cell membrane [19]. Meyer E et al, used sequence 3 in the form ssRNA to prove the role of GB in protection of colon cancer cells from apoptosis [20]. In the mentioned experiments (e.g. [19]), targeting GB led to 70% and 50% decreases in GB mRNA and protein levels, respectively.
Finally, sequence 4 that we chose for cloning was also used by Hu M, et al. to explore the interaction of epithelial and stromal cell in breast cancer [21]. In their study, the authors integrated GB shRNA encoding sequence into a lentiviral genome, achieved a stable shRNA expression in the infected cells and knocked GB down by >90%.
Similarly to the vector that Hu M, et al. used in their study, the vector pGPV-17019250 that we chose for our experiments [22] encoded a lentiviral genome. In the present time, commercial lentiviral vectors are frequently used to deliver and express the genes of interest in mammalian cells including human epidermal keratinocytes. For safety reasons, the commercial len-tiviral vectors are missing several viral genes that make them infectious. In the same time, they usually contain additional genes. These genes are needed to replicate the vector in E. coli and monitor the infection of mammalian cells. For instance, the vector pGPV-17019250 contained three additional genes. The first of them was the resistance factor to ampicillin AmpR. Expression of this gene in bacteria made possible to select E. coli clones transformed with pGPV-17019250. The second gene was the resistance factor to puromycin PuroR. This gene was needed to make mammalian cells infected with pGPV-17019250 resistant to puromycin. Respectively, PuroR expression made possible a selection of infected cells on a puromycin-containing medium. The third gene was the fluorescent protein Cop-GFP. The expression of CopGFP made possible to track the infected cells in a fluorescent microscope.
In our study, we cloned the sequence encoding GB shRNA between the binding sites of two restriction endonucleases EcoRI and BamH1 (Figure 1). These sites are important for successful cloning for two reasons, First, they are unique, i.e. each enzyme cut pGPV-17019250 only in one place. Second, the space located between these sites does not contain DNA motifs, such as open reading frames, that could be essential for proper functioning of the vector.
To optimize the enzyme activity in the ligation reaction, we varied T4 DNA ligase in the probes (Figure 3). Optimizing the ligase activity is important because the stock solution of the enzyme might contain nonspecific exo- and endonucleases that could introduce mutations into DNA [23]. Respectfully, than more nonspecific nucleases the probes contain, than more mutations and less transformed clones may appear (Figure 3).
To minimize chances of acquiring a mutation, we randomly selected three E. coli clones from the plate with the highest number of transformed clones. Then, we verified whether plasmid DNA isolated from these clones contained an insert of the expected size and this sequence did not have any mutations. First, we amplified the plasmid DNA with the specific primers, EXT-F and EXT-R that supposed to flank the cloned sequence. We found (Figure 4) that the amplified DNA contained ~150 bp PCR-product. Since the size of the amplified DNA was close to the expected size (154 bp), we sequenced one of the samples of plasmid DNA with the same primers. Particularly, we sequenced both DNA strands using one primer at the time and found that both strands contained the cloned oligonucleotide. Moreover, the sequenced DNA fragments overlapped each other. The latter helped us to explore the so-called "junction regions", i.e. clarify whether the cloned oli-gonucleotide was properly integrated into the vector. Thus, we confirmed that the plasmid DNA contained
the sequence encoding GB shRNA (Figure 5), i.e. the DNA sequence that we aimed to clone (Figure 1).
In conclusion, we would like to acknowledge that we obtained vector pGPV-17019250-GB that encoded GB shRNA. We also preserved E. coli clones that were transformed with the named vector. The obtained vector can be used to express GB shRNA in cultured cell and study the biological effects of GB silencing in vitro.
References
1. Parisi R., Symmons D.P., Griffiths C.E. and Ashcroft D.M. Global epidemiology of psoriasis: a systematic review of incidence and prevalence. J. Invest. Dermatol. 2013. 133(2):p. 377-385.
2. Znamenskaya L.F., Melehina L.E., Bogdanova E.V. and Mineeva A.A. Prevalence and distribution of psoriasis in Russian Federation. Vestn. Dermatol. Venerol. (5):p. 20-29.
3. Mezentsev, A., A. Nikolaev, and S. Bruskin, Matrix metalloproteinases and their role in psoriasis. Gene, 2014. 540(1): p. 1-10.
4. Starodubtseva N.L, Sobolev V.V., Soboleva A.G., Nikolaev A.A. and Bruskin S.A. Expression of genes for metalloproteinases (MMP-1, MMP-2, MMP-9, and MMP-12) associated with psoriasis. Genetika. 2011. 47(9):p. 1254-1261.
5. Database "NCBI Nucleotide", http://www.ncbi.nlm.nih.gov/nuccore/ (accessed at Jan 3, 2019).
6. Ren Y, Gong W., Zhou H., Wang Y., Xiao F. and Li T. siRecords: a database of mammalian RNAi experiments and efficacies. Nucleic Acids Res. 2009. 37(Database issue): D146-149.
7. Online Application "blastn suite", https ://blast. ncbi. nlm. nih. gov/Blast.cgi?PAGE_TYPE =BlastSearch (accessed at Jan 3, 2019).
8. Kibbe W.A. OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Res. 2007. 35(Web Server issue): W43-6.
9. Vogelstein B. and Gillespie D. Preparative and analytical purification of DNA from agarose. Proc Natl Acad Sci U S A. 1979. 76(2): p. 615-619.
10. Huff J.P., Grant B.J., Penning C.A., Sullivan K.F. Optimization of routine transformation of Escherichia coli with plasmid DNA. Biotechniques. 1990. 9(5):p. 570-572, 574, 576-577.
11. Rueden C.T., Schindelin J., Hiner M.C., DeZonia B.E., Walter A.E., Arena E.T., Eliceiri K.W. ImageJ2: ImageJ for the next generation of scientific image data, BMC Bioinformatics 2017. 18:p. 529.
12. Online Application "RNAi designer", http ://bioinfo. clontech.com/rnaidesigner/frontpage.j sp (accessed at Jan 3, 2019).
13. Glazewska E.K., Niczyporuk M., Lawicki S., Szmitkowski M., Zajkowska M., Donejko M., Przylipiak A. ROC analysis of selected matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) in psoriatic patients. Postepy Dermatol. Alergol. 2018. 35(2):p. 167-173.
14. Gearing A.J., Beckett P., Christodoulou M., Churchill M., Clements J., Davidson A.H., Drummond A.H., Galloway W.A., Gilbert R., Gordon J.L, Processing of tumour necrosis factor-alpha precursor
by metalloproteinases. Nature. 1994. 370(6490):p. 555-557.
15. Boese Q., Leake D., Reynolds A., Read S., Scaringe S.A., Marshall W.S. and Khvorova A.
Mechanistic insights aid computational short interferingRNA design. Methods Enzymol, 2005. 392: p. 73-96.
16. Turner N.A., Hall K.T., Ball S.G. and Porter K.E. Selective gene silencing of either MMP-2 or MMP-9 inhibits invasion of human saphenous vein smooth muscle cells. Atherosclerosis. 2007. 193(1):p. 36-43.
17. Gondi C.S., Lakka S.S., Dinh D.H., Olivero W.C., Gujrati M. and Rao J.S. Downregulation of uPA, uPAR and MMP-9 using small, interfering, hairpin RNA (siRNA) inhibits glioma cell invasion, angiogenesis and tumor growth. Neuron Glia Biol. 2004. 1(2):p. 165-176.
18. Sanceau J, Truchet S, Bauvois B. Matrix metalloproteinase-9 silencing by RNA interference triggers the migratory-adhesive switch in Ewing's sarcoma cells. J. Biol. Chem. 2003. 278(38):p. 3653736546.
19. Brule S., Charnaux N., Sutton A., Ledoux D., Chaigneau T., Saffar L. and Gattegno L. The shedding
of syndecan-4 and syndecan-1 from HeLa cells and human primary macrophages is accelerated by SDF-1/CXCL12 and mediated by the matrix metalloproteinase-9. Glycobiology. 2006. 16(6):p. 488-501.
20. Meyer E., Vollmer J.Y., Bovey R. and Stamenkovic I. Matrix metalloproteinases 9 and 10 inhibit protein kinase C-potentiated, p53-mediated apoptosis. Cancer Res. 2005. 65(10):p. 4261-4272.
21. Hu M., Peluffo G., Chen H., Gelman R., Schnitt S. and Polyak K. Role of COX-2 in epithelial-stromal cell interactions and progression of ductal carcinoma in situ of the breast. Proc. Natl. Acad. Sci U S A. 2009. 106(9):p. 3372-3377.
22. Mogulevtseva J.A. and Mezentsev A.V. Cloning of the sequence encoding small interfering RNA directed to human matrix metalloproteinase 1 into the expression vector pGPV-17019250. Wschodnioeuropejskie Czasopismo Naukowe. 2016. 9(1):p. 85-93
23. Kuhn, H. and Frank-Kamenetskii M.D. Template-independent ligation of single-stranded DNA by T4 DNA ligase. FEBS J. 2005. 272(23): p. 59916000.
Melkonyan Arman
Student, National Polytechnic University of Armenia
ANALYSIS AND MODELING OF EQUIVALENT SCHEMES OF BIOLOGICAL TISSUE
Abstract: There have been observed the peculiarities of different types of biological tissue, the principles of electric circuits constructions. These principles have allowed constructing biological tissue-equivalent electrical circuits by using two, three, and four elements. There have been introduced the most commonly used electrical schemes of biological tissue, as well as their impedance phrases and application areas. An analysis of the adequate schemes and simulation of the MATLAB software environment has been performed and modelling results have been implemented.
Keywords: biological tissue, impedance, construction principle, equivalent electrical scheme, modelling.
Introduction.
By the nature of the electrical properties biological tissue is a heterogeneous environment. Organic substances (proteins, fats, carbohydrates, etc.) that make up the dense parts of tissues are dielectrics. However, all tissues and cells in the body contain fluids or are washed by them (blood, lymph, various tissue fluids), in addition to organic colloids, these fluids also contain electrolyte solutions, and therefore their resistivity to direct current is quite big.
The electrical conductivity of biological tissues (BT) is determined by the presence of free ions. The Ohm's law does not apply to BTs (due to polarization the current decreases in 2-3 ways/categories/). For the analysis of the effects of electrophysical properties of BTs on excitation processes, passive BTs are presented with equivalent electrical schemes (EESs) having alive BT impedance properties [1-6]. BT structural surveys are conducted in a wide range of frequencies (100 Hz ... 10 KHz). For this purpose, the frequency capabilities of BTs are presented in the form of EESs that correspond to the regularity of the distribution of electricity
in biological systems (the phenomenon of ionic conductivity and charge separation in BTs is caused by phase deviation of current and voltage). Tissue membranes have complicated structures, and according to Cole, they can be compared with capacitors [1]. The active ingredients of biological-electrical impedance (BEI) characterizing the flow of external and internal electrolytes (blood, lymph, interstitial fluid, etc.) are conditioned by the replacement of the amplifiers in the electric chain, and the capacitance components are characterized by separating the vacuum cleaners which is typical to the multidimensional BTs. At low frequencies (f < 100 Hz), the capability of the BT's is small, and the base deposit is an active component which is attributed to the upper layers of the skin. At high frequencies (f >10 kHz), the capacitance component of BTs decreases (decreases the impact of the discharging structures), and the active component strives for a constant value, characterizing the properties of high-definition BTs.
The nature of the problem and justification of the methodology. The construction of EES for BT is an important stage in the investigation of the given
