CC BY
5Characterization and Analysis of the Major Structural Protein Genes of the Recently Isolated Avian Infectious Bronchitis Virus in Egypt
Nahed Yehia*, Dalia Said and Ali M. Zanaty
Reference Laboratory for Veterinary Quality Control on Poultry Production, Animal Health Research Institute, Agriculture Research Center,
Dokki, Giza 12618, Egypt Corresponding author's Email: [email protected], ORCID: 0000-0002-2823-6467.
Received: 09 Nov. 2020 Accepted: 21 Dec. 2020
ABSTRACT
Infectious Bronchitis Virus (IBV) is a severe infectious disease affecting chickens and causing serious economic loss. Although several studies have been conducted to characterize HVRs-S1 (Hyper-Variable Regions of Spike 1 gene) in Egypt, few of which aimed to characterize the major structural protein genes. In the present study, the genetic characterization of the major structural protein genes was carried out in 10 isolates selected from six governorates in 2019. Phylogenetically, the S1 gene was clustered into genotype GI-23 (variant II), with seven viruses that were clustered into Egy/Var II occurring in two subgroups (I, II) when aligned with previously isolated Egyptian strains. It had a specific character of 40 Amino Acids (AA) mutations except for IBV/EG/CV32/2019, which had 50 AA mutations, specifically in HVRs regions (HVRI, II, and III). The other three strains were clustered into Egy Var I with 17 AA mutations except IBV/EG/F859/ 2019, which had 15 AA mutations, compared to IBV/CU/4/2014 reference strain. The examined isolates had an additional glycosylation site at position 280 and one was missing at position 139 with the exception of two strains that only had an additional one, compared to IBV/CU/4/2014. The viruses in this study differed genetically from various vaccine seeds in the range of 69-83%. The Nucleocapsid, genetically characterized in the group of variant II (Egy/Var II) and the glycoprotein membrane genes genetically characterized in the variant group in a new sub-group with 11 and 9 AA mutations, respectively. The recombination event was only detected in the S1 gene in two isolates of IBV/EG/CV32/2019 and IBV/EG/F859/2019 from D274 and QX, respectively. In this regard, it is important to conduct continuous surveillance, pathogenicity study, and vaccine efficacy evaluation.
Keywords: Characterization, Infectious bronchitis virus, Major structure protein, Matrix, Nucleoprotein, Spike
JWPR
2020, Scienceline Publication
J. World Poult. Res. 10(4): 649-661, December 25, 2020
Journal Of W°rld s Research Paper, PII: S2322455X2000074-10
Poultry Research License: CC BY 4.0
DOI: https://dx.doi.org/10.36380/jwpr.2020.74
structural protein is composed of glycoprotein Spike (S),
Nucleocapsid (N) protein, glycoprotein Membrane (M), Infectious bronchitis virus (IBV) is a serious viral disease , . . ~ ,
and protein Envelope (E) (Thor et al., 2011; Wang et al.,
affecting poultry and causing high economic loss
worldwide (Cavanagh et al., 2007; Milek et al.,2018). It is ™ c , . , ,
The S glycoprotein is a surface protein cleaved into caused by avian IBV, a member of the Coronaviridae ^ . _ , _,„ „. . ^ ^ ^
two subunits of S1 and S2. The S1 subunit constitutes the
family, the 99+Coronavirinae subfamily and genus Gammacoronavirus (Carstens, 2009). It affects the respiratory, reproductive, and renal systems of all ages in different ways and increases the exposure to other pathogen infections (Cavanagh et al., 2007; Jackwood, 2012).
The IBV genome is a single-stranded and positivesense (Masters and Perlman, 2013). The genome consists of 5 '-UTR-1a-1b-S-3a-3b-E-M-4b-4c-5a-5b-N-6b-UTR-poly (A) tail-3' (Brierley et al., 1989) encodes major structural proteins and non-structural protein. The major
highly variable globular head, which was responsible for the serotype and virus neutralization (Cavanagh et al., 1992). In addition, it contains a receptor binding site that is important for tissue tropism (Ammayappan et al., 2009). The N protein plays a significant role in the replication and assembly of the virus (Lai and Holmes, 2001). The S1 and N are the key genes for determining pathogenicity, evolution, and diversity of IBV (Lee et al., 2003; Ammayappan et al., 2009). The M protein is mainly responsible for the viral assembly process (Corse and Machamer, 2003). Several IBV serotypes and genotypes
TSE3ESE233EaSS9 Yehia N, Said D and Zanaty AM (2020). Characterization and Analysis of the Major Structural Protein Genes of the Recently Isolated Avian Infectious Bronchitis Virus in Egypt. J. World Poult. Res., 10 (4): 649-661. DOI: https://dx.doi.org/10.36380/jwpr.2020.74
with minimal cross-protection were found around the world. The IBV evolves rapidly in nature through the substitution, insertion, deletion and/or recombination of different genes (Jackwood, 2012; Hewson et al., 2014; Hassan et al., 2019). Thus, the new highly virulent viruses emerge with minimal cross-protection leading to vaccination failure (Cavanagh et al., 2007; Jackwood, 2012). Multiple serotypes and genotypes of IBV were found in Egypt and co-circulated in the field (Abdel-Moneim et al., 2002; Abdel-Moneim et al., 2012). Depending on the complete S1 sequence, Valastro et al (2016) grouped the Egyptian variant strains into the GI-23 lineage. An Egyptian variant I strain was identified in various poultry farms in 2001 (Abdel-Moneim et al., 2002). In 2011, the new variant (Egyptian variant II) was detected in both vaccinated and non-vaccinated flocks causing severe outbreaks (Abdel-Moneim et al., 2012). The Egyptian variant II differed from the classical vaccine H120 and Ma5 used in Egypt (Abd El Rahman et al., 2015). In 2012, an upgrade of the vaccines was introduced to control the outbreak in Egypt using "variant" vaccine strains 1/96, 4/91, CR88, and D274 (Abozeid et al., 2017). With this background in mind, the present study aimed to investigate the variability of major IBV structural protein genes in Egypt (S1, N, and M) during 2019 using 10 isolates from different governorates and evaluate current control measures in the field.
MATERIALS AND METHODS
Ethical approval
The present study did not work on animals or human participants directly.
Isolation information
In the present study, ten IBV isolates from ten infected chicken farms from six different governorates were isolated in 2019 in nine to 11-days-old Specific Pathogenic Free Embryonated Chicken Egg (SPF-ECE) in the allantoic fluids and then the allantoic fluid was collected after 48 hours post-inoculation and stored at -80 °C (Li et al., 2012). The S1, N, and M genes were sequenced and published by the National Center for Biotechnology Information (NCBI) with the accession number provided in Table1.
Polymerase chain reaction and sequencing of S1, N, and M genes from IBV isolates
Viral RNA was extracted from the infected allantoic fluid of Specific Pathogen Free (SPF) eggs using a mini kit of QIAmp viral RNA (Qiagen, Hilden, Germany), as instructed by the manufacturers. The cDNA synthesis was performed using a First-Strand Synthesis System SuperScriptTM III (Thermo Fisher Scientific, MA, USA) according to the manufacturer's instructions. The S1, N, and M genes were amplified using specific primers (Table 2) and high fidelity Phusion® DNA polymerase (Thermo Fisher Scientific, MA, USA) according to the manufacturer protocol. The amplification of the reverse transcription-Polymerase Chain Reaction (PCR) were detected by agarose gel electrophoresis. The purification was carried out using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). Full-length sequencing was performed with gene-specific primers using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, California, USA) and the nucleotide sequence was obtained from an ABI 3500 Genetic Analyzer (Life Technologies, California, USA).
Table 1. Epidemiological data and accession number of major structural protein genes (S1, N, and M) of IBV isolates by the
National Center for Biotechnology Information
Code collection Date Governorate GenBank Accession number
S1 N M
1 IBV/EGY/CH/CV48/2019 2/2019 Giza MN651560 MT085346 MT085356
2 IBV/EGY/CH/CV10/2019 1/2019 Sharqia MN651561 MT085342 MT085359
3 IBV/EGY/CH/CV17/2019 5/2019 Behera MN651562 MT085343 MT085358
4 IBV/EGY/CH/CV31/2019 5/2019 Sharqia MN651563 MT085344 MT085353
5 IBV/EGY/CH/CV32/2019 3/2019 Behra MN651564 MT085349 MT085352
6 IBV/EGY/CH/CV125/2019 1/2019 Giza MN651565 MT085347 MT085354
7 IBV/EGY/CH/F5 80/2019 7/2019 Dakhlia MN651566 MT085345 MT085361
8 IBV/EGY/CH/F564/2019 6/2019 Qaliobia MN651567 MT085348 MT085360
9 IBV/EGY/CH/F742/2019 4/2019 Gharbia MN651568 MT085350 MT085357
10 IBV/EGY/CH/F859/2019 8/2019 Sharqia MN651569 MT085351 MT085355
Table 2. Primers sequences of S, N, and M genes of IBV
Gene Primer sequence
Amplicon size
Reference
3' NP-F 3'NP-IR
ATTCCAAGGGAAAACTTGTG TCCTCATTCATCTTGTCATCACC
832
The present study
NP
NP-IF NP-R
GGTATAGTGTGGGTTGCTG AGCTGTGCATTGTTCCTCTC
832
The present study
M
3'M-F 3'M-R
TTTTGGTATACATGGGTAG TACTCTCTACACACACACAT
880
The present study
S1
IBV-S1- F2 IBV- HVR3- Reverse
GATTGTGCATGGTGGACAATG CAGAYTGCTTRCAACCACC
1100
Abdel-moneim et al. (2002); Naguib et al. (2017)
IBV-HVR3- Forward IBV-Oligo -3-Reverse
TAC TGGTAATTTTTCAGATGG CATAACTAACATAAGGGCAA
900
Adzhar et al. (1997); Gelb et al. (2005)
Genetic and phylogenetic analysis
Nucleotide and amino acid sequences of ten isolates were alignments with other IBV strains representing different groups (classical, variant I, variant II) and vaccine seeds (H120, M41, Ma5, 4/91, CR88121, and D274) that were used in Egypt were obtained from the National Center for Biotechnology Information. The alignment was carried out with the CLUSTAL-W program and the MegAlign module of DNASTAR software (Lasergene version 7.2; DNASTAR, Madison, WI, USA). The phylogenetic tree was constructed using MEGA version 6 (Tamura et al., 2013) according to the maximum likelihood tree method with moderate strength and 1000 bootstrap replicates (Kumar et al., 2016). The pairwise nucleotide percent identity was calculated using DNA star software (DNAStar, Madison, WI). The glycosylation sites were detected using NetN-Glyc 1.0 Server (Gupta et al., 2004).
Estimation of selection pressure
The sequence of S gene from the ten isolated IBV was analyzed to determine the selection pressure for each gene segment by estimating the ratio of non-synonymous (dN) to synonymous (dS) substitutions (ra=dMdS) across the lineages towards a codon-by-codon basis. The selective pressure was defined as ra= 1 indicates a neutral evolution, ra < 1 denotes a negative or purifying selective pressure, and ra > 1 refers to a positive selective pressure. The mean values of ra were calculated using the SLAC and FEL methods on the Datamonkey website (Delport et al., 2010).
The Recombination Detection Program (RDP 4, Version 4.95) was used to identify possible recombination events of S1, M, and N genes (Mo et al., 2013), including the algorithms RDP, Bootscan, Geneconv, MaxChi, Chimaera, SiScan, and 3Seq (Martin et al., 2015).
RESULTS
Genetic characterization of the spike gene
Phylogenetic analysis of the spike gene revealed that the ten Egyptian strains were clustered in GI 23 (variant II). The findings indicated that seven out of ten strains were clustered into Egy Var II, divided into two subgroups (I, II) as shown in Figure 1. The spike gene had specific features, compared to the reference strain IBV/CU/4/2014 isolated from Egypt in 2014. It had 40 Amino Acid (AA) mutations with the exception of IBV/EG/CV32/ 2019 that had a specific character with 50 AA mutations in different sites. The other three strains were clustered to Egy Var I with specific features. The three strains had 17 AA mutations with the exception of IBV/EG/F859/ 2019 that had 15 AA in comparison with the reference strain IBV/CU/4/2014 isolated from Egypt in 2014.
Hypervariable Regions (HVRs) in the S1 gene demonstrated different patterns among different viruses, compared to the IBV/CU/4/2014 strains. All of the Egy Var II related strains in the new cluster had two, four, and eight AA mutations with the exception of IBV/EG/cv32/ 2019 with 6, 7, 8 AA mutations in the HVRI, II, III, respectively (Figure 2).
Figure 1. Phylogenetic tree of the S1 gene. Figure shows the phylogenetic analysis of the S1 gene indicating all Egyptian strain clusters into genotype GI-23 (variant II) with three strains were sub-clustered into Egy VAR I and the other seven isolates sub-clusters into Egy VAR II, dividing it into two subgroups (I, II). Black dots indicate viruses sequenced in the current study.
The other three strains related to Egy Var I had two AA mutations in the HVRI with the exception of IBV/EG/F859/ 2019 which had one AA mutation. The four AA mutations were detected in the HVRII, except that IBV/EG/F742/ 2019 with three AA mutations. Finally, HVRIII of IBV/EG/CV125/ 2019, IBV/EG/F859/ 2019, IBV/EG/F742/ 2019 had five, seven, and one AA mutations, respectively (Figure 2).
All of the IBV strains in the present study had 17 N-linked glycosylation sites. However, the isolated strains lacked the glycosylation site at position 139 and had an additional glycosylation site at AA 280, compared to IBV/CU/4/2014 reference strain with the exception of IBV/EG/F742/2019 and IBV/EG/CV32/2019, which had an additional one at only 280. Selection pressure analysis demonstrated five positive selections at position 53, 69,128, 232, and 262 in all strains of the S1 gene.
Phylogenetic analysis and amino acids identity of the S1 gene revealed that the variant IBV isolates (Egy/Var I and Egy/Var II) had a significant relationship with vaccine seeds commonly used in Egypt, including H120, M41, 4/91, CR88, D274, Var I 1/96, in the range of 69% to 83% (Table 3).
Genetic characterization of N gene
Phylogenetic analysis of the N gene classified IBV strains into classical and variant groups. The variant group was classified into variant I and variant II. The Egyptian strains in the present study were clustered in GI 23 variant II and divided into two sub-groups (I, II; Figure 3). All strains had specific features (16 AA mutations), compared to the reference strain IBV/CU/4/2014 isolated from Egypt in 2014. However, the IBV/EG/CV32/ 2019 had a specific character with 11 AA mutations at different sites with no selection pressure. The amino acid identity of the N gene of the 10 strains, compared to IBV vaccine seeds Egypt, including Ma5, H120, 4/91, CR88, ranged 91-95% (Supplementry Table 1). All strains presented one N-glycosylation site at N protein residue 32 (Site of glycosylation: NASW).
Genetic characterization of M gene
The phylogenetic analysis of the M gene revealed no differentiation between variant I and II. All isolated strains in the present study were clustered in the variant group and appeared in a new sub-group (Figure 4). All of the strains had nine AA mutations, compared to the reference strain IBV/CU/4/2014 isolated from Egypt in 2014 without any selection pressure. The nucleotide identity of the M gene of the ten strains, compared to IBV vaccine seeds IBV/H120, Ma41, 4/91, was within the range of 94-96% (Supplemntry Table 2). All strains showed only one N-glycosylation site at residue 3/4/6 (Site of glycosylation: NCTL).
Figure 2. Hyper-variable regions of the S1 gene of IBV. The amino acid alignment and mutation of hyper-variable regions of tested isolates, compared to IBV/CU/4/2014.
49,*IBV-1|*IBV-
IBV-E GYIC H/CV125-2 019-M IB V-E GY /C №F 742-2019-M IBV-E GY/CH/CV 32-2019-M
• IBV-EGY/CH/CV17-2019-M
• IBV-EGY/GH/F564-2019-M
• IBV-EGY/CH/F580-2019-M IBV-EGY/CH/CV48-2019-M
• IB V-E GY/CH/F 85 9-2019-M
• IB V-EGY/CHfCV1 0-2019-M
• IB V-EGY/CHÎCV31-2019-fvl Infectious bronchitis virus strain ck/CHfl_HB/14Q532 Infectious bronchitis yrus strain ck/CHfl_SD/110410 Infectious bronchitis virus strain ck/CHfLHLJ/111246 g IBV-4/91 vaccine
Avian corona virus strain D274 IBV- IBV/Ck/EG/CU/4/2014
IBV- gammaCoV/Ck/PolancV162/1997 IBV- gamma CoV/Ck/Poland/G22S2017 IBV- gammaCoV/Ck/PolancVG103/2016 ss 1 IBV- gammaCoV/Ck/P ol an d/ G 052/ 2016 IBV- THA4Q151 32 protein gene IBV- CK/CH/LSD/05I IBV-A rkDPI11 ff? 1 IBV- Gonn46 1 991
IBV-QXBV-M
I-gipi9769109|gb|GU393337.1| IBV- Iowa 97
i— gi|319769096|gb|GU393336.1| IBV- Holte gi|319769069|gb|GU393334.1| IBV- G ray
-IBV- Mass41 1979
IBV/Ck/EG/CU/1/2014 IBV- ck/CH/LDL/101212 IBV- GX-NN170901 membrane protein IBV- GX-NN170805 membrane protein IBV- GX-LZ160322 membrane protein IBV- 13/1494/06 matrbc protein CM) Avian infectious bronchitis virus H120 Avian infectious bronchitis virus strain D41
IBY-VARIANT
IBV CLASSIC
Figure 3. Phylogenetic tree of the N gene. The phylogenetic analysis of the N gene revealed that all Egyptian strain clusters into genotype GI-23 (variant II) divided it into two subgroups (I, II). Black dots indicate viruses that were sequenced in the current study.
Figure 4. Phylogenetic tree of M gene. The phylogenetic analysis of the M gene revealed that all Egyptian strain clusters into the variant group in a new subgroup. Black dots indicate viruses that were sequenced in the current study.
Table 3. Nucleotide and Amino acid identities and divergence of S1 gene sequenced viruses compared to other selected strains and vaccine strains. Comparative alignment of the S1 gene showed that S1 A.A identity percent of tested strain ranged 69% to 83% with different vaccine seeds used in Egypt.
Sequence name
j
u •¡g
Ed £
o
p o
a
NUCLEOTIDE IDENTITY %
flarajarcngpnai Yehia N, Said D and Zanaty AM (2020). Characterization and Analysis of the Major Structural Protein Genes of the Recently Isolated Avian Infectious Bronchitis Virus in Egypt. J. World Poult. Res., 10 (4): 649661. DOI: https://dx.doi.org/10.36380/jwpr.2020.74
Figure 5. Recombination detection analysis of the S1 gene. Recombination events predicted for IBV/EG/CV32/2019 had a minor recombination from D274 and a major recombination from the Egyptian strain IBV/EG/F859 / 2019. However, the IBV/EG/F859/2019 had a minor recombination of QX and a major one of IBV/EG/CV10/2019.
Recombination analysis
The recombination events of the S1 were detected in two strains, with IBV/EG/CV32 / 2019 indicating a slight recombination from D274 and a larger recombination from the Egyptian strain IBV/EG/F859 / 2019. However, the IBV/EG/F859 / 2019 had a minor recombination of QX and a larger recombination of IBV/EG/CV10 / 2019 (Figure 5). No recombination events were recorded in the nucleotide sequences of the N and M genes.
DISCUSSION
The Infectious bronchitis virus (IBV) is still widespread worldwide and causes massive damage in the poultry industry in both vaccinated and non-vaccinated flocks (Lyb, 2010). Different studies have focused on the epidemiology of the virus (Fathy et al., 2014; Sultanet al., 2019). There is a study emphasizing the hypervariable
region of the spike gene (HVR-S) (Abdel-Moneim et al., 2012; Zanaty et al., 2016), but limited genetic information about the major structural protein was reported (S, N, and M). The molecular characterization of S1 and N genes was responsible for the evolutionary analysis of IBV (Lee et al., 2003). Besides, the protein encoded by the S1 and N genes is the most potent antigens for inducing an immune response to IBV infection (Ignjatovic and Galli, 1995). The current study examined the genetic variability and recombination of IBV of the major structural protein (S1, N, and M).
Previous research suggested the genetic classification of IBV based on S1 HVR I (Lee et al., 2003; Zantay et al., 2016), but the findings were not representative due to the presence of multiple mutations throughout the S1 gene detected in the presented study and other previous studies (Schikora et al., 2003; Li et al., 2012). The S1 genes of all strains were clustered in GI-23
U3B3t3E333BS3S3S Yehia N, Said D and Zanaty AM (2020). Characterization and Analysis of the Major Structural Protein Genes of the Recently Isolated Avian Infectious Bronchitis Virus in Egypt. J. World Poult. Res., 10 (4): 649-661. DOI: https://dx.doi.org/10.36380/jwpr.2020.74
(variant II) with three strains clustered into Egy VAR I and the other seven strains clustered in Egy VAR II, as previously reported (Zanaty et al., 2016, Abozeid et al., 2017). However, all of the strains in the present study related to Egy VAR II became a new subgroup.
Multiple outbreaks in the presence of different vaccination programs were previously studied (Abd El Rahman et al., 2015; Sultan et al., 2013). The massive use of classic H120, M41, and variant 4/91 vaccines produced vaccination pressure on the virus leading to the production of a virus escape mutant in the HVR, and accordingly vaccination failure as reported in previous studies (Zanaty et al., 2016; Sultan et al., 2019). Different mutations in the HVRI, II, and III were detected in all strains possibly due to vaccination pressure. Moreover, the currently administered vaccine showed genetically different values as was mentioned before (Rohaim et al., 2019). In this regard, there is a need to conduct further studies to demonstrate the antigenicity ,pathogenicity and the effectiveness of the vaccine of recent field strains.
The N-glycosylation sites in the spike and membrane glycoproteins of IBV had a significant effect on the antigenicity, receptor binding and fusion (Braakman and Van Anken, 2000; Wissink et al., 2004). Variation in N-glycosylation sites could affect receptor interaction, reduce recognition of antibodies leading to a reduction in the innate immune response, and affect the replication and infectivity of the virus (Slater-Handshy et al., 2004; Vigerust and Shepherd, 2007). The difference in the N-glycosylation sites on the spike protein reported in current study requires further studies to show its effect on the pathogenicity of the virus. The N protein played an important role in immunogenicity against IBV infection, and the assembly of viruses (He et al., 2004; You et al., 2007). However, previous studies suggested that the N gene was conserved, which was supported by the detection of all IBV strains (Williams et al., 1992). all strains in this study were divided into a new subgroup with multiple specific mutations as well as the S1 gene with one N-glycosylation site in the N gene, as previously described (Fan et al., 2019). It is therefore required to investigate the effect of this mutation on the immunogenicity and pathogenicity of the virus.
The M protein is responsible for the assembly of virus particle by interactions with other structural proteins (Vennema et al., 1996). The phylogenetic analysis revealed that genotypes based on the S1 gene differ significantly from those of the M gene. There is no differentiation between variant I and II in the characterization of the M gene, as previously described
(Shieh et al., 2004; Hughes, 2011). All strain clustered in the variant group with a new subgroup as well as the S1 gene. The rise of multiple new IBV genotypes was observed due to the occurrence of several recombination events within the same genotype or between different genotypes. Others were observed between field and vaccine viruses (Zhang et al., 2010; Han et al., 2016; Jackwood et al., 2010). The recombination was detected in the present study in two isolates from QX and D274 and the same genotype as previously detected in a study conducted by Kiss et al (2016) and no recombination was detected in the N or M gene.
Natural selection usually led to a reduction in harmful mutations, thus promoting beneficial mutations. In general, the gene positively selected by natural selection usually had very important functions (Tang et al., 2009). The positive selection pressure in this study was only detected at five sites in the S1 gene, and was expected due to the extensive use of IBV vaccine as previously described (Jahantigh et al., 2013). This selective pressure could affect the primary and secondary structures of the S1 gene, which led to a change in the genetic and molecular characterization of the virus and the emergence of new strains that, as previously reported, could escape from the immune system (Dolz et al., 2008). Therefore, more research is needed to determine the role of these mutations in the virulence of IBV.
CONCLUSION
The Egyptian IBV has evolved continuously and has acquired special features. The S1 protein is clustered to clad GI23 variant II (the genetic classification of IBV) with three strain clusters into Egy VARI and others cluster to Egy VARII in new subgroup, compared to the previously isolated strain in Egypt with specific mutations, especially in the HVRI, II, and III. The strains included in the study differed significantly from vaccine seeds. The molecular characterization of the M gene and N gene are confirmed as the classification of the S1 gene with a specific feature. The recombination detected in the present study occurred in two isolates from QX and D274. Surveillance of IBV should continue to ensure the early detection of virus mutations and to study the pathogenicity and antigenicity, as well as the evaluation of the vaccine efficacy against newly evolved strains.
DECLERATION
Authors contribution
Nahed Yehia suggested the title of study and designed the paper, Dalia Said isolated the IBV samples.
Nahed Yehia and Ali Zanaty identified the molecular characterization of isolates. All authors participated in the writing, analysis of the data, and review of the manuscript, and finally approved the last version of manuscript.
Acknowledgement
This study was funded by Animal health research institute.
Competing interests
All authors declared that did not have any conflict of interest.
REFERENCES
Abd El Rahman S, Hoffmann M, Lueschow D, Eladl A, and Hafez HM (2015). Isolation and characterization of new variant strains of infectious bronchitis virus in Northern Egypt. Advanced in animal and veterinary science, 3: 326-471. DOI: http://dx.doi.org/10.14737/journal.aavs/2015/3.7.362.371
Abdel-Moneim AS, Afifi MA, and El-Kady MF (2012). Emergence of a novel genotype of avian infectious bronchitis virus in Egypt. Archive Virology, 157: 2453-2457. DOI: https://www.doi.org/10.1007/s00705-012-1445-1
Abdel-Moneim AS, Madbouly HM, Gelb Jr J, and Ladman BS (2002). Isolation and identification of Egypt/Beni-Suef/01 a novel genotype of infectious bronchitis virues. Veterinary Medicine Journal, Giza, 50: 1065-1078.
Abozeid H, Paldurai A, Khattar SK, Afifi MA, El-Kady MF, El-Deeb AH, and Samal SK (2017). Complete genome sequences of two avian infectious bronchitis viruses isolated in Egypt: Evidence for genetic drift and genetic recombination in the circulating viruses. Infection, Genetics and Evolution, 53: 7-14. Available at: https://pubmed.ncbi.nlm.nih.gov/28495648/
Adzhar A, Gough R, Haydon Daniel, Shaw K, Britton Paul, and Cavanagh D (1997). Molecular analysis of the 793/B serotype of infectious bronchitis virus in Great Britain. Avian pathology, 26: 625-40. DOI: https://www.doi.org/10.1080/03079459708419239
Ammayappan A, Upadhyay C, Gelb J, and Vakharia VN (2009). Identification of sequence changes responsible for the attenuation of avian infectious bronchitis virus strain Arkansas DP. Archieve Virology, 154: 495-499. Available at:
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7086983/
Braakman I, and Van Anken E (2000). Folding of viral envelope glycoproteins in the endoplasmic reticulum. Traffic, 1(7): 533-539. DOI: https://www.doi.org/10.1034/j.1600-0854.2000.010702.x
Brierley I, Digard P, and Inglis SC (1989). Characterization of an efficient coronavirus ribosomal frame shifting signal: requirement for an RNA pseudoknot, Cell, 57: 537-547. Available at: https://pubmed .ncbi.nlm.nih. gov/2720781/
Carstens E (2009). Ratification vote on taxonomic proposals to the international committee on taxonomy of viruses. Archive Virology, 155: 133-146. Available at:
https://pubmed .ncbi.nlm.nih. gov/27424026/
Cavanagh D, Casais R, Armesto M, Hodgson T, Izadkhasti S, Davies M, Lin F, Tarpey I, and Britton P (2007). Manipulation of the infectious bronchitis coronavirus genome for vaccine development and analysis of the accessory proteins. Vaccine, 25: 5558-5562. Available at: https://pubmed.ncbi.nlm.nih.gov/17416443/
Cavanagh D, Davis PJ, Cook JK, Li D, Kant A, and Koch G (1992). Location of the amino acid differences in the S1 spike glycoprotein subunit of closely related serotypes of infectious bronchitis virus.
Avian Patholology, 21: 33-43. Available at:
https://pubmed.ncbi.nlm.nih.gov/18670913/
Corse E, and Machamer CE (2003). The cytoplasmic tails of infectious bronchitis virus E and M proteins mediate their interaction. Virology, 312: 25-34. Available at:
https://pubmed.ncbi.nlm.nih.gov/12890618/
Delport W, Poon AF, Frost SD, and Kosakovsky Pond SL (2010). Datamonkey 2010: a suite of phylogenetic analysis tools for evolutionary biology. Bioinformatics, 26: 2455-2457. Available at: https://pubmed.ncbi.nlm.nih.gov/20671151/
Dolz R, Pujols J, Ordonez G, Porta R, and Majo N (2008). Molecular epidemiology and evolution of avian infectious bronchitis virus in Spain over a fourteen-year period. Virology, 374: 50-59. Available at: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7103278/
Fan W, Tang N, Dong Z, Chen J, Zhang W, Zhao C, He Y, Li M, Wu C, Wei T et al. (2019). Genetic Analysis of Avian Coronavirus Infectious Bronchitis Virus in Yellow Chickens in Southern China over the Past Decade: Revealing the Changes of Genetic Diversity, Dominant Genotypes, and Selection Pressure. Viruses, 11: 898. Available at:
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6833030/
Fathy RR, El boraay, IM, El shorbagy MA, and El-Mahdy SS (2014). A survey on presence of new strains of infectious bronchitis virus in some chicken farms of Egyptian Delta provinces during. Benha veterinary medical journal, 2: 248-262. Available at: https://bvmj.journals.ekb.eg/article 32511 .html
Gelb JJ, Weisman Y, Ladman B, and Meir R (2005). Gene characteristics and efficacy of vaccination against infectious bronchitis virus field isolates from the United States and Israel (1996-2000). Avian Pathology, 34: 194-203. Available at:
https://pubmed .ncbi.nlm.nih. gov/16191702/
Gupta R, Jung E, and Brunak S (2004). Prediction of N-Glycosylation Sites in Human Proteins. 46: 203-206. Available at: https://pubmed.ncbi.nlm.nih.gov/11928486/
Han Z, Zhang T, Xu Q, Gao M, Chen Y, Wang Q, Zhao Y, Shao Y, Li H, and Kong X et al. (2016). Altered pathogenicity of a tl/CH/ LDT3/03 genotype infectious bronchitis coronavirus due to natural recombination in the 5'-17 kb region of the genome. Virus Research, 213: 140-148. Available at:
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7114521/
Hassan MSH., Ojkic D, Coffin CS, Cork SC, van der Meer F, Abdul-Careem MF (2019). Delmarva (DMV/1639) Infectious Bronchitis Virus (IBV) variants isolated in eastern Canada show evidence of recombination. Viruses, 11: 1054. Available at: https://pubmed.ncbi.nlm.nih.gov/31766215/
He R Dobie F, Ballantine M, Leeson A, Li Y, Bastien N, Cutts T, Andonov A, Cao J, Booth TF et al. (2004). Analysis of multimerization of the SARS coronavirus nucleocapsid protein. Biochemical Biophysical Research Community, 316: 476-483. Available at:
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7111152/
Hewson KA, Noormohammadi AH, Devlin JM, Browning GF, Schultz BK, and Ignjatovic J (2014). Evaluation of a novel strain of infectious bronchitis virus emerged as a result of spike gene recombination between two highly diverged parent strains. Avian Pathology, 43: 249-257. Available at:
https://www.tandfonline.com/doi/full/10.1080/03079457.2014.9146 24
Hughes AL (2011). Recombinational histories of avian infectious bronchitis virus and turkey coronavirus. Archive Virology, 156: 1823-1829. DOI: https://www.doi.org/10.1007/s00705-011-1061-5
Ignjatovic J, and Galli U (1995). Immune responses to structural proteins of avian infectious bronchitis virus. Avian Pathology, 24(2): 313332. Available at: https://pubmed.ncbi.nlm.nih.gov/18645789/
Jackwood MW (2012). Review of infectious bronchitis virus around the world. Avian Disease, 56: 634-641. Available at: https://pubmed.ncbi.nlm.nih.gov/23397833/
Jackwood MW, Boynton TO, Hilt DA, McKinley ET, Kissinger JC, Paterson AH, Robertson J, Lemke C, McCall AW, and Williams SM et al. (2010). Emergence of a group 3 coronavirus through recombination. Virology, 398: 98-108. Available at: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7111905/
Jahantigh M, Salari S, and Hedayati M (2013). Detection of infectious bronchitis virus serotypes by reverse transcription polymerase chain reaction in broiler chickens. Springer plus, 2(1): 36. Available at: https://springerplus.springeropen.com/ articles/10. 1186/2193-18012-36
Kiss I, Mató T, and Homonnay Z (2016). Successive occurrence of recombinant infectious bronchitis virus strains in restricted area of Middle East. Virus Evulsion, 2: vew021. Available at: https://pubmed .ncbi.nlm.nih. gov/29492274/
Kumar S, Stecher G, and Tamura K (2016). MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular and Biological evolution, 33: 1870-1874. Available at: https://pubmed.ncbi .nlm.nih. gov/27004904/
Lai MMC, and Holmes KV (2001). Coronaviridae: the viruses and their replication. In: Knipe, Available at:
https://www.ncbi .nlm.nih. gov/pmc/articles/PMC43693 85/
Lee CW, Hilt DA, and Jackwood MW (2003). Typing of field isolates of infectious bronchitis virus based on the sequence of the hypervariable region in the S1 gene. Journal of veterinary Diagnostic Investigation, 15: 344-348. Available at: https://pubmed .ncbi.nlm.nih. gov/12918815/
Li M, Wang XY, Wei P, Chen QY, Wei ZJ, and Mo ML (2012). Serotype and genotype diversity of infectious bronchitis viruses isolated during 1985-2008 in Guangxi, China. Archive Virology, 157: 467-474.
Lyb V (2010). Diagnosis of infectious bronchitis: an overview of concepts and tools Revista Brasileira de Ciencia Avícola .Brazilain journal of poultry science, 12: 10. Available at: https://www. scielo.br/scielo.php?pid=S 1516-635X2010000200006&script=sci abstract
Martin DP, Murrell B, Golden M, Khoosal A, and Muhire B (2015). RDP4: detection and analysis of recombination patterns in virus genomes. Virus Evolution, 1. Available at: https://academic.oup.com/ve/article/1/1/vev003/2568683
Masters P, and Perlman S (2013). Coronaviridae in Fields of virology, Lippincot Williams and Wilkins, Philadelphia, USA. Available at: https://www.umassmed.edu/globalassets/ambros-lab/meetings/rna-biology-club-2019 20/masters-and-perlman-2013-in-fields-virology_1.pdf
Milek J, and Blicharz-Domanska K (2018). Coronaviruses in avian species-review with focus on epidemiology and diagnosis in wild birds. Journal of Veterinary. Research, 62: 249-255. Available at: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6296008/
Mo ML, Li M, Huang BC, Fan WS, Wei P, Wei TC, Cheng QY, Wei ZJ, and Lang YH (2013). Molecular characterization of major structural protein genes of avian coronavirus infectious bronchitis virus isolates in southern China. Viruses, 5: 3007-3020.
Naguib MM, El-Kady MF, Lüschow D, Hassan KE, Arafa AS, El-Zanaty A, Hassan MK, Hafez HM, Grund C, and Harder TC (2017). New real time and conventional RT-PCRs for updated molecular diagnosis of infectious bronchitis virus infection (IBV) in chickens in Egypt associated with frequent co-infections with avian influenza and Newcastle disease viruses. Journal of virological methods, 245: 19-27. Available at:
https://www.sciencedirect.com/science/article/abs/pii/S0166093416 302105
Rohaim MA, El Naggar RF, Hamoud MM, Bazid AI, Gamal AM, Laban SE, Abdel-Sabour MA, Nasr SAE, Zaki MM, Shabbir MZ et al. (2019). Emergence and genetic analysis of variant pathogenic 4/91 (serotype 793/B) infectious bronchitis virus in Egypt during, 55: 720-725. Available at: https://pubmed.ncbi.nlm.nih.gov/31372921/
Schikora BM, Shih LM, and Hietala SK (2003). Genetic diversity of avian infectious bronchitis virus California variants isolated between 1988 and 2001 based on the S1 subunit of the spike glycoprotein. Archive Virology, 148: 115-136. Available at: https://link.springer.com/article/10.1007/s00705-002-0904-5
Shieh HK, Shien JH, Chou HY, Shimizu Y, Chen JN, and Chang PC (2004). Complete nucleotide sequences of S1 and N genes of infectious bronchitis virus isolated in Japan and Taiwan. Journal of veterinary medicine science, 66: 555-558. Available at: https://pubmed .ncbi.nlm.nih. gov/15187369/
Slater-Handshy T, Droll DA, Fan X, Di Bisceglie AM, and Chambers TJ (2004). HCV E2 glycoprotein: mutagenesis of N-linked glycosylation sites and its effects on E2 expression and processing. Virology, 319: 36-48. Available at:
https://www.sciencedirect.com/science/article/pii/S0042682203007 736
Sultan H, Abdel-Razik AG, Shehata AA, Ibrahim M, Talaat S,Abo-Elkhair M, Bazid AE, Moharam IM, and Vahlenkamp T (2013). Characterization of Infectious Bronchitis Viruses Circulating in Egyptian Chickens during 2012 and 2013. Journal of Veterinary Science & Medical Diagnosis, 4: 5. Available at: https://www.scitechnol.com/peer-review/characterization-of-infectiousbronchitis-viruses-circulating-inegyptian-chickens-during-2012and-2013-tfHD.php?article_id=4042
Sultan HA, Ali A, El Feil WK, Bazid AHI, Zain El-Abideen MA, and Kilany WH (2019). Protective efficacy of different live attenuated infectious bronchitis virus vaccination regimes against challenge with IBV variant-2 circulating in the Middle East. Frontiers in Veterinary Science, 6: 341. Available at:
https://www.frontiersin.org/articles/10.3389/fvets.2019.00341/full
Tamura K, G Stecher, D Peterson, A Filipski, and S Kumar (2013). MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular biology evolution, 30: 2725-2729.Avilable at: https://pubmed.ncbi.nlm.nih. gov/24132122/
Tang X, Li G, Vasilakis N, Zhang Y, Shi Z, Zhong Y, Wang LF, and Zhang S (2009). Differential stepwise evolution of SARS coronavirus functional proteins in different host species. Evolutionary Biology, 9: 52. Available at: https://bmcevolbiol.biomedcentral.com/articles/10.1186/1471-2148-9-52
Thor SW, Hilt DA, Kissinger JC, Paterson AH, and Jackwood MW (2011). Recombination in avian gamma-coronavirus infectious bronchitis virus. Viruses, 3: 1777-1799. Available at: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3187689/
Valastro V, Holmes EC, Britton P, Fusaro A, Jackwood MW, Cattoli G, and Monne I (2016). S1 gene-based phylogeny of infectious bronchitis virus: An attempt to harmonize virus classification. Infectious genetic evolution, 39: 349-364. Available at: https://www.sciencedirect.com/science/article/abs/pii/S1567134816 300466
Vennema H, Godeke GJ, Rossen JW, Voorhout WF, Horzinek MC, Opstelten DJ, and Rottier PJ (1996). Nucleocapsid-independent assembly of coronavirus-like particles by co-expression of viral envelope protein genes. The EMBO Journal, 15: 2020-2028. Available at: https://pubmed.ncbi.nlm.nih.gov/8617249/
Vigerust DJ, and Shepherd VL (2007). Virus glycosylation: role in virulence and immune interactions. Trends Microbiology, 15(5): 211-218. Available at: https://pubmed.ncbi.nlm.nih.gov/17398101/
Wang C, Zheng X, Gai W, Zhao Y, Wang H, Wang H, Feng N, Chi H, Qiu B, Li N et al. (2017). MERS-CoV virus-like particles produced in insect cells induce specific humeral and cellular immunity in
rhesus macaques. Oncotarget, 8(8): 12686-12694. Available at: https://pubmed .ncbi.nlm.nih. gov/27050368/
Williams A, Wang L, Sneed L, and Collisson E (1992). Analysis of a hypervariable region in the 3' non-coding end of the infectious bronchitis virus genome. Virus Research, 25: 213-222. Available at:
https://www.sciencedirect.com/science/article/abs/pii/0168170293900863
Wissink EH, Kroese MV, Maneschijn-Bonsing JG, Meulenberg JJ, Van Rijn PA, Rijsewijk FA, and Rottier PJ (2004). Significance of the oligosaccharides of the porcine reproductive and respiratory syndrome virus glycoproteins GP2a and GP5 for infectious virus production. The Journal of General Virology, 85(12): 3715-3723. Available at: https://pubmed.ncbi.nlm.nih.gov/15557245/
You JH, Reed ML, and Hiscox JA (2007). Trafficking motifs in the SARS coronavirus nucleocapsid protein. Biochemical Biophysical
Research Communication, 358: 1015-1020. Available at: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7092899/
Zanaty A, Arafa AS, Hagag N, and El-Kady M (2016). Genotyping and pathotyping of diversified strains of infectious bronchitis viruses circulating in Egypt. World journal of virology, 5(3): 125-134. Available at:
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4981825/
Zhang Y, Wang HN, Wang T, Fan WQ, Zhang AY, Wei K, Tian GB, and Yang X (2010). Complete genome sequence and recombination analysis of infectious bronchitis virus attenuated vaccine strain H120. Virus Genes, 41: 377-388. Available at: https://pubmed.ncbi.nlm.nih.gov/20652731/
Supplementary Table 1. Nucleotide identities and divergence of N gene sequenced viruses compared to other selected strains and vaccine strains. The comparative alignment of N gene showed that the percentage of N AA identity of the tested strain ranged 91- 95% with different vaccine seeds used in Egypt.
Sequence name
U5
u ¡5
H
3s u
s
09
IT)
2
<
tj
"o
>
a
C\ >
a
a
u >
m
a
IX =
£
irn
ss
& U
¡5
H Si
U >
a
o
n
a
V <
o\
09
P P P
N- N- N-
-9 -9 -9
10 10 10
<s <s <s
-0 -1
> > f> >
/H 0 a 0
<J u U
/Y /Y /Y
0 0 O
H H (¡■a
B B B
Oh
Z
IT)
to
u
s
o
H >
09
Oh
z
a
U
S
O
H >
09
Oh
z
o
in <s
B
U
S
O
H £
Oh
Z
IT)
&H
S3
U
S
O
H >
09
Oh
z
U
S
O
(¡■a >
09
Oh
z
3
to S3
U
S
O
H >
09
Nucleotide Identity %
19. IBV-EGY/CH/F859-2019-NP
Oh
N
8
F F/H
U
/Y
O
H >
B
96% 94% 93% 93% 92% 92% 92% 96% 92% 100% 100% 99% 100% 100% 100% 100% 98% 100%
Amino Acids Identity %
U3ct3Gh0ES3§3 Yehia N, Said D and Zanaty AM (2020). Characterization and Analysis of the Major Structural Protein Genes of the Recently Isolated Avian Infectious Bronchitis Virus in Egypt. J. World Poult. Res., 10 (4): 649661. DOI: https://dx.doi.org/10.36380/jwpr.2020.74
Supplementary table 2. Nucleotide identities and divergence of M gene sequenced viruses compared to other selected strains and vaccine strains. The comparative alignment of M gene showed that the percentage of M gene AA identity of the tested strain ranged 94-96% with different vaccine seeds used in Egypt.
Sequence name
%
x
a £
s u o
H
2a u
B
B
V
B
VB
VB
V
B
V
B
u S o
H -VB
V
u
S
u S o
H -VB
S
u S O
H -VB
V
u
S
U
s
o
H -VB
Nucleotide Identity %
