CC BY
0JWPR
Journal of World's Poultry Research
2021, Scienceline Publication
J. World Poult. Res. 11(1): 83-95, March 25, 2021
Research Paper, PII: S2322455X2100011-11 License: CC BY 4.0
DOI: https://dx.doi.org/10.36380/jwpr.2021.11
Etiology of Respiratory Diseases of Poultry Farms in the North
Coast of Egypt
Hanan Saad El-Samahy and Disouky Mohamed Mourad*
Department of Animal and Poultry Health, Division of Animal and Poultry Production, Desert Research Center, Ministry of Agriculture, 1-Mathaf El-
Materia Street, Cairo, 2633 759, Egypt Corresponding author's Email: dismou235@gmail.com; ORCID: 0000-0001-7777-9305
Received: 08 Jan. 2021 Accepted: 25 Feb. 2021
ABSTRACT
The current study aimed to identify the respiratory problems in poultry farms located in the north coast of Egypt from October 2018 to November 2019. A total of 89 poultry flocks (79 broilers, 5 layers, 3 ducks, and 2 turkeys) were investigated for four major viral respiratory pathogens, namely avian influenza (AI) H9N2, AI H5 subtypes, Newcastle Disease (ND), and Infectious Bronchitis (IB) viruses. All 89 flocks were subjected to real-time PCR to investigate AI H9N2 virus. The samples of 31, 43, and 15 out of 89 flocks were selected for the investigation of ND, IB, and AI H5 subtypes viruses, respectively, using real-time PCR. Sample selection was performed according to the mortalities, clinical signs, and post mortem lesions. The positive findings indicated that 22 out of 89 flocks were positive for AI H9N2 virus (2 layers + 20 broilers), 32 out of 43 flocks were positive for IB virus (2 layers + 30 broilers), 24 out of 31 flocks were positive for ND virus (1 Duck + 1 layer+ 22 broilers) and 9 out of 15 flocks were positive for AI H5N8 virus (1 turkey + 1 duck + 7 broilers). Partial sequencing for selected isolates of six ND, five IB, four H9N2, and three H5N8 viruses was applied, then nucleotide sequences were accessed on GenBank. Six ND isolates belonged to genotype Vll viruses circulating in Egypt. Two IB isolates were related to the classical strain circulating in Egypt, while the other three IB isolates belonged to EGY/Variant ll. Four H9N2 AI isolates were related to G1-lineage of H9 viruses circulating in the Middle East and Egypt. Three H5N8 AI isolates belonged to the highly diverse clade 2.3.4.4.b viruses circulating in Egypt. It was concluded that ND and IB viruses isolated in this study were not related to their vaccinal strains. Also, AI H5N8 circulating alone in affected flocks while AI H9N2 circulating alone and/or mixed with either IB or ND viruses. Finally, there is a need to devise a complete strategy to control the isolated respiratory viruses on the north coast of Egypt.
Keywords: Poultry, Respiratory, RRT-PCR, Sequence, Viruses
Respiratory affection is a major problem in the commercial poultry industry leading to the annual loss of a hundred million dollars (Easterday et al.,1997). During the last few years, Egyptian commercial chicken flocks have been suffering from the co-circulation of multiple respiratory viruses leading to variable mortality rates and different clinical manifestations. Many important diseases can affect the respiratory system of poultry, including Avian Influenza (AI), Newcastle Disease (ND), and Infectious Bronchitis (IB) viruses (Shankar, 2008). The AI-H5N1 viruses affected poultry flocks in many countries including Egypt, and have become endemic (Aly et al., 2008). An additional challenge facing the poultry industry occurred in Egypt when AI-H9N2 subtype was detected during 2010-11 in chickens and commercial quails (El-
Zoghby et al., 2012). In addition to high pathogenic avian influenza (HPAI) H5N1 and low pathogenic avian influenza (LPAI) H9N2, there was the incursion of HPAI H5N8 to Egypt in November 2016 via wild birds followed by spreading into commercial poultry flocks, further complicated the situation (Hassan et al., 2019). The ND virus still represents a serious problem for poultry production in many countries, although strict vaccination and other controlling regimes. In Egypt, ND virus strains of recent outbreaks in poultry farms have belonged to class II, genotype VII which might be introduced through the trading of poultry and poultry products with China and the Middle Eastern countries (Mohamed et al., 2011; Radwan et al., 2013). Furthermore, IB virus threatens the poultry industry worldwide and is considered as one of the most economically important respiratory viral diseases (Cook et al., 2012), and it was described as a natural infection in
To cite this paper: El-Samahy HS and Mourad DM (2021). Etiology of Respiratory Diseases of Poultry Farms in the North Coast of Egypt. J. World Poult. Res., 11 (1): 83-95. DOI: https://dx.doi.org/10.36380/jwpr.2021.11
different countries of Asia and the Middle-East in association with both HPAI and/or LPAI virus (Hassan et al., 2016). Therefore, the present study aimed to determine the current field situation of these major avian respiratory pathogens in the north coast region with the molecular identification of certain selected isolates to monitor and record their genetic properties through sequencing, phylogenetic analysis, and GenBank accessions.
MATERIALS AND METHODS
Samples collection and processing
Tracheal and/or oropharyngeal swabs and tissues of 89 different poultry flocks (10 samples per each flock) suffering from respiratory symptoms, a severe drop in egg production, and high mortalities were collected between October 2018 and December 2019. The area of investigation included the north coast area (west Alexandria, El-Hamam, El Alamein, and Matrouh governorates) in Egypt. All 89 flocks were subjected to real-time PCR for the investigation of AI H9N2 virus. The samples of 31, 43, and 15 out of 89 flocks were selected for the investigation of ND, IB, and AI H5 subtypes viruses, respectively, using real-time PCR. Sample selection was performed according to the mortalities, clinical signs, and post mortem lesions. Tissue samples were grounded in phosphate buffer saline with a pH of 7.0 to 7.4 containing gentamycin (50 ^g/mL) and Mycostatin (1,000 units/mL) in a 1:5 (w/v) dilution, centrifuged, and tissue supernatant was collected (OIE, 2005; Naguib et al., 2017). The transport medium used for collected swabs composed of glycerol (50%), Phosphate buffer saline (PBS) (50%) with 2x106 U/liter penicillin, 200 mg /liter streptomycin, and 250 mg/liter amphotericin B. Samples were stored at - 80°C until being tested (Gelb and Jackwood, 2008). All tissue samples were tested using RRT-PCR, then certain selected positive samples for each virus were purified through intra-allantoic inoculation of Specific Pathogen Free Embryonated Chicken Egg (SPF-ECE, De Wit, 2000), and these allantoic fluids were subjected to RT-PCR and sequencing.
Viral RNA extraction
All steps were carried out according to the manufacturer's instructions. Whole nucleic acid extraction from the samples was performed using the QIAamp® minielute virus spin kit (Qiagen, Germany, GmbH). Briefly, 200 ^l of the sample suspension was incubated
with 25 ^l of Qiagen protease, and 200 ^l of AL lysis buffer at 56°C for 15 min, then 250 ^l of ethanol 100% was added to the lysate. After that, the sample was washed and centrifuged. The nucleic acid was eluted with 100 ^l of elution buffer.
Real-time reverse transcription-polymerase chain reaction
For AI viruses, type A (matrix) gene primer was used (Spackman et al., 2002), followed by H5 (Londt et al., 2008), H9 (Ben Shabat et al., 2010), and N8 primers (Hoffmann et al., 2016), while for ND virus and IB virus, M primer and N primer were utilized, respectively (Wise et al., 2004; Meir et al., 2010). Viral RNA extraction with QIAamp® was performed using viral RNA mini kit buffers (Qiagen, Germany) and Master Mix kit (Quantitect probe RT_PCR kit), and all steps were carried out according to the manufacturer's instructions (Table 1).
Conventional polymerase chain reaction
The H gene primer was used with the length of amplified product 311 bp and 920 bp for AI H5 virus and AI H9 virus, respectively (Slomka et al., 2007; Adel et al., 2016), while for ND virus, M & F gene primer with the length of amplified product 766 bp (Mase et al., 2002), and for IB virus, Spike SP1 gene primer with the length of amplified product 457 bp were used (Naguib et al., 2017). Viral RNA extraction with QIAamp® was performed using viral RNA mini kit buffers (Qiagen, Germany) and Master Mix kit (Quantitect probe RT_PCR kit), and all steps were performed according to the manufacturer's instructions (Table 2).
Analysis of the polymerase chain reaction products
The products of PCR were separated by electrophoresis on agarose gel 1.5% (Applichem, Germany, GmbH) in 1x Tris Borate EDTA (TBE) buffer at room temperature using gradients of 5V/cm. For gel analysis, 15 ^l of the products were loaded in each gel slot. A gene ruler 100 bp DNA ladder (Fermentas, Thermofisher, Germany) was used to determine the fragment sizes. The gel was photographed by a gel documentation system (Alpha Innotech, Biometra), and the data were analyzed using the computer software (Automatic Image Capture Software, protein simple formerly cell biosciences, USA).
Sequencing and phylogenetic analysis
The PCR products of selected different isolated respiratory viruses (six ND, five IB, four H9, and three H5 subtypes viruses) were purified using QIAquick PCR Product extraction kit (Qiagen, Valencia). Bigdye Terminator V3.1 cycle sequencing kit (Perkin-Elmer) was used for the sequence reaction, and then it was purified using Centrisep spin column. Sequence analysis was done by Applied Biosystems3130 genetic analyzer (HITACHI, Japan), and the sequence identity was initially performed by A BLAST® analysis (Basic Local Alignment Search Tool) (Altschul et al., 1990) to be established to GenBank
accessions. The phylogenetic tree was created by the MegAlign module of Laser gene DNAStar version 12.1 (Thompson et al., 1994), and Phylogenetic analyses were performed using maximum likelihood, neighbor-joining, and maximum parsimony in MEGA6 (Tamura et al., 2013).
Ethical approval
The present study was affirmed by the Ethics of Animal Health Committee, Desert Research Center, Egypt.
Table 1. Oligonucleotide primers and probes used for RRT-PCR.
Virus Gene Primer/ probe sequence 5'-3' Virus Gene Primer/ probe sequence 5'-3'
H5LH1 ACATATGACTAC CCACARTATTCA G AGTGATGTGCTCGGACCTTC-3'
H5 H5RH1 AGACCAGCT AYC ATGATTGC H5PRO [FAM]TCWACA GTGGCGAGT TCCCTAGCA[TAMRA] NDV M CCTGAGGAGAGGCATTTGCTA-3' [FAM] TTCTCTAGCAGTGGGACAGCCTGC [TAMRA]-3'
H9F IBF:
GGAAGAATTAATTATTATTGGTCGGTAC ATGCTCAACCTTGTCCCTAGCA
AIV H9 H9R GCCACCTTTTTCAGTCTGACATT IB N IBR: TCAAACTGCGGATCATCACGT
H9 Probe IBTM: (FAMTTGGAAGTAGAGTGACGCCCAAACTTCA-TAMRA)
[FAM]AACCAGGCCAGACATTGCGAGTAAGATCC [BHQ]
N8-1296F
TCC ATG YTT TTG GGT TGA RAT GAT
N8
N8-1423R
GCT CCA TCR TGC CAY GAC CA
N8-1354
FAM- TCH AGY AGC TCC ATT GTR ATG TGT GGA GT-Tamra
Table 2. Oligonucleotide primers used for conventional PCR.
Target agent Target gene Primer sequence (5'-3') Length of amplified product (bp)
H9F
H9 H GGAAGAATTAATTATTATTGGTCGGTAC 920 bp
HT7R TAA TAC GAC TCA CTA TAA GTA CAA ACA AGG GTG
IBV-HVR1-2-FW
IB Spike SP1 GTK TAC TACTAC CAR AGT GC IBV-HVR1-2-RV GAA GTG RAA ACR AGA TCA CCA TTT A 457 bp
M2
ND M and F TGG-AGC-CAA-ACC-CGC-ACC-TGC-GG F2 GGA-GGA-TGT-TGG-CAG-CAT-T - 766 bp
H5-kha-1
H5 H CCT CCA GAR TAT GCM TAY AAA ATT GTC H5-kha-3 TAC CAA CCG TCT ACC ATK CCY TG 311 bp
RESULTS
Prevalence of respiratory viruses
Concerning the results of the RRT-PCR used for detection of respiratory viruses (Figure 1), 22 out of 89 flocks (24.7%) were positive (+ve) for AI H9N2 virus, 9 out of 15 flocks (60%) were positive for AI H5 subtype virus, 24 out of 31 flocks (77.4%) were positive for ND virus, and 32 out of 43 flocks (74.4%) were positive for IB virus (Tables 3 and 4). All AI H5 subtypes were H5N8 viruses.
Single and mixed viral infection
There were 16 out of 89 poultry flocks negative for RRT-PCR. Furthermore, 59 flocks were recorded with a single viral infection, 8 flocks with AI H9N2, 22 with IB, 20 with ND, and 9 with AI H5N8 viruses. Mixed infection with AI H9N2 virus occurred in 14 poultry flocks, 10 flocks with mixed IB, and 4 flocks with mixed ND virus. On the other hand, there was no mixed infection with AI H5N8 subtype virus (Table 5).
Results of conventional polymerase chain reaction
The PCR product revealed the specific amplification of 920, 766, 457, and 311 bp fragments for all selected AI H9N2, ND, IB, and AI H5N8 isolates of viruses, respectively (Figure 2).
Sequencing and phylogenetic analysis of avian influenza H9N2 isolated viruses
The isolates of four selected AI H9N2 viruses were genetically related to G1-lineage of H9 viruses circulating in the Middle East and were clustered in the same branch of the isolated Egyptian viruses during 2011-2019. The phylogenetic tree of HA gene showed that the first three analyzed isolates (A/Chicken/Egypt/North-coast/19 H9N2, A/Chicken/Egypt/Bahig/19 H9N2, and
A/Chicken/Egypt/Matrouh/19 H9N2) were genetically related and significantly closer to each other (99 bootstrap value), and with the fourth isolate (A/chicken/Egypt/King-Mariot/18 H9N2) 54 bootstrap value (Figure 3). King-Mariot 2018 AI H9N2 virus isolate had an identity of 98.7% with other selected isolates which were closely related (100%) to each other. The four selected isolates were identical with other Egyptian strains of 2011-2019 by 94.8-100%, while with Hong Kong strains in 1997 were identical by 87.3-87.4%, Israel strains isolated in 2018 were identical with the four isolates from 97.1-97.2% and Korean strains in 1996 and 2007 had the identity of 82.783.1% (Figure 4).
Sequencing and phylogenetic analysis of avian influenza H5N8 isolated viruses
The selected three H5N8 HPAIV isolates were compared with Egyptian strains during 2014-2019, and it was found that these isolates belonged to the highly diverse clade 2.3.4.4.b viruses circulating in Egypt. On the basis of the phylogenetic tree, the analyzed isolates
(A/chicken/Egypt/El-hamam/1/2019 H5N8,
A/chicken/Egypt/El-hamam/10/2019 H5N1, and A/turkey/Egypt/North-coast k38/2019 H5N1) were clustered together and related highly genetically of 86 bootstrap value with each other, and 53 bootstrap value with other Egyptian viruses isolated during 2014-2019 (Figure 5). An amino acid sequence identity of the three isolates was 100% with each other and 98.9-99.3% with the Egyptian strains from 2017 to 2019 (Figure 6).
Sequencing and phylogenetic analysis of infectious bronchitis isolated viruses
The isolates of five selected IB viruses were compared with Egyptian classic, variant, QX, and their vaccinal strains. Two IB isolates (MT324521_IBV Matrouh and MT324522_IBV El-hamam) were genetically related to the classical strain circulating in Egypt (71 bootstrap value), and 33 bootstrap value with each other. The mentioned isolates had an amino acid sequence identity of 100% with each other and 71.8 -91.2% with the Egyptian strains. The other three IB isolates (MT324523_IBV North-coast-k70,
MT324524_IBV El-Alamin, and MT324525_IBV El-hawaria) belonged to EGY/Variant ll. MT324523_IBV North-coast-k70, and MT324525_IBV El-hawaria were genetically related to each other, 97 bootstrap value with an amino acid sequence identity of 100%, and had 41 bootstrap value with an amino acid sequence identity of 97.5% and 70.6-75.2% when compared with MT324524_IBV El-Alamin and the Egyptian strains respectively (Figures 7 and 8).
Sequencing and phylogenetic analysis of Newcastle disease viruses
The isolates of all selected six ND viruses were compared with Egyptian strains of 2012- 2018. The findings indicated that the isolates belonged to the genotype Vll viruses circulating in Egypt. The phylogenetic tree revealed that the analyzed isolates, MT324529_North coast-4 and MT324530_North coast-5 were closely related to each other, 66 bootstrap values. MT324531_North coast-6 virus isolate was clustered separately alone, 63 bootstrap value, while the other three virus isolates (MT324528_North coast-3, MT324526_North coast-1, and MT324527_North coast-2) were clustered together, and related genetically to each other with 57 bootstrap value (Figure 9). All selected six isolates showed an amino acid sequence identity of 98.6100% with each other, and 97.6-100% and 97.6-98.1% when compared with the Egyptian and Israel strains respectively (Figure 10).
GenBank accessions of all selected viruses' isolates
Nucleotides sequences of all selected AI H9N2, AI H5N8, IB, and ND viruses' isolates were submitted to GenBank, and given accession numbers (Table 6).
Figure 1. Results of RRT-PCR for collected samples of different poultry flocks showed amplification plots for the following primers H9, H5, N8, M, and N of H9N2, H5N8, ND, and IB viruses' isolates, respectively. ND: Newcastle disease IB: Infectious Bronchitis.
Figure 2. Results of conventional PCR showed the specific amplification of 920, 766, 457, and 311 bp fragment for all selected AI H9N2, ND, IB, and AI H5N8 viruses' isolates, respectively. ND: Newcastle disease IB: Infectious Bronchitis.
Figure 3. Phylogenetic tree showing the genetic relationships between circulating LPAI H9N2 and the four selected isolates for the HA gene (indicated by red dots).
Percent Identity
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26
1 ■ 98.4 988 97.8 98.5 97.9 97.9 97.2 97.2 96.8 98.6 96.7 95.7 95.5 954 94.6 95.5 95.7 837 83.7 88.1 88.1 95.5 95.7 95.7 95.7 1
2 1.7 ■ 97.9 93 9 97.5 97.4 97.4 96.7 96.7 96.4 98.1 96.2 95.2 95.4 95.2 93.9 95.1 95.2 83.6 83.6 88.5 88.5 95.1 95.2 95.2 95.2 2
3 1.2 2.1 ■ 974 994 97.7 97.8 96.9 96.9 96.6 98.4 96.7 95.7 95.5 95.7 94.4 95.5 95.7 84.0 84.0 87.9 87.9 95.5 95.7 95.7 95.7 3
4 2.3 1.1 2.6 ■ 971 97.2 97.3 96.5 96.5 96.1 97.8 96.1 95.1 95.3 94.7 93.8 95.0 948 83.6 83.6 87.9 87.9 95.0 948 948 94.8 4
5 1.5 2.5 0.6 3.0 ■ 97.3 97.4 96.6 96.6 96.2 98.0 96.4 95.3 95.2 95.3 94.0 95.2 95.3 83.9 83.9 87,8 87.8 95.2 95.3 95.3 95.3 5
6 2.1 2.6 2.4 2.9 2.8 ■ 97.9 97.4 97.4 97.1 98.6 96.9 95.9 95.8 95.4 94.6 95.8 95.7 83.9 83.9 881 88.1 95.8 95.7 95.7 95.7 6
7 2.1 2.6 2.3 28 2.6 2.1 ■ 98.0 98.0 97.7 98.8 97.9 96.8 966 96.6 95.5 96.7 96.6 832 83.2 87,8 87.8 96.7 96.6 96.6 966 7
8 2.9 3.4 3.1 3.6 3.5 2.6 2.0 ■ 99.8 994 98.4 98.8 982 97.8 97.5 96.9 97.7 97.5 832 83.2 87.7 87.7 97.7 97.5 97.5 97.5 8
9 2.9 3.4 3.1 3.6 3.5 2.6 2.0 0.2 ■ 99.6 98.6 99.1 98.5 98.0 97.8 97.2 97.7 97.5 83.2 83.2 87.7 87.7 97.7 97.5 97.5 97.5 9
10 3.3 3.8 3.5 4.0 3.9 3.0 2.4 0.6 0.4 ■ 98.2 98.7 98.4 97.7 974 96.8 97.3 97.2 83.2 83.2 87,3 87.3 97.3 97.2 97.2 97.2 10
11 1.4 19 1.7 2.3 2.0 1.4 1.2 1.7 1.4 1.8 ■ 97.9 97,1 968 968 95.8 96.7 96.6 83.8 83.8 88.1 88.1 96.7 96.6 96.6 96.6 11
12 3.4 3.9 3.4 4.0 3.8 3.1 2.1 1.2 0.9 1.3 2.2 ■ 98.7 98.2 978 972 97.7 97.5 82.9 82.9 87,4 87.4 97.7 97.5 97.5 97.5 12
13 4.5 5.0 4.5 5.1 4,9 4.3 3.2 1.8 1.5 1.7 3.0 1.3 ■ 97.7 97.2 96.6 97.1 96.9 82.4 82.4 86.6 86.6 97.1 96.9 96.9 96.9 13
14 4.6 4.8 4.6 4.9 5.0 4.4 3.5 2.3 2.0 2.4 3.3 1.8 2.4 ■ 96.8 96.7 97.2 971 82.7 82.7 86.9 86.9 97.2 97.1 971 97.1 14
15 4.8 5.0 4.5 5.5 4.9 4.8 3.5 2.5 2.3 2.6 3.3 2.3 2.9 3.3 ■ 96.4 97,1 96.9 83.0 83.0 86.7 86.7 97.1 96.9 96.9 96.9 15
16 5.5 6.3 5.8 6.4 6.2 5.5 4.5 3.0 2.8 3.1 4.3 2.8 3.4 32 3.6 ■ 96.5 964 81.7 81.7 85.9 85.9 96.5 96.4 964 96.4 16
17 4.6 5.1 4,6 5.3 5.0 4,4 3.4 2.4 2.4 2.8 3.4 2.4 3.0 2.9 3.0 3.5 m 98.7 82.7 82.7 87.4 87.4 1000 98.7 98.7 98.7 17
18 4.5 5.0 45 5.4 49 4.5 3.5 2.5 25 2.9 3.5 2.5 3.1 3.0 3.1 3.6 1.3 83.1 831 873 87.3 98.7 100.0 100.0 100.0 18
19 19.0 19.2 18.6 19.2 18.7 18.7 19.7 19.7 19.7 19.7 18.9 20.2 20.8 20.4 20.0 21.7 20.4 19.9 100.0 85.3 85.3 82.7 83.1 83.1 83.1 19
20 19.0 19.2 186 19.2 18.7 18.7 19.7 19.7 19.7 19.7 18.9 202 20.8 204 20.0 21.7 20.4 19.9 0.0 ■ 85.3 85.3 82.7 83.1 831 83.1 20
21 13.2 12.8 13.6 13.5 13.7 13.3 13.7 13.8 13.8 14.3 13.3 14.2 15.2 14.9 15.0 16.0 14.2 14.3 16.9 16.9 ■ 100.0 87.4 87.3 87.3 87.3 21
22 13.2 12.8 13.6 135 13.7 13.3 13.7 13.8 13.8 14.3 13.3 14.2 15.2 14.9 15.0 160 14.2 14.3 16.9 16.9 0.0 ■ 87.4 87.3 87.3 87.3 22
23 4,6 5.1 4.6 5.3 5.0 4.4 3.4 2.4 2.4 2.8 3.4 2.4 3.0 2.9 3.0 3.5 0.0 1.3 204 20.4 14,2 14.2 ■ 98.7 98.7 98.7 23
24 4.5 5.0 4.5 5.4 4.9 4.5 3.5 2.5 2.5 2.9 3.5 2.5 3.1 3.0 3.1 3.6 1.3 0.0 19.9 199 14.3 14.3 1.3 100.0 100.0 24
25 4,5 5.0 4.5 5.4 4.9 4.5 3.5 2.5 2.5 2.9 3.5 2.5 3.1 3.0 3.1 3.6 1.3 0.0 19.9 19.9 14,3 14.3 1.3 0.0 ■ 100.0 25
26 4.5 5.0 4.5 5.4 4.9 4.5 3.5 2.5 2.5 2.9 3.5 2.5 3.1 3.0 3.1 3.6 1.3 0.0 19.9 19.9 14.3 14.3 1.3 0.0 0.0 ■ 26
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26
JQ9065521 A/CtliCkerVEgypti114915V/2011 JQ906556.1 A/ctiicken£gypt/124B/2012 KF881640.1 A/ChiCkeiVEgypt/S7022D/2013 KJ7812151 A/diicken/Egypt/13139V/2013 HH1826331 A/chickerVEg/ptW2014 KX000718.1 A/ctilckeni gypt/F95168/2014 KX0008531 A/ChiCken£gypt/S10916B/2015 KX000793.1 A/ctiicken£gyptlD10945B2015 KX0007501 A/CtliCken£gypt/S10939E/2015 KX783417.1 A/diickenJIsrael/214/2016 MH997629.1 A/CtliCken/Egypt/A-Ch1/2017 MN897765.1 A/cbicken£gypW69/2017 MN897767.1 A/ChiCken/EgypWV2479/2017 MK942474.1 Afchicken/lsraeli303070/2018 MK968882.1 A/ChiCken£gypt/AB2/2018 MK212394.1 A/chicken/EgypW1527/2018 HN897781 1 A/CtliCken/Egypt/FAO-S18/2019 MN8977821 A/ctoicken/EgypW2630/2019 HQ871933.1 A/CfliCken/Korea/GH2/2007 GU0531861 A/ctiicken/Korea/MS96-CE6/96 KF188366.1 A/chicken/Hong Kong/G9/97 AF156373.1 A/Chicken/Hong Kong/G9/97
MT319757AOicken/EgyptlKing-manoV1l MT319758 A/Cfiidien/EgypVMatrouh/19 MT319759 A/Chicken/EgypWortti-coastn i MT319760A/Chicken£gyptflahig/19
Figure 4. Genetic identity between circulating LPAI H9N2 and the selected four isolates (blue text box).
Figure 5. Phylogenetic tree showing the genetic relationships between circulating HPAI H5N8 and the selected three isolates for the HA gene (indicated by red dots).
Percent Identity
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
1 ■ 996 99.3 98.6 98.9 97.9 97.5 97.9 97.9 98.6 98.9 93.3 92.9 93.3 936 936 92.9 982 982 98.2 982 98.2 98 6 986 1
2 0.4 ■ 98 9 982 98.6 97.5 97.2 97.5 97.5 98.2 98.6 93.3 92.9 93.3 93.6 936 929 979 979 979 97.9 97.9 982 982 2
3 0.7 1.1 ■ 99.3 99.6 986 98.2 98.6 98.6 99.3 99.6 94.0 93.6 940 943 94.3 93.6 98.2 98.2 98.2 98.9 98.9 99.3 993 3
4 1.4 1.8 0.7 99.6 98.6 98.2 98.6 98.6 99.3 98.9 94.0 93.6 94.0 94.3 94.3 93.6 989 989 93.9 99.6 99.6 100.0 100.0 4
5 1.1 14 0.4 0.4 98.9 98.6 98.9 989 99.6 99.3 94.3 94.0 94.3 947 94.7 94.0 986 98.6 98.6 99.3 99.3 99.6 99.6 5
6 2.2 2.5 14 1.4 1.1 97.5 97.9 98.6 98.6 982 93.3 92.9 93.3 93.6 93.6 92.9 97,5 97,5 97.5 98.2 982 98.6 98.6 6
7 2.5 29 1.8 1.8 1.4 2.5 ■ 99.6 98.2 98.9 979 93.6 93.3 93.6 94.0 94.0 93.3 97.2 97.2 97.2 97.9 97.9 98.2 98.2 7
8 2.2 2.5 14 1.4 1.1 22 0.4 ■ 98.6 99.3 982 94,0 93.6 94.0 94.3 94.3 93.6 97,5 97.5 97.5 98.2 982 986 98.6 8
9 2.2 2.5 14 14 1.1 1.4 18 14 ■ 99.3 989 94,0 93.6 94 0 943 94.3 93.6 97,5 97,5 97.5 982 982 98 6 986 9
10 1.4 18 0.7 0.7 0.4 1.4 1.1 0.7 0.7 ■ 98.9 94.7 94.3 94.7 95.0 95.0 94.3 98.2 982 98.2 98.9 98.9 99.3 99.3 10
11 1.1 1.4 0.4 1.1 0.7 1.8 2.2 18 1.1 1.1 93.6 93.3 93.6 94.0 94.0 93.3 97.9 97.9 97.9 98.6 98.6 98.9 98.9 11
12 7.2 7.2 6.4 6.4 6.0 7.1 6.8 6.4 6.4 5.6 6.8 ■ 99.6 1000 99 6 996 996 929 92.9 92 9 93.6 936 94.0 94 0 12
13 7.6 7.6 6.8 6.8 6.4 7.5 7.2 6.8 6.8 60 7.2 0.4 ■ 99 6 99 3 993 1000 926 926 926 933 93.3 93.6 93.6 13
14 7.2 7.2 6.4 6.4 6.0 7.1 68 6.4 6.4 5.6 6.8 0.0 0.4 ■ 99.6 99.6 99.6 92.9 92,9 929 93.6 936 94.0 94.0 14
15 6.8 6.8 6.0 6.0 5.6 6.8 6.4 6.0 6.0 5.2 6.4 0.4 0.7 0.4 ■ 1000 99.3 93.3 93 3 93,3 94.0 94.0 94.3 94.3 15
16 6.8 6.8 6.0 60 5.6 68 6.4 6.0 6.0 5.2 6.4 0.4 07 04 00 99.3 933 933 933 940 94.0 94.3 94.3 16
17 7.6 7.6 6.8 6.8 6.4 7.5 7.2 6.8 68 6.0 72 0.4 0.0 0.4 0.7 0.7 926 926 926 93.3 93.3 93.6 93.6 17
18 1.8 2.2 1.8 1.1 1.4 2.5 2.9 2.5 2.5 1.8 2.2 7.6 8.0 7.6 7.2 7.2 8.0 ■ 1000 100.0 99.3 99.3 98.9 98.9 18
19 1.8 2.2 18 1.1 1.4 25 29 2.5 25 1.8 2.2 7.6 8.0 7.6 7.2 7.2 8.0 0.0 100.0 99.3 99.3 989 989 19
20 1.8 2.2 1.8 1.1 1.4 2.5 29 2.5 2.5 1.8 2.2 7.6 80 7.6 7.2 7.2 8.0 0.0 0.0 99.3 99.3 989 989 20
21 1.8 2.2 1.1 0.4 0.7 1.8 2.2 1.8 1.8 1.1 1.4 6.8 7.2 6.8 6.4 64 7.2 0.7 0.7 0.7 1000 996 996 21
22 1.8 2.2 1.1 0.4 07 18 2.2 1.8 1.8 1.1 1.4 6.8 7.2 6.8 6.4 6.4 7.2 0.7 0.7 0.7 0.0 ■ 99.6 99.6 22
23 14 1.8 0.7 0.0 0.4 1.4 1.8 14 1.4 0.7 1.1 6.4 6.8 6.4 6.0 6.0 6.8 1.1 1.1 1.1 0.4 0.4 ■ 1000 23
24 1.4 1.8 0.7 0.0 0.4 14 1.8 14 1.4 0.7 1.1 6.4 6.8 6.4 6.0 6.0 6.8 1.1 1.1 1.1 0.4 0.4 0.0 ■ "
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
MT199012A/Gallus Gallus/BetgiurrV6518/17 MT199010A/Turkey/BelgiurrV6136/17 MK494923 A/goose/Spain/lA17CR02699/17 MN658694A/chicken/Egypt/AL1/19 MN658767 A/Duck/Egypt/SMG5/19 MN068832 ATOucWCairo/189Fao-S/18 MH998498 A/chicken/Egypt/H 13796A/17 MK190702 A/duck/Egypt/F13667A/17 MF037851A/green-wingedteal/Egy/871/16 KP732646 A/duck/Eastem China/S1109/14 MH893739 A/RailsiEgypt/CA285/16 KJ413842 A/Broiler duck/Korea/Buan2/14 KJ413350A/baikal teal/Korea/Donglim3/14 KJ756625 A/Daikal teal/Korea/1449/14 KX297865Aienvironment/Korea/W458/14 KX297864 A/mallard duck/Korea/W457/14 KX297862A/environment/Korea/W454/14
MT372817A/turkey£gy/Noitti-coast-K38/19
MT372818A/chicken/Egy€l-namam/19-1
MT372819A/chicken/Egy/EL-hamam/19-10
MN658695A/cfiickenJEgypt/F111/19 MH733825Afctiicken-layer/Egypt/MR18/18 MN068839A®uck/AI-Monfi a/1727/17 MN658694A/chicken/Egypt/AL1/19
Figure 6. Genetic identity between circulating HPAI H5N8 and the selected three isolates (blue text box).
V
• 11_ : a 1 7 MJCJ 1 xv Vrtii 1
• 'A 1
lilBV
^riKUZWI/? iTfwjJTt96f2)7[} 1 EG
ri~KUl835i2 1 IÖyltG-A«Ö12 t*rji)u j Lkuirtf,io 1 evrt'Apivft u'20t3
I I-Mn2/4<li, t IBV
M .MKMOOTil GV Sfiartiia/201J " M • MtjMwrfmTMaiTmjn
-MHM'.ilM 1~)ftV CXirk '.ONI
Classic
^44 116VXV10
KU18}W> 1 10V J
/AR250-1«
MT wjBVTLfcjwwwi 1KU183611 1 TBV t!Vw2ivi4/(Xil
Wl1 KIESM174 rey QUi&n^lII t
■ I— 35553WS w, —H r AYOT1 ?52 7 TBVMswj'72<
TfcJ— G02»1M* T fcfV SufÖ aiffilii ■ .ly^n^m
IfclV AJjlamn - № 39653 rf IBV Ecti-^'Bc" :
»d
i140C
EGY/Variant II
EGY/Variant I
Crt WU I 7 IV IV ,_5JV'(H,ÄI IWkAT-i
Ta 1 4/91 Mthoaaf
J^JäaÄ. 1 ">§Y (UK i 67 n. Kf tuSl TJt№~ 4J51 vaccine Tlrtft " HiW ' 6lV~4.'V1 aft enu*
»H n«K88?992 1 IBV GX-YLKlOl»
100 r—H ' ©VOC1 -=-{ 1-KX ffiSlJV^«^
/ViKU'3675(J riBV M170 vaccine C ill ÄV84Ä750 1 'IBVrWjiXaiiJKFudietts im/Cv1««*1 1TBV111W-
-AYi^/i) rey"Mrf
L Afjfeny 1
r— 1JBV axerv 16W
M1 MG2'2»90 1 JÖV_QXJÖV_ '24/?
Vaccine like strains (4/91-like)
Vaccine like strains (Mass-Jlke) QX-flke
Figure 7. Phylogenetic tree showing the genetic relationships between representative IB viruses and the selected five isolates for the S1 gene (indicated by red dots) IB: Infectious Bronchitis.
1 t ) 4 4 8 ; a ■ 10 11 1] 13 M 15 19 17 1» X 71 2) 7) M 19 » 27 a
1 ni M c 999 «9 799 749 892 101 917 MS IS i — 748 74 9 790 790 7|| 719 1
■■ Kt' »T 898 T12 79Ö' 741 804 817 899 898 999 899 74i 79) 741 749 799 "T 71) 2
T ■Ü N8 94 9 MT 748 749 879 91 4 999 Ml Ii 9 741 74) 74 9' 741 790 741 711 714 3
4 1« IB 190 D nf 79J •82 912 990 U) 990 890 989 19S 799 799 797 798 792 7«T 749 73 1 4
t II ■ 797 877 100 889 890 MQ 99) 899 797 797 797 790 749 792 748 799 t
t » 19 ■1 no 797 ■ ] 804 812 mT ÜT 799 Tjj 1« 797 749 749 721 t
); Tr 3 B ■ 904 812 890 MO li 0 899 199 TsT "789 798 792 749 749 721 7U 7
• ni m T 274 79' 28 7 ■1 792 St N) 719 741 Mi IM 084 »1 71 1 729 72) 809 998 t
299 51 »7 »T 779 881 281 19 ■i 99* H 781 ^ 790" 74) 10 791 799 ÜT Ml 984 HI 799 72) 721 984 t
Id T 188 711 äT 288 "YT 19 ■I 74 8 780 74) 7)J 74) 718 74) 999 88 4 998 (04 78) 718 711 719 984 'ill 19
« m Iii Bl 12 1>9 128 128 ■■ 991 992" 8tT 913 84 9 891 T21 Til 721 782 749 719 7)9 728 11
12 10 J 10) 112 10? 188 U W» 182 308 11« 41 mm «T 8)1 919 at j; 7)0 7)| 710 7lT 791 71» «T ru 721 12
1) 14 16 1« 181 88 «1 181 87 «7 W 88 V * 18 7~ 88 187 «7 187 312 29 7 2tT 78 118 127 1 J 882 89 0 882 78 7 798 Tu 71 T 795 71 6 748 —— T1 Q "TTT 74 0' 74 r 74 8 1721 1 In ft ill 718 723 1) 14 11
31 T70 81 IT H « 1 M8 FlT 7ÖT 748 m no
11 H1_ £1 157. mr 187 187 HI 311 () 88 119 ■1 87 s" 718 718 719 718 782 748 718 718 738 738 18
IT it« 164 173 1T 187 170 178 328 »13 121 64 TT ■jTI 708 708 788 708 748 743 73S 713 710 81
1i 1S1 1f 1 tri 167_ 1«7 | 1ST ^ 3i7 »1 31.3 41 «J 88 '13 00 711 i!l 718 782 74 711 71J 738" 739 81
1» 28 4 »A «2 273 2T0 273 27» 380 377 323 FT 287 344 332 >48 888 713 72 rj 721* .721 780 75S 18
» ai] 28i 28« 274 27« 27« 274 380 VI J77 324 }12 28.1 siF 34 S Hi 1)2 910 n7 71.3 72 S 721 72.1 758 29
72 284 20 D 2M 28» 282 288 Wi at 270 288 279 270 274 380 384 377 ¡61 37] »7 ¿8 E» »7 287 280 332 148 332 338 332 "ÖT m 71.1 reJ 718 719 780 755 a i
» 3 3)8 0-2 08 723 711 J19 Tit 752 22
n 2ST »_7 M8 287 381 297 287 350 >54 382 296 ¿*i! 313 288 304 29« M7 288 348 348 383 844 780 745 23
- 24 2«T 288 287 »4 294 294 281 130 334 342 Ml »3 289 306 314 388 310 38.8 328 328 332 332 880 24
H 287 388 308 3#J 308 30.8 326 ;330 ,338 IL» 31s 318 327 318 322 Tit 334 338 340 340' ■1 7«? 25
« 2S7 287 M9 MS 288 3Q9 30.8 329 >3 3 34J 322 318 322 33.8 322 >28,322 336 317 >40 5 9 ■ 748
17 u ft ]f 1 Ä4 .Ui 32 i 342 541 373 >7 7 37 7 331 338 342 3iS 327 31f as'sij 28 8 281 219 2S3 MS 314 312 ■ H
7« Mt 35.4 as 4 UT 311 347 34.7 373 37 3 17) 342 350 326 338 328 JiB 124 28.1 281 28S 312 15 ■1 »1
1 1 i 4 s 8 ? 8 9 10 11 12 « « 18 18 18 2« 21 22 23 24 2S 29 27 29
iikxomo t bv »«tivjoii
147127409 1V' IM7.7070
I UII.'H'jrill'UIHlfl |
«njej;», p-«jmiiT. I
JV2799D 1©Y MQ
KUinm 1 wtiwi»iH)« 03979819 i ew-e<iin»cr«tJtrti
mkm;«44 \m< cr.10 KUWSU 1WEWR221114»14
16» &i9t%?vi2.eg ^TSIWHCrwWTIilWin
VT324024 W H-Utfftn
•r , y ■ - • . i
RJI223411 W28
TJIZ31! 11B. H!i
««17t) • e/M!
»Ml 750 1 ft fOi MUUOUSIt*
MM87KJ1» OX «.161(1« ■N1821541»4»1iU0 vyrisri 1 en <41 ik»i UC2724S611B» OtBV 48№241S MCS7248111B. Ol» 7520*17
Figure 8. Genetic identity between circulating IB and the selected five isolates (blue text box) IB: Infectious Bronchitis.
Figure 9. Phylogenetic tree showing the genetic relationships between circulating ND viruses and the selected six isolates for the F gene (indicated by red dots) ND: Newcastle disease.
i 2 3 4 § 9 1 9 f 19 n 12 "SI nr « 19 "F IT 19 » 21 M 24 26 29 27
1 11 91» M1 161 940 943 lit 992 791 711 797 791 №? 741 <94 ill 7941794 [744 7» 4 fll 741 791 7»1 794 749 791 1
2 N1 912 IIS Ml 799 799 799 794 799 794 791 791 799 741 791 719 7(1 7»7 797 799 719 791 744 799 2
) 19 1» 999 1)3 »33 941 90! 794 794 799 794 799 794 797 794 rr 797 791 9! 3 794 794 794 797 791 794 3
4 91 <; ) m 932 Rl 992 791 791 797 791 797 791 794 791 714 HI 799 7»4 799 79 1 791 797 794 79 9 1 791 4
I «17 14« 199 199 97 > 993 979 ¡171 »73 979 97J »73 979 997 97 0 970 97 0 97 9 914 973 »7 3 97> 979 »70 •7» 9
1 Ml 194 195 199 954 994 992 »92 B2 992 994 M2 .64 961 954 m 964 999 997 W 5 K9 Ml 994 169 9
7 HI 17» 177 171 «44 ■1 127 919 Bit 921 921 821 919 »13 119 813 913 913 919 935 919 919 919 913 813 6'9 7
• ♦ 24 3 25« 24 7 2«J 240 24$ SSjM 932 1967 114 ¡190 227 14 ■ 999 100 0 we N5 195 999 914 989 m Ml M2 M1 Ml 994 992 »34 992 W4 M? M> 997 992 911 IS! 949 M1 let >81 949 994 992 984 992 K6 995 9 1
10 25) 293 »5 269 13« 19 0 227 14 ■ 995 914 Ml Ml2 19» 992 992IM2 99 7 911 I*') Ml 992 992 »5 10
n 250 245 247 252 Mi 190 211 14 05 ■i Mi 994 941 N2 Ml 992 992 N2 997 911 949 9»9 992 992 195 11
1) at »3 »9 299 Ul 190 211 14 05 04 ■ M4]M9 •02 999 992 M2 (02 997 991 «5 M5 919 992 992 M9 13
13 299 24 7 »2 149 rra 211 14 .9 « 19 19 914 »1 97» 911 991 N1 999 991 [»79 979 97» 991 911 13
14 KI »2 »9 »9 M9 190 uT 237 14 11 11 01 11 99 »» 11 »9 17 U 994 997 999 HI 999 N9~ 9»2 999 911 ^09 4 wiTi 7" »94 M7 994 991 99 9 1 W 2** 14 19
1« »i 29« 291 291 <4 9 231
19 " 2*9 255 893 299 299 299 «2 179 239 19 <' M i.i 11 IB 11 1 17 19 14 ».3 11 ■ 999 1000 wL 195 992 99 5 974 99 9IM9 M91 M.I Ml 109 0" 911 »91 189 962 10 17
281 m U9 171 231 19 09 99 »9 979 999 N9
18 255 259 2S1 25.4 149 171 |»i 19 09 09 9» 04 tl 14 11 14 ■1 995 995 974 989 Mf 949 1090 »15 992 14
19 2JJ as 260 29.5 149 171 231 19 01 1 ft» »4 04 U 1.4 1.1 14 05 ■1 191 974 99 8 Mi 949 995 100 01H2 19
30 255 259 »1 25 4 «42 1U 223 1.9 03 ft3 •J 14 01 94 04 05 05 (i ■ 994 ¡992 992 992 995 945 N7 »
21 247 »2 J44 249 Ol 153 199 09 11 19 11 19 t9 19 " 24 22 22 22 974 979 971 974 971 941 21
a 259 213 »9 299 «41 |rtf 227 11 11 11 04 22 17 93 OS 14 14 14 09 2! ■ >000 9»9 999 Ml a
a »1 29J »9 299 «49 19 7 «7 11 " 11 04 22 17 92 94 14 14 14 99 29^ m N9 999 919 .9 a
34 2" 9 293;»9 »2 MJ ITS 227 11 11 11 11 1 1 22 17 11 14 14 14 99 29111 ■i 999 999 N9 24
n »9 299 251 299 «49 171 231 19 09 99 99 09 19 14 11 14 00 09 »9 9 9 22 14 14 14 m 99 Q Hi 29
» 213 299 299 299 «49 j 171 231 i»To9 99 9» 09 19 14 11 14 09 04 99 99 22 I 14 14 14 09 ■I 11
27 259 292 29.5 299 «49 19 7 227 14 u 95 99 0 5 1» 11 91 1.9 09 01 »4 93 til 11 11 11 08 27
2 3 * * « 7 I 9 19 11 12 13 MJJ» 16 17 19 19 20 » [a. » 24 » »
M2WM t U6ttv46 Cmehpi I rum 1 CUM X Cmttti* 0
t MlanxllMT Gtnditit | «1791171 KtmonNHK r.«i*tt I WJ701M I Ont»rw\» Xn}»nt «0703W 1 CwrtiW « Niwjnr «7031210wrttt* 3 «H j»MC Mtetto t Ep 2012 CwHr» MU Mitt» 311M 2914 a NR735 IM«Mttt1Vtl>»1« Eg»«tt«MR7» i»<lMtt2 ivm MH EgiM a HR7J1 •Mffil 1 KrUMMM
№№M 1KTMZW-M1I 1M9942101 KV«l121(r-J9l» MS4J)1?!2 10iOwME Di TI MHIfltnt 1 QMCtanMEtVEp t»C977»W 1 r»KWn€j>MW*iM1T »miivnEii
1*977»» 1 aKK»€a>H)S(VQ017
KV07SU21 «M aeacwMMaaia ■ ...........
Nri2452IMeitlcMII1 HTJ54M7Ht«Ha>MlJ N7324939 Noll OMI3 M7H4W1N(»IIC0KI4 WT324639N«9ia>Hl9 •(7X24531 NertiCMIt»
Figure 10. Genetic identity between circulating ND viruses and the selected six isolates (blue text box). ND: Newcastle disease.
Table 3. Results of RRT-PCR of surveyed poultry flocks.
AI H9N2
virus Total
+ve -ve
IB +ve 10 22 32
-ve 5 6 11
ND +ve 4 20 24
-ve 3 4 7
+ve 0 9 9
AI H5N8
-ve 0 6 6
Total 22 67 89
ND: Newcastle disease IB: Infectious bronchitis +ve: Positive -ve: Negative AI H9N2: Avian influenza H9 subtype AI H5N8: Avian influenza H5N8 subtype.
Table 4. Prevalence of different respiratory viruses in poultry flocks in the north coast of Egypt.
Virus AI H9N2 IB ND AI H5N8
Total flocks 89 43 31 15
+ve 22 32 24 9
percent 24.7% 74.4% 77.4% 60% ND: Newcastle disease IB: Infectious bronchitis +ve: Positive -ve: Negative AI H9N2: Avian influenza H9N2 subtype AI H5N8: Avian influenza H5N8 subtype.
Table 5. Single and mixed infection with respiratory viruses in the surveyed poultry flocks.
Viruses AI H9N2 IB ND AI H5N8 Total
Single infection 8 22 20 9 59
Mixed infection with AI H9N2 - 10 4 - 14
ND: Newcastle disease IB: Infectious bronchitis AI H9N2: Avian influenza H9 subtype AI H5N8: Avian influenza H5N8 subtype.
Table 6. Data and GenBank accession numbers of selected virus isolates for sequencing.
ND virus samples
sample Code name Governorates Species Collection date accession numbers
1 North cost 1 Matrouh Broiler 10/2018 MT324526
2 North cost 2 Alexandria Broiler 12/2018 MT324527
3 North cost 3 Alexandria Layer 1/2019 MT324528
4 North cost 4 Alexandria Broiler 2/2019 MT324529
5 North cost 5 Alexandria Duck 4/2019 MT324530
6 North cost 6 Matrouh Broiler 11/2019 MT324531
IB virus samples
1 Matrouh Matrouh Broiler 11/2019 MT324521
2 El hamam Alexandria Broiler 9/2019 MT324522
3 North coast K70 Alexandria Broiler 1/2019 MT324523
4 Al alamin Matrouh Layer 10/2018 MT324524
5 Elhawaria Alexanderia Layer 12/2018 MT324525
H9 virus samples
1 King mariot Alexandria Broiler 11/2018 MT319757
2 Matrouh Matrouh Layer 9/2019 MT319758
3 North coast K48 Alexandria Broiler 1/2019 MT319759
4 Bahig Alexandria Broiler 10/2019 MT319760
H5 virus samples
1 North coast K38 Alexandria Turkey 8/2019 MT372817
2 EL hamam Alexandria Broiler 1/2019 MT372818
3 EL hamam Alexandria Broiler 10/2019 MT372819
ND: Newcastle disease IB: Infectious bronchitis.
DISCUSSION
Avian viral respiratory pathogens investigated in the north coast poultry farms were detected in the current study using RRT-PCR. The obtained results indicated that ND viruses had the highest rate of 77.4% followed by 74.4%, 60%, and 24.7% for IB, H5N8, and H9N2 viruses, respectively. These results matched with those reported by Hassan et al. (2019) who found that 35, 27, 12, 9, and 9 samples out of 39 flocks were positive for AI H5N8, AI H9N2, IB, AI H5N1, and ND viruses, respectively, and detected an increase in the rate of positive flocks for AI H5N8 from 23% in 2017 to 66.6% during 2018. Shakal (2013) recorded that IB viruses had the highest incidence rate with 64% of the total investigated poultry farms, during January-July 2012 at 19 Egyptian governorates. Taher et al. (2017) showed that the incidence of IB, ND, AI H5, and AI H9 was 13.3%, 5.6%, 2.8%, and 1.1% respectively. Amer et al. (2018) found that H5, H9, and H5+ H9 subtypes were rated as 8.3%, 16.7%, and 6.5% respectively.
Co-infection with circulating H9N2 occurred in 14 poultry flocks, 10 flocks with IB, and 4 flocks with ND viruses. Abd El-Hamid et al. (2018) found that 12 out of 36 H9N2 affected poultry flocks co-infected with H5N1 (19.4%), ND (11.1%), and IB viruses (8.3%). Hassan et al. (2016) showed that mixed infections of IB with AI H9N2 viruses were the most common infection (41.7%). Amer et al. (2018) detected the mixed infections in chicken flocks of Egypt with AI H9N2 and ND genotype VII viruses. Davidson et al. (2014) and Hassan et al. (2016) reported that natural co-infections of AI H9N2 with ND viruses have occurred in poultry in Egypt.
Regarding the results of sequencing and phylogenetic analysis in the current study, AI H9N2 isolated viruses belonged to G1-lineage circulating in the Middle East, and were clustered with the isolated Egyptian H9N2 viruses during 2011-2019 with the similarity rate of 94.8-100%. Amer et al. (2018) found that H9 sequences belonged to the G1 lineage clustered with Egyptian H9N2 strains during 2015-2016. Abd El-Hamid et al. (2018) reported that the H9 isolates were clustered with recent Egyptian isolates of G1/97-like lineage of HA gene sequencing, and were similar to A/Quail/Egypt/113413v/2011 with about 92.3%-97.1% similarity rate. Monne et al. (2012) reported that all Egyptian AI H9N2 isolates were grouped within group B of G1-like lineage.
AI H5N8 isolated viruses were closely related to clade 2.3.4.4.b circulating in Egypt from 2014 to 2019
with an identity of 98.9 - 99.3%. Hassan et al. (2019) revealed that H5N1 and H5N8 were grouped within Clade 2.2.1.2 and Clade 2.3.4.4b, respectively. WHO (2019) reported that the higher the number of H5N8 infected poultry farms, the lower the number of human cases in Egypt (2016: 10; 2017: 3; 2018: 0). Also, Grund et al. (2018) reported that Clade 2.3.4.4b H5N8 viruses were known to have grossly reduced zoonotic propensity versus clade 2.2.1.2 H5N1 (Samir et al., 2015; Ghazi et al., 2016).
Two IB isolated viruses were located with classic strain circulating in Egypt with an identity of 71.8-91.2%, and the other three IB isolates belonged to EGY/Variant 11 with an identity of 70.6-75.2%. Abou El-Fetouh et al. (2016) revealed that the results of partial sequencing and phylogenetic analysis of 400 bp of S1 gene for the isolates of IB viruses were separated into two distinct groups, namely variant 2 and classic. Also, Zanaty et al. (2016) isolated 20 IB viruses, four belonging to the classic group and 16 belonging to the variant group (six isolates with Egy /Var-1 and 10 isolates with Egy /Var -2).
Abd El-Moneim et al. (2012) partially analyzed the S1 gene of IB virus isolates and found that these isolates were closely related to recent Egyptian IB viruses isolated in northern and middle Egypt, and belonged to genotype variant 2. Meir et al. (2004) found that isolates of IB viruses were closely related to the Israeli nephropathogenic isolate (IS/885/00).
Finally, the selected isolated ND viruses belonged to genotype V11 circulating in Egypt from 2012 to 2018 with an identity of 97.6-100%. Amer et al. (2018) found that NDV isolates belonged to the class II genotype VII. Ramzy (2016) mentioned that genetic classification has divided NDV into two classes (I and II); class I was composed of only 1 genotype (class I, genotype I), and class II was divided into 18 genotypes (class II, genotypes I-XVIII). The predominant genotypes and virulent viruses circulating worldwide were genotypes V, VI, and VII. Genotype VII was associated with the most recent outbreaks in Africa, Asia, and the Middle East.
CONCLUSION
The current study concluded that the most predominant etiology of respiratory diseases in the north coast of Egypt were ND followed by IB, AI H5N8, and AI H9N2 viruses, furthermore ND and IB viruses isolated in this study were not related genetically to their vaccinal strains. Also, AI H5N8 circulating alone in affected flocks while AI H9N2 circulating alone and/or mixed with either IB (most
common) or ND viruses (less), finally, The north coast of Egypt is a zone of sustainable development, so there is a need to devise a complete strategy to control the isolated respiratory viruses.
DECLARATIONS
Acknowledgments
The authors thank the members of Maryout Research Station, Desert Research Center, Ministry of Agriculture, Egypt. With deeply indebted and grateful to Dr. Ahmed Erfan, Researcher, Reference Laboratory for Veterinary Quality Control on Poultry Production, Agriculture Research Center, Ministry of Agriculture, Egypt.
Competing interests
The authors declare that they do not have any Competing interests.
Authors' contribution
Dr. Hanan El-Samahy planned the work, article writing, and revision, Dr. Disouky Mourad designed the protocol and helped in sample collection and laboratory analyses. All authors have read and approved the final manuscript.
REFERENCES
Abd El-Hamid HS, Ellakany HF, Elbestawy AR, and Gado AR (2018). Molecular characterization of H9N2 avian influenza viruses isolated from commercial broiler chickens in Egypt during 20142015. Alexandria Journal of Veterinary Sciences, 56(2): 54-61. DOI: https://www.doi.org/10.5455/ajvs.220473
Abd El-Moneim AS, Afifi MA, and El-Kady MF (2012). Emergence of a novel genotype of avian infectious bronchitis virus in Egypt. Archives of Virology, 157(12): 2453-2457. DOI: https://www.doi.org/10.1007/s00705-012-1445-1
Abou El-Fetouh MS, Mohamed HM, Nahla AG, Mohamed HA, and Abd Elfattah IE (2016). Pathological studies on infectious bronchitis disease in chickens. Zagazig Veterinary Journal, 44(3): 251-262. DOI: https://www.doi.org/10.21608/zvjz.2016.7879
Adel A, Arafa A, Hussein HA, and El-Sanousi A (2016). Antibody response of commercial vaccinated layers against H9N2 viruses in Egypt. Global Veterinaria, 16(6): 557-564. DOI: https://www.doi.org/10.5829/idosi.gv.2016.16.06.10463
Altschul SF, Gish W, Miller W, Myers EW, and Lipmanl DJ (1990). Basic local alignment search tool. Journal of Molecular Biology, 215(3): 403-410. DOI: https://www.doi.org/10.1016/S0022-2836(05)80360-2
Aly MM, Arafa A, and Hassan MK (2008). Epidemiological findings of outbreaks of disease caused by highly pathogenic H5N1 avian influenza virus in poultry in Egypt during 2006. Avian Diseases, 52(2): 269-277. DOI: https://www.doi.org/10.1637/8166-103007-Reg.1.
Amer MM, Asmaa MM, Abdel-Alim GA, Awaad MH, and Kutkat MA (2018). Isolation and identification of H9N2 avian influenza and Newcastle disease viruses co-infections in chicken. Egyptian
Journal of Veterinary Sciences, 49(2): 135-146. DOI: https://www.doi.org/10.21608/ejvs.2018.4963.1043
Ben Shabat M, Meir R, Haddas R, Lapin E, Shkoda I, Raibstein I, Perk S, and Davidson I (2010). Development of a real-time TaqMan RT-PCR assay for the detection of H9N2 avian influenza viruses. Journal of Virological Methods, 168(1-2): 72-77. DOI: https://www.doi.org/10.1016/j.jviromet.2010.04.019
Cook JK, Jackwood M, and Jones RC (2012). The long view: 40 years of infectious bronchitis research. Avian Pathology, 41(3): 239-250. DOI: https://www.doi.org/10.1080/03079457.2012.680432
Davidson I, Fusaro A, Heidari A, Monne I, and Cattoli G (2014). Molecular evolution of H9N2 avian influenza viruses in Israel. Virus Genes, 48(3): 457-463. DOI:
https://www.doi.org/10.1007/s11262-014-1037-0
De Wit J (2000). Detection of infectious bronchitis virus. Avian Pathology, 29(2): 71-93. DOI: https:// www.doi.org/ 10.1080/ 030 794 500 94 108.
Easterday BC, Hinshaw VS, and Halvorson DA (1997). Influenza. In diseases of poultry, 10th ed. Calnek et al., eds., Ames IA: Iowa State University Press, pp. 583-605.
El-Zoghby EF, Arafa AS, Hassan MK, Aly MM, Selim A, Kilany WH, Selim U, Nasef S, Aggor MG, Abdel Wahab EM et al. (2012). Isolation of H9N2 avian influenza virus from bobwhite quail (Colinus virginianus) in Egypt. Archives of Virology, 157(6): 11671172. DOI: https://www.doi.org/10.1007/s00705-012-1269-z.
Gelb JJ, and Jackwood MW (2008). Infectious Bronchitis. In A Laboratory Manual for the Isolation, Identification and Characterization of Avian Pathogens, 5th ed. L. Dufour-Zavala, D.E. Swayne, J.R. Glisson, J.E. Pearson, W.M. Reed, M.W.Jackwood, and P. Woolcock, eds. American Association of Avian Pathologists, Kennett Square, pp. 146-149. Available at: https://www.vet-library.com/pathology/microbiology/virology/p-2224-a-laboratory-manual-for-the-isolation-identification-and-characterization-of-avian-pathogens-5th-edition.html
Ghazi K, Ahmed K, Rabeh ES, Ahmed SK, Asmaa MM, Zhipeng C, and Mohamed AA (2016). Avian influenza A (H5N1) virus in Egypt. Emerging Infectious Diseases journal, 22(3): 379-388. DOI: https://www.doi.org/10.3201/eid2203.150593
Grund C, Hoffmann D, Ulrich R, Naguib M, Schinköthe J, Hoffmann B, Harder T, Saenger S, Zscheppang K, Tönnies M et al. (2018). A novel European H5N8 influenza A virus has increased virulence in ducks but low zoonotic potential. Emergening Microbes and Infections, 7(1): 1-14. DOI: https://www.doi.org/10.1038/s41426-018-0130-1
Hassan KE, El-Kady MF, EL-Sawah AA, Luttermann C, Parvin R, Shany S, Beer M, and Harder T (2019). Respiratory disease due to mixed viral infections in poultry flocks in Egypt between 2017 and 2018: Upsurge of highly pathogenic avian influenza virus subtype H5N8 since 2018. Transboundary and Emerging Diseases, pp. 1-16. DOI: https://www.doi.org/10.1111/tbed.13281
Hassan KE, Shany SA, Ali A, Dahshan AH, El-Sawah AA, and El-Kady MF (2016). Prevalence of avian respiratory viruses in broiler flocks in Egypt. Poultry Science, 95(6): 1271-1280. DOI: https://www.doi.org/10.3382/ps/pew068
Hoffmann B, Hoffmann D, Henritzi D, Beer M, and Harder TC (2016). Riems influenza a typing array (RITA): An RT-qPCR-based low density array for subtyping avian and mammalian influenza a viruses. Scientific Reports, 6(1): 1-10. DOI: https://www.doi.org/10.1038/srep27211
Londt BZ, Nunez N, Banks J, Nili H, Johnson LK, and Alexander DJ (2008). Pathogenesis of highly pathogenic avian influenza A/turkey/Turkey/1/2005 H5N1 in Pekin ducks (Anas platyrhynchos) infected experimentally. Avian Pathology, 37(6): 619-627. DOI: https://www.doi.org/10.1080/03079450802499126
Mase M, Imai K Sanada Y, Sanada N, Yuasa N, Imada T, Tsukamoto K and Yamaguchi S (2002). Phylogenetic analysis of newcastle disease virus genotypes isolated in Japan. Journal of Clinical Microbiology, 40(10): 3826-3830. DOI:
https://www.doi .org/10.1128/JCM.40.10.3826-3830.2002
Meir R, Maharat O, Farnushi Y, and Simanov L (2010). Development of a real-time TaqMan® RT-PCR assay for the detection of infectious bronchitis virus in chickens and comparison of RT-PCR and virus isolation. Journal of Virological Methods, 163(2): 190-194. DOI: https://www.doi.org/10.1016/jjviromet.2009.09.014
Meir R, Rosenblut E, Perl S, Kass N, Ayali G, Perk S, and Hemsani E (2004). Identification of a novel nephropathogenic infectious bronchitis virus in Israel. Avian Diseases, 48(3): 635-641. DOI: https://www.doi .org/10.1637/7107.
Mohamed MH, Kumar S, Paldurai A, and Samal SK (2011). Sequence analysis of fusion protein gene of Newcastle disease virus isolated from outbreaks in Egypt during 2006. Virology Journal, 8(1): Article number 237. DOI: https://www.doi.org/10.1186/1743-422X-8-237
Monne I, Hussein HA, Fusaro A, Valastro V, Hamoud MM, Khalefa RA, Dardir SN, Radwan MI, Capua I, and Cattoli G (2012). H9N2 influenza A virus circulates in H5N1 endemically infected poultry population in Egypt. Influenza and Other Respiratory Viruses, 7(3): 240-243. DOI: https://www.doi.org/10.1111/j.1750-
2659.2012.00399.x
Naguib MM, El-Kady MF, Lüschow D, Hassan KE, Arafa AA, El-Zanaty A, Hassan MK, Hafez HM, Grund C, and Harder TC (2017). New real time and conventional RT-PCRs for updated moleculardiagnosis of infectious bronchitis virus infection (IBV) in chickens in Egypt associated with frequent co-infections with avian influenza and Newcastle disease viruses. Journal of Virological Methods, 245: 19-27. DOI:
https://www.doi.org/10.1016/j.viromet.2017.02.018
Office International Epizootics (OIE) (2005). Manual of diagnostic tests and vaccines for terrestrial animals. Part 2 section 2.1. Chapter, 2.1. Available at: https://www.oecd-ilibrary.org/sites/b3852e6b-en/index.html?itemId=/content/component/b3852e6b-en
Radwan MM, Darwish SF, El-Sabagh IM, El-Sanousi AA, and Shalaby MA (2013). Isolation and molecular characterization of Newcastle disease virus genotypes II and VIId in Egypt between 2011 and 2012. Virus Genes, 47(2): 311-316. DOI: https://www.doi.org/10.1007/s11262-013-0950-y
Ramzy N (2016). Viral respiratory diseases of chicken in Egypt. Egyptian Journal of Chemistry and Environmental Health, 2(2): 3844. Available at: http://cehea.org/wp-content/uploads/2017/01/5-.pdf
Samir R, Eduardo AB, Marwa Mohamed A, Manal F, Katherine R, Abd Hanaa Abu Elsood E, and Amr K (2015). increased number of human cases of influenza virus A (H5N1) infection, Egypt, 201415. Emerging Infectious Diseases Journal, 21(12): 2171-2173. DOI: https://www.doi.org/10.3201/eid2112.150885.
Shakal M (2013). Current situation of poultry respiratory diseases in Egypt. international conference on animal & dairy sciences July 2324, embassy suites las vegas, NV, USA. Journal of Veterinary Science and Technology, 4: 4. DOI: http://www.dx.doi.org/10.4172/2157-7579.S1.002
Shankar BP (2008). Common respiratory diseases of poultry. Veterinary World, 1(7): 217-219. Available at:
http://www.veterinaryworld.org/200 8/July/10 .html.
Slomka MJ, Coward VJ, Banks J, Löndt BZ, Brown IH, Voermans J, Koch G, Handberg KJ, Jergensen PH, Cherbonnel-Pansart M et al. (2007). Identification of sensitive and specific avian influenza polymerase chain reaction methods through blind ring trials organized in the European Union. Avian Diseases, 51(1): 227-234. DOI: https://www.doi.org/10.1637/7674-063006RL1
Spackman E, Senne DA, Myers TJ, Bulaga LL, Garber LP, Perdue ML, Lohman K, Daum LT, and Suarez DL (2002). Development of a real-time reverse transcriptase PCR assay for type a influenza virus and the avian H5 and H7 hemagglutinin subtypes. Journal of Clinical Microbiology, 40(9): 3256-3260. DOI: https://www.doi.org/10.1128/jcm.40.93256-3260.2002
Taher MT, Amer MM, Arafa A, and Saad FE (2017). Epidemiology of viral components causing respiratory problems in broilers in six Egyptian Governorates. Journal of Veterinary Medical Research, 24(1): 308-320. DOI:
https://www.doi.org/10.21608/jvmr.2017.43266.
Tamura K, Stecher G, Peterson D, Filipski A, and Kumar S (2013). MEGA 6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution, 30(12): 2725-2729. DOI: https://www.doi.org/10.1093/molbev/mst197.
Thompson JD, Higgins DG, and Gibson TJ (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22(22): 4673-4680. DOI:
https://www.doi.org/10.1093/nar/22.22.4673.
Wise MG, Suarez DL, Seal BS, Pedersen JC, Senne DA, King DJ, Kapczynski DR, and Erica Spackman E (2004). Development of a real-time reverse-transcription pcr for detection of Newcastle disease virus RNA in clinical samples. Journal of Clinical Microbiology, 42(1): 329-338. DOI:
https://www.doi.org/10.1128/jcm.42.L329-338.2004.
World Health Organization (WHO) (2019). Cumulative number of confirmed human cases for Avian Influenza A (H5N1) reported to WHO 2003-2019. Source: WHO /GIP, data in HQ as of 12 February 2019. Available at:
https://www.who.int/influenza/human_animal_interface/2019_02_1 2 tableH5N1.pdf?Ua=1
Zanaty A, Arafa AS, Hagag N, and El-Kady M (2016). Genotyping and pathotyping of diversified strains of infectious bronchitis viruses circulating in Egypt. World Journal of Virology, 5(3): 125-134. DOI: https://www.doi.org/10.5501/wjv.v5.i3.125
