Научная статья на тему 'Bacteria associated with planktonic diatoms from lake Baikal'

Bacteria associated with planktonic diatoms from lake Baikal Текст научной статьи по специальности «Биологические науки»

CC BY
202
81
i Надоели баннеры? Вы всегда можете отключить рекламу.
Журнал
Acta Biologica Sibirica
WOS
Scopus
AGRIS
Область наук
Ключевые слова
DIATOMS / BACTERIA / 16S RRNA SEQUENCING / LAKE BAIKAL

Аннотация научной статьи по биологическим наукам, автор научной работы — Mikhailov I.S., Zakharova Y.R., Volokitina N.A., Petrova D.P., Likhoshway Y.V.

Algal-bacterial associations were studied in unialgal xenic cultures of Synedra acus subsp. radians, Asterionella formosa and Fragillaria crotonensis planktonic diatoms from Lake Baikal, using epifluorescent and scanning electron microscopy. It was found that rodand ovoid-shaped bacteria colonized cell walls of diatoms. Cloning and sequencing of fragments of 16S rRNA gene in diatom cultures revealed members of Gammaproteobacteria ( Pseudomonas sp.), Betaproteobacteria ( Janthinobacterium sp., Hydrogenophaga sp., Methylophilus sp.), Bacteroidetes ( Flavobacterium sp., Pedobacter sp.), and Acinobacteria ( Nocardioides sp.).

i Надоели баннеры? Вы всегда можете отключить рекламу.
iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

Текст научной работы на тему «Bacteria associated with planktonic diatoms from lake Baikal»

Slcfa ^iotyjka StbirÎca

Joiu rul (if Umlag}'

Founded in ÎOiS

ISSN 2412-1908

Acta Biologica Sibirica, 2018, 4(4), 89-94

Altai State University

www.asu.ru

RESEARCH ARTICLE

Bacteria associated with planktonic diatoms

from Lake Baikal

I.S. Mikhailov*, Y.R. Zakharova, N.A. Volokitina, D.P. Petrova, Y.V. Likhoshway

Limnological Institute, Siberian Branch of the Russian Academy of Sciences, Irkutsk, Russia ivanmikhai@gmail.com, julia.zakharova@gmail.com, nshelest@mail.ru, daryapetr@gmail.com,

likhoshway@mail.ru

Algal-bacterial associations were studied in unialgal xenic cultures of Synedra acus subsp. radians, Asterionella formosa and Fragillaria crotonensis planktonic diatoms from Lake Baikal, using epifluorescent and scanning electron microscopy. It was found that rod- and ovoid-shaped bacteria colonized cell walls of diatoms. Cloning and sequencing of fragments of 16S rRNA gene in diatom cultures revealed members of Gammaproteobacteria (Pseudomonas sp.), Betaproteobacteria (Janthinobacterium sp., Hydrogenophaga sp., Methylophilus sp.), Bacteroidetes (Flavobacterium sp., Pedobacter sp.), and Acinobacteria (Nocardioides sp.).

Key words: diatoms; bacteria; 16S rRNA sequencing; Lake Baikal

Introduction

Phytoplankton and bacteria play a key role in biogeochemical cycles in aquatic ecosystems (Cole, 1982; Azam, Malfatti, 2007). Diatoms are common microeukaryotes responsible for 20% of the photosynthesis on Earth (Armbrust,

2009). Diatom cells are surrounded by phycosphere containing extracellular metabolites that stimulate growth of heterotrophic bacteria (Amin et al., 2012; Seymour et al., 2017). Relationships between diatoms and bacteria vary from symbiotic to commensal to parasitic (Cole, 1982; Amin et al., 2012). Heterotrophic bacteria associated with phytoplankton consume organic matter produced by live algae or generated during their lysis (Riemann et al., 2000; Azam, Malfatti, 2007). Bacteria facilitate the build-up of aggregates from diatom cells and other compounds, thereby, increasing settlement of organic compounds in the water column (Gärdes et al., 2011). Determining the composition of bacterial communities associated with certain species of algae helps to determine the relationship between phytoplankton and bacteria. Composition and physiological characteristics of diatom-associated bacteria are typically studied using lab cultures (Schäfer et al., 2002; Grossart et al., 2005; Sison-Mangus et al., 2014; Mila et al., 2018). Members of Proteobacteria, Bacteroidetes and Actinobacteria were detected earlier in marine (Schäfer et al., 2002; Grossart et al., 2005; Sapp et al., 2007a; Sapp et al., 2007b; Guannel et al., 2011) and freshwater diatom cultures (Bruckner et al., 2008; Zakharova et al., 2010; Mila et al., 2018). When co-cultured with bacteria, diatoms increase production of polysaccharides (Bruckner at al., 2008). Bacteria produce vitamins necessary for microalgae growth (Croft et al., 2005).

In the spring, a massive bloom of phytoplankton dominated by diatoms (13-98% of phytoplankton biomass) takes place in Lake Baikal (Popovskaya et al. 2015). Although the composition of dominant phytoplankton species is different in different areas of the lake, the composition of bacterial communities is similar (Mikhailov et al., 2015). Earlier, culturable heterotrophic Proteobacteria and Actinobacteria were found in culture of Synedra acus subsp. radians (Kütz.) Skabitsch (Fragilaria radians (Kützing) D.M. Williams & Round) isolated from the Listvenichny Bay (Lake Baikal) (Zakharova et al.,

2010). Since nonculturable bacteria account for a large share of bacterial communities, the analysis of fragments of 16S rRNA gene from the total DNA allows to better identify the composition of bacterial communities (Schäfer et al., 2002; Grossart et al., 2005; Mila et al., 2018).

The goal of this work was to study algal-bacterial associations using microscopy and to determine the bacterial composition in cultures of planktonic diatoms by means of cloning and sequencing of the 16S rRNA gene.

Materials and Methods

Objects of study. Phytoplankton samples collected with a Jedy net in the photic 0-25 m layer from the RV 'G.Yu. Vereschagin' in late May - early June 2011 in the southern basin of the lake at the Listvyanka-Tankhoi and Peschanaya Bay stations (1,425 m and 966 m depths, respectively); and in the middle basin in the Chuvyrkuy Bay (10 m depth) (Fig. 1). Using micromanipulation, single diatom cells were transferred to a well of a 96-well microplate (Linbro Biomedicals, INC, Denmark) containing 200 |jl of sterile diatom medium (DM) (Zakharova et al., 2010). Cells were grown in a microincubator at 8°C and continuous light at 16 pmol of photons m-2 s-1 on a 12-hour alternating day/night cycle (Safonova et al., 2007). As the number of diatom cells reached 103, unialgal cultures were transferred to a 1 L Erlenmeyer flask for further

Fig. 1. Map of sampling stations at Lake Baikal

Epifluorescent microscopy. Total bacterial abundance was determined in a 1 ml sample fixed with glutaraldehyde and stained with 4,6 diamidino-2-phenylindole (DAPI, Sigma-Aldrich, USA) with a final concentration of 1 pg/ml during 15 minutes (Porter, Feig, 1980). A stained sample was filtered through a polycarbonate membrane (0.2 pm) (Whatman GE Healthcare Life Science, UK) using a filter unit (Sartorius, Germany). Bacterial cells were enumerated using an inverted microscope Axiovert 200 (Carl Zeiss, Germany) with an ultraviolet lamp HBO 50W/AC ASRAM with an excitation spectrum of 365 nm. For total bacterial abundance counts were taken at least 20 fields of view per sample.

Scanning electron microscopy. Scanning electron microscopy was used to analyze diatom-bacteria associations. A diatom culture sample was fixed with a 1% glutaraldehyde solution, placed on 0.2 pm polycarbonate filters (Millipore, Ireland), and air dried. The sample was dewatered in ethanol solutions of 30%, 50%, 70% and 96% (during 10 min each time) and then dried. A filter holding the sample was then fixed at a SEM screen with a double-sided scotch tape and coated with gold in a vacuum unit SDC 004 (BALZERS). Samples were examined under a scanning electron microscope FEI Quanta 200 (USA).

DNA extraction, amplification, cloning and sequencing. One hundred ml of diatom cultures that were at the exponential growth stage (after 10 days of culturing) were filtered through 0.2 pm polycarbonate filters (Millipore, Ireland). Biomass was then washed in sterile flasks containing 5 ml of TE buffer (10mM Tris-HCl containing 1mM EDTA, pH 7.5) and stored at -20°C. DNA was extracted from the biomass with lysozyme, 10% SDS and phenol-chloroform (Marmur, 1961). Fragments of the 16S rRNA gene were amplified using the polymerase chain reaction (PCR) with primers 27L (AGAGTTTGATCMTGGCTCAG), 500L (CGTGCCAGCAGCCGCGGTAA) and 1350R (GACGGGCGGTGTGTACAAG) (Denisova et al., 1999). Obtained PCR products were lygated in pJET using CloneJET™ PCR Cloning Kit. Ligation and transformation were performed according to a methodology (Inoue et al., 1990). Sequencing of fragments of the 16S rRNA gene was performed using BigDye V 3.1 Terminator Cycle sequencing kit and AmpliTaqDNA polymerase FS (Applied Biosystems) on a genetic analyzer ABI 3130XL Genetic Analyser (Applied Biosystems) in Genomics Core Facility (Institute of Chemical Biology and Fundamental Medicine SB RAS, Novosibirsk).

Sequencing data analysis. Sequences obtained during the sequence analysis were compared to sequences in GenBank, EMBL and DDBL databases via the BLASTN program. MEGA5.1 program and "neighborjoining" algorithm were used to compare sequences and create phylogenetic trees. Statistical accuracy of branching was evaluated with the

"bootstrap analysis" (1,000 replicates). 16S rRNA sequences consisting of 430-694 base pairs were deposited in GenBank with numbers KR870424 - KR870434.

Results and discussion

Four unialgal xenic cultures of diatoms isolated from the lake's plankton were used to analyze algal-bacterial associations: two S. acus subsp. radians cultures (Listvyanka-Tankhoi - ltsa; Peschanaya Bay - psa); Asterionella formosa Hassall and Fragillaria crotonensis Kitton cultures (Chivyrkuysky Bay - chaf and chfc, respectively). Diatom cells differed in size (Table 1, Fig. 2). In 10-day cultures, the number of diatoms and bacteria was 2.4-3.3x103 cell/ml and 0.9-1.2x106 cell/ml, respectively (Table 1). The number of bacteria in diatom cultures (Table 1) is similar to the number of bacteria in plankton of Lake Baikal during spring diatom blooms (0.2-2.2x106 cell/ml) (Mikhailov et al., 2015).

Table 1. Diatom and bacteria counts in cultures

Diatom cultures Length & width of Diatom abundance, Total bacterial

diatom cells cells/ml abundance, cells/ml

Synedra acus subsp. radians ltsa 160-200 |jm, 3 |jm 3,3x103 0,9x106

Synedra acus subsp. radians psa 160-200 |jm, 3 |jm 2,4x103 0,9x106

Asterionella formosa chaf 40-50 |jm, 3 |jm 3,0x103 1,0x106

Fragillaria crotonensis chfc 30-40 |jm, 4 |jm 2,9x103 1,2x106

Free-living bacteria and diatom-attached bacteria were found in cultures. Scanning electron microscopy revealed that rod- and ovoid-shaped bacteria colonized diatom cell walls (Fig. 2). Bacteria were attached to the diatom cells either individually or in microcolonies (Fig. 2). In some cases, bacteria were located near diatom's cingulum (Fig. 2e) and combined several diatom cells into aggregates (Fig. 1c). Bacteria in diatom cultures grow without additional sources of carbon, therefore, they use organic matter produced by diatoms. Bacteria associated with phytoplankton blooms have transporters and enzymes to consume low molecular weight molecules and to degrade complex polymer organic compounds (Buchan et al., 2014).

Fig. 2. Associations of diatoms and bacteria in unialgal xenic cultures. a, b, c - S. acus subsp. radians; d, e, f - A. formosa; g, h, i - F. crotonensis. Arrows point to bacteria. SEM. Scale: a - 50 |jm; b, e, f, h - 5 |jm; c, i - 4 |jm; d - 100 |jm; g - 10 |jm.

Sequences of 16S rRNA genes in diatom cultures were found to be 99-100% similar to sequences of bacteria from GenBank belonging to Proteobacteria, Bacteroidetes, and Actinobacteria (Fig. 3). Only sequences of Pseudomonas sp. were found in S. acus subsp. radians cultures (ltsa, psa) (Fig. 3). Earlier, heterotrophic bacteria of Sphingomonas sp., Caulobacter vibrioides, Brevundimonas vesicularis (Alphaproteobacteria), Variovorax paradoxus (Betaproteobacteria), Pseudomonas fluorescens (Gammaproteobacteria) u Microbacterium trichotecenolyticum, Rhodococcus sp. (Actinobacteria) were found in S. acus subsp. radians culture incubated in a 100 L photobioreactor (Zakharova et al., 2010). Sequences of Flavobacterium sp. (Bacteroidetes), Pseudomonas sp. (Gammaproteobacteria), Hydrogenophaga sp., Methylophilus sp. (Betaproteobacteria), and Nocardioides sp. (Actinobacteria) were detected in A. formosa culture (chaf) (Fig. 3). In the culture of A. formosa isolated from a small Esthwaite Water lake (UK), high-throughput sequencing revealed operational taxonomic units most similar to Flavobacterium, Sediminibacterium, Leadbetterella (Bacteroidetes), Gemmobacter, Rhodopseudomonas, Novosphingobium (Alphaproteobacteria), Pseudomonas (Gammaproteobacteria), Aquabacterium, Rhizobacter, Variovorax, Pelomonas (Betaproteobacteria) (Mila et al., 2018). Sequences of Flavobacterium sp., Pedobacter sp., and Janthinobacterium sp. were found in F. crotonensis culture (chfc) (Fig. 3). Obtained 16S rRNA sequences of bacteria in cultures of different Baikal diatoms are most similar to sequences found in freshwater reservoirs, plant surfaces and biofilms of precipitations and stones.

Janthinobacterium sp. HC7-17, JF313035.1 Janthinobacterium sp. TP-Snow-C76, KC987006.1

▲ clone chfc22, KR870430 (4)

▲ clone chfc25, KR870431 (3) ▲ clone chaf26, KR870425 (2)

Uncultured Hydrogenophaga sp. clone SBC-il9, AM990010.1 Hydrogenophaga sp. BAC306, EU130968.1 ■ Uncultured Methylophilus sp. clone: BPP-23, AB849314.1 !▲ clone chaf54, KR870427 (1)

70 100

100 44

100 I' 58l

58 L Uncultured bacterium clone DB-32, KM454375.1 clone chaf56, KR870428 (2)

ß-Proteobacteria

ri,

Pseudomonas sp. PT19, KF465842.1 0<nA clone ltsa1, KR870429 (5) ""' Pseudomonas sp. PsI, AF105387.1

A clone psa8, KR870434 (6) 100 I Pseudomonas sp. DMSP-ZZ, KC860268.1 _

Nocardioides plantarum strain J70, NR_036915.1 _

▲ clone chaf51, KR870426 (2) 79Uncultured bacterium clone ZQMB01, JF417827.1 _

▲ clone chfc52, KR870433 (1) _ Uncultured bacterium clone BROJ-23, KP012227.1 Pedobacter daechungensis strain Dae 13, NR_041507.1

100 pAclone chfc49, KR870432 (1)

I— Flavobacterium sp. WB2.1-83, AM934639.1

Uncultured Flavobacterium sp. clone XZTSH72, EU703375.1 ▲ clone chaf25, KR870424 (1) 83 L Flavobacterium sp. S4, KF499996.1

N

100 Lri 7<H- U

74

100 n U Lp

Y-Proteobacteria

Actinobacteria

_|— 1

100 tf^ 83I- Fl

Bacteroidetes

0.05

Fig. 3. A phylogenetic tree of 16S rRNA gene fragments for bacteria associated with S. acus subsp. radians (ltsa, psa), A. formosa (chaf) and F. crotonensis (chfc), and similar sequences from the GenBank database. Triangles show obtained sequences. The number of sequences are shown in parentheses.

The number of bacterial phylotypes is significantly lower in diatom cultures (Fig. 3) than in the lake's plankton during phytoplankton bloom (Mikhailov et al., 2015). The diversity of bacteria is lower in diatom cultures than in natural phytoplankton samples. Bacteria that are dominant in natural conditions are typically found in diatom cultures (Schäfer et al., 2002). Gammaproteobacteria (Pseudomonas sp.) were found in three diatom cultures (S. acus subsp. radians ltsa, psa, and A. formosa chaf), while Betaproteobacteria and Bacteroidetes were found in two (A. formosa chaf and F. crotonensis chfc), and Actinobacteria was found in one (A. formosa chaf). During spring diatom blooms Actinobacteria, Bacteroidetes, and, sometimes, Verrucomicrobia dominated in Lake Baikal. Betaproteobacteria and Gammaproteobacteria are present in much smaller quantities (Mikhailov et al., 2015). Therefore that diatom cultures were found to have taxa of bacteria that are predominant and minor in the lake. Bacteria phylotypes that are prevalent in diatom cultures can be rare in natural conditions. For example, Actinobacteria dominated in hypereutrophic Barra Bonita Reservoir (Brazil), while Alphaproteobacteria, Betaproteobacteria and Bacteroidetes were represented in small quantities. During co-culturing of axenic culture of Aulacoseira granulata (Ehrenberg) Simonsen diatom and natural inoculum, the dominant taxa were Alphaproteobacteria, Betaproteobacteria and Bacteroidetes, while the number of Actinobacteria declined significantly (Bagatini et al., 2014). Proteobacteria and Bacteroidetes are the main phyla of heterotrophic bacteria associated with diatoms. Within these phyla, such species as Sulfitobacter, Roseobacter, Alteromonas and Flavobacterium are most

frequently found in associations with diatoms (Grossart et al., 2005; Sapp et al., 2007a; Sapp et al., 2007b; Amin et al., 2012).

Therefore, in cultures Baikal diatoms have associations with bacteria that are found in bacterial communities in the photic layer of the lake. The increase in number of diatoms in cultures indicates that bacteria do not have a negative impact on them. Algal-bacterial associations represent a sustainable form of coexistence benefiting both partners.

Acknowledgement

We thank M.V. Usoltseva (PhD, Biology) for the help in determining species of diatoms. The study was performed using microscopes of the Instrument Center "Electron Microscopy" a subsidiary of "Ultramicroanalysis" LIN SB RAS. This work was supported by the Federal Agency of Scientific Organizations (FASO) of Russia under the subject No. 0345-20160001 (microscopy) and the subject No. 0345-2016-0005 (sequencing).

References

Amin, S.A., Parker, M.S., Armbrust, E.V. (2012). Interactions between diatoms and bacteria. Microbiology and Molecular Biology reviews, 76, 667-684.

Armbrust, E.V. (2009). The life of diatoms in the world's oceans. Nature, 459, 185-192.

Azam, F., Malfatti, F. (2007). Microbial structuring of marine ecosystems. Nature Reviews Microbiology, 5, 782-791.

Bagatini, I.L., Eiler, A., Bertilsson, S., Klaveness, D., Tessarolli, L.P., Vieira, A.A.H. (2014). Host-specificity and dynamics in bacterial communities associated with bloom-forming freshwater phytoplankton. PloS ONE, 9(1), e85950.

Bruckner, C.G., Bahulikar, R., Rahalkar, M., Schink, B., Kroth, P. (2008). Bacteria associated with benthic diatoms from Lake Constance: phylogeny and influences on diatom growth and secretion of extracellular polymeric substances. Applied and Environmental Microbiology, 74(24), 7740-7749.

Buchan, A., LeCleir, G.R., Gulvik, C.A., González, J.M. (2014). Master recyclers: features and functions of bacteria associated with phytoplankton blooms. Nature Reviews Microbiology, 12, 686-698.

Cole, J.J. (1982). Interactions between bacteria and algae in aquatic ecosystems. Annual Review of Ecology and Systematics, 13, 291-314.

Croft, M.T., Lawrence, A.D., Raux-Deery, E., Warren, M.J., Smith, A.G. (2005). Algae acquire vitamin B12 through a symbiotic relationship with bacteria. Nature, 438, 90-93.

Denisova, L.Y., Bel'kova, N.L., Tulokhonov, I.I., Zaichikov, E.F. (1999). Bacterial diversity at various depths in the southern part of Lake Baikal as revealed by 16S rDNA sequencing. Microbiology, 68(4), 475-483.

Gardes, A., Iversen, M.H., Grossart, H.P., Passow, U., Ulrich, M.S. (2011). Diatom-associated bacteria are required for aggregation of Thalassiosira weissflogii. The ISME Journal, 5, 436-445.

Grossart, H.-P., Levold, F., Allgaier, M., Simon, M., Brinkhoff, T. (2005). Marine diatom species harbour distinct bacterial communities. Environmental Microbiology, 7(6), 860-873.

Guannel, M.L., Horner-Devine, M.C., Rocap, G. (2011). Bacterial community composition differs with species and toxigenicity of the diatom Pseudo-nitzschia. Aquatic Microbial Ecology, 64, 117-133.

Inoue, H., Nojima, H., Okayama, H. (1990). High efficiency transformation of Escherichia coli with plasmids. Gene, 96(1), 23-28.

Marmur, J. (1961). A procedure for the isolation of deoxyribonucleic acid from micro-organisms. Journal of Molecular Biology, 3(2), 208-218.

Mikhailov, I.S., Zakharova, Y.R., Galachyants, Y.P., Usoltseva, M.V., Petrova, D.P., Sakirko, M.V., Likhoshway, E.V., Grachev, M.A. (2015). Similarity of structure of taxonomic bacterial communities in the photic layer of Lake Baikal's three basins differing in spring phytoplankton composition and abundance. Doklady Biochemistry Biophysics, 465, 413-419.

Mila, K.S., Adrien, V., Carine, P., Sophie, F.S., Laura, P., Pierre, H., Gérald, G., Yizhi, Z., Jean-François, S., Jean-Michel, C., Guillaume, B. Brigitte, G. (2018). Exploring the microbiome of the "star" freshwater diatom Asterionella formosa in a laboratory context. Environmental microbiology.

Popovskaya, G.I., Usol'tseva, M.V., Domysheva, V.M., Sakirko, M.V., Blinov, V.V., Khodzher, T.V. (2015). The spring phytoplankton in the pelagic zone of Lake Baikal during 2007-2011. Geography and Natural Resources, 36(3), 253-262

Porter, K.G., Feig, Y.S. (1980). The use of DAPI for identifying and counting aquatic microflora. Limnology and Oceanography, 25(5), 943-948.

Riemann, L., Steward, G.F., Azam, F. (2000). Dynamics of bacterial community composition and activity during a mesocosm diatom bloom. Applied and Environmental Microbiology, 66(2), 578-587.

Safonova, T.A., Aslamov, I.A., Basharina, T.N., Chenski, A.G., Vereschagin, A.L., Glyzina, O.Y., Grachev, M.A. (2007). Cultivation and automatic counting of diatom algae cells in multi-well plastic plates. Diatom Research, 22(1), 189-195.

Sapp, M., Schwaderer, A.S., Wiltshire, K.H., Hoppe, H.-G., Gerdts, G., Wichels, A. (2007a). Species-specific bacterial communities in the phycosphere of microalgae? Microbial Ecology, 53, 683-699.

Sapp, M., Wichels, A., Gerdts, G. (2007b). Impacts of cultivation of marine diatoms on the associated bacterial community. Applied and Environmental Microbiology, 73(9), 3117-3120.

Schäfer, H., Abbas B., Witte H., Muyzer, G. (2002). Genetic diversity of 'satellite' bacteria present in cultures of marine diatoms. FEMS Microbiology Ecology, 42, 25-35.

Seymour, J.R., Amin, S.A., Raina, J.-B., Stocker, R. (2017). Zooming in on the phycosphere: the ecological interface for phytoplankton-bacteria relationships. Nature microbiology, 2(7), 17065.

Sison-Mangus, M.P., Jiang, S., Tran, K.N., Kudela, R.M. (2014). Host-specific adaptation governs the interaction of the marine diatom, Pseudo-nitzschia and their microbiota. The ISME Journal, 8, 63-76.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Zakharova, Y.R., Adel'shin, R.V., Parfenova, V.V., Bedoshvili, Y.D., Likhoshway, Y.V. (2010). Taxonomic characterization of the microorganisms associated with the cultivable diatom Synedra acus from Lake Baikal. Microbiology, 79(5), 679-687.

Citation:

Mikhailov, I.S., Zakharova, Y.R., Volokitina, N.A., Petrova, D.P., Likhoshway, Y.V. (2018). Bacteria associated with planktonic diatoms from Lake Baikal. Acta Biologica Sibirica, 4 (4), 89-94. Submitted: 18.09.2018. Accepted: 03.11.2018 CRHsref http://dx.doi.org/10.14258/abs.v4.i4.4880

© 2018 by the authors. Submitted for possible open access publication under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).

i Надоели баннеры? Вы всегда можете отключить рекламу.