CC BY
15
Assessment of the relationship of Gln 551Arg polymorphism of a-chain receptor of gene interleukin-4 (IL4RA).
3) need for self-restriction in use of alcohol, coffee, strong tea, smoking, and difficulties in realization of usual rest, housework, sport activities and hobbies — in 18 patients (55%);
4) dizziness, difficulty in breathing, general weakness, fatigue, cardialgia — in 14 patients (43%).
The average QOL before a surgical treatment of patients with non-ischemic ventricular arrhythmia amounted to 14.02+0.95 points, what corresponds to a high quality of life. Two months after the surgery we revealed a significant decrease in the number offactors, which contribute to decrease in quality of life. The total quality-of-life in-
dicator in patients with non-ischemic ventricular arrhythmia was 6.1+2.58 points (p<0.05). The main factors of quality-of-life improvement were upturn of mood, disappearance of anxiety and depressive symptoms, lack of dietary restrictions. The considerable dynamics of quality of life after 6 months (3,98±2.56 points) was not observed in comparison with an average quality-of-life indicator after 2 months.
Conclusion: Thus, analysis of dynamics of quality-of-life parameters confirms that already 2 months after RFA there is a growth of indicators of both physical and psycho-emotional health. A complete physical health restoration is observed after 6 months.
References:
1. 2015 ESC Guidelines for the management of patients with ventricular arrhythmias and the prevention of sudden cardiac death The Task Force for the Management of Patients with Ventricular Arrhythmias and the Prevention of Sudden Cardiac Death of the European Society of Cardiology (ESC) The disclosure forms of all experts involved in the development of these guidelines are available on the ESC website URL: http://www.escardio.org/guidelines.
2. Курбанов Р. Д. Желудочковые нарушения ритма сердца. - Ташкент - 2012.
3. United Nations Economic Commission for Europe. UNECE statistical database. Available at URL: http://w3.unece.org/pxweb
4. Jouven X., Desnos M., Guerot C., Ducimetiere P. Predicting sudden death in the population: the Paris Prospective Study I. Circulation - 1999; - 99: - 1978-1983.
5. Жаринов О.И, Куц В. О. Диагностика и лечение экстрасистолической аритмии//Медицина свггу. - 2007. - № 5. - С. 312-323.
6. Кабаев У Т. Непосредственные результаты катетерного лечения желудочковых-фасцикулярных тахикардий: научное издание/У Т. Кабаев, Т. К. Есенов//Кардиология Узбекистана. - Ташкент, - 2010. - N 2-3. - C. 339 (Шифр К 9/2010/2-3).
7. Соколов С. Аллапинин и современные подходы к лечению нарушений ритма сердца: научное из-дание/С. Соколов//Врач. -М., - 2012. - № 4. - C. 55-59.
DOI: http://dx.doi.org/10.20534/ESR-16-11.12-73-75
Muminova Sevara Rustamovna, Specialized Scientific practical Medical Center Dermatology and Venereology of Republic of Uzbekistan.
E-mail: [email protected]
Assessment of the relationship of Gln 551Arg polymorphism of a-chain receptor of gene interleukin-4 (IL4RA) with atopic dermatitis in Uzbekistan
Abstract: The article presents the data of molecular-genetic study of polymorphism Gln551Arg IL4RA gene in patients with atopic dermatitis. As a result of the PCR analysis is installed genetic significant association of this marker with the development of atopic dermatitis.
Keywords: atopic dermatitis, atopy, IL4RA gene, the SNP, polymorphisms Gln551Arg.
Introduction.
Recent years there is the role of cytokine in atopic dermatitis (AD) clinical implications nascency exhaustively covered. Various researchers have made investigations on polymorphism association of allelic variant of a cytokine gene with atopic dermatitis. There have been positive associations [1, 6, 7], as well as absence of positive associations [4, 5] revealed. Cytokine gene receptors play an important role in the development of atopic diseases clinical progression. In this regard, it is reasonable to analyze the allelic polymorphism of cytokines genes and their receptors directly involved in the progression of atopic dermatitis. a-chain of receptor of cytokine interleukin-4-gene (IL4RA) plays an important role in the progression of atopic diseases. Various polymorphisms in the gene IL4RA have been described. In particular: -33C> TIL4 and 576Q> R of IL4RA gene were firmly associated with atopy and bronchial asthma [2; 3].
The aim of research: To optimize oligoprimers system operation for testing IL4RA gene's Gln551Arg polymorphism and study
contribution (affect) of this marker to AD progression.
Materials and methods. Materials for our research were the DNA samples isolated (taken) from the peripheral blood ofpatients with AD and apparently healthy donors — individuals without any signs of atopic diseases. Total studied Gln551 and Arg551 alleles were 150 (100 chromosomes of patients and 50 chromosomes of healthy individuals). DNA purification was carried out by standard methods with some modifications. Amplification of polymorphic (multi-form) loci was performed using polymerase chain reaction on a programmable thermal cycler of «Applied Biosysteems» company (USA). The specificity of the synthesized fragment and the quantity of amplifier was checked by electrophoresis' technique with 2% agarose gel and then conducted hydrolytic cleavage of the resulting fragment with the restrictase — Avail. Restriction of PCR product was performed at + 37 °C during 12 hours, as indicated in the manufacturer's recommendations. Products DNA fragment amplifiers and amplitude of restriction was separated with 2-3%
Section 7. Medical science
agarose gel and was assessed after staining with ethidium bromide in the transmitted (resolving) UV light. Statistical analysis of the results was carried out using «OpenEpi 2009, Version 2.3» statistical software package. The frequency of allele and genotype variants (f) was calculated by the formula: f = n/2N and f = n/N
Results and discussion: The initial stage of our work was the selection and synthesis of oligoprimer to identify polymorphisms Gln551Arg of IL4RA gene. Molecular genetic testing
(PCR) of the genetic marker was conducted in the Laboratory of Molecular Medicine and Cell Technologies of Scientific-research institute of hematology and blood transfusion of Ministry of Health of Republic of Uzbekistan. Information about gene pathways and primer's structure was prepared taking into account the original literary source and in GeneBank. A characteristic of genetic marker and synthesized oligoprimer sequence is shown in Table 1.
Table 1. - The sequence of oligoprimers used in PCR
Gene, localization Polymorphism Structure of used oligoprimers Allelic variants after restriction
IL4RA 16p12.1 Gln551Arg CCCCCACCACCAGTGGCTAC CCAGGAATGAGGTCTTGGAA Gln551 (125+9 n. h.) Arg551 (116 n. h.)
+ K 1 2 3 4 M
Figure 1. Electrofhoretic detection of polymorphisms Gln551Arg of IL4RA gene after restriction +K - control; 1 and 3 - normal genotypes; 2 - heterozygous genotype; 4 - mutant homozygouse genotype, M - marker of the fragments sizes.
Table 2. - Allelic variants of polymorphism Gln551Arg of IL4RA gene after amplification and restriction
PCR products of IL-4R4 gene. Before restriction Allelic variants after restriction with Avail restrictase.
Normal 125 bps 125 bps
Heterozygous 116 bps 125 bps + 116 bps
Mutant homozygous 116 bps + 9 bps
Interpretation of the findings is shown in Table. 1 and Fig.1. As seen, as a result of the PCR analysis the Arg/Arg mutant allele marker was synthesized as a fragment with a size of 116 bp. After restriction there is formation of 9 bps + 116 bps fragments observed at patients with normal genotype of Gln/Gln, But there is no 125 fragment bps, while heterozygous carriers have an amplification of all three fragments (125 bps and 116 + 9 bps). In a purpose to analyze the distribution of frequencies of alleles and genotypes of Gln551Arg of IL4RARA gene in combined sample of AD patients and the control group, there was testing of the test system conducted (Table 2).When analyzing the distribution of
alleles and Gln551Arg polymorphism's genotype of IL4RA gene was identified a significant prevalence of the mutant allele frequency — Arg551 in patients with AD compared with a group of conditionally healthy donors. There was Arg551mutant allele detected at the main and control groups study in 42/100 (42%) and 14/50 (28%) cases, respectively. The frequency of Gln551wild allele and in the groups was 58/100 (58%) and 36/50 (72%), respectively. In this case, estimated risk probability of (OR) AD progression in carriers of this polymorphism was 1.8 points higher than in carriers of Gln551wild alleles. The findings are statistically valid (X 2=2.79; P=0.09; OR=1.8; 95%CI 0.89-3.88) (Tabl. 3).
Table 3. - Frequency of alleles and genotypes of polymorphism Gln551Arg of IL4RA in patients with AD and healthy donors (control group)
Groups n« Frequency of alleles Frequency of genotypes
Gln551 Arg551 Gln/Gln Gln/Arg Arg/Arg
n % n % n % n % n %
Patients with AD. 50 (100) 58 58 42 42 14 28 30 60 6 12
Healthy donors. 25 (50) 36 72 14 28 13 52 10 40 2 8
Comparative analysis of genotypes distribution showed that the proportion of persons with hetero + homozygous mutant genotype of «Gln/Arg and Arg/Arg» among patients and healthy donors was 36/100 (36%) versus 12/50 (24%), respectively. The calculated probability of developing AD among carriers of these
genotypes is 4 times significantly higher compared with the control group (X 2=4.17; P=0.04; OR=2.79; 95%CI 1.03-7.56). Significant (firm) predominance of the number of carriers of mutant alleles and genotypes in patients may indicate a pathogenetic connection, is the association between the Gln551Arg polymorphism of IL4RA.
Experience and comparative analysis of application results of regulated subclavian-pulmonary artery anastomosis.
gene and formation ofAD. The point to be emphasized is that, when comparing Gln/Gln healthy genotype in patients with AD as compared to healthy individuals, it was found more than 5-fold valid reduction in the frequency of occurrence ofhealthy genotypes (OR = 0.54; 95% CI 0.26-1.12). These data confirm the validity of our results, showing that allele IL4RA- Gln551 is a marker of reduced risk of AD progression in patients. Thus, in the result of the study on IL4RARA gene's Gln551Arg polymorphism was found that the
DNA locus associated with AD in Uzbekistan. In the initial stages of defining diagnosis on atopic dermatitis it is recommended to conduct genotyping assay of studied gene polymorphisms of cytokines and their receptors for the establishment of further variants of its clinical course and nasty disease-forms-susceptibility. Treatment of atopic dermatitis is recommended to conduct taking into account the genetic data on the dominating nature of its clinical course and evidence of immune status disorders.
References:
1. Sandford A. J., Chagani T., Zhu S., Weir T. D., Bai T. R., Spinelli JJ, et al.Polymorphisms in the IL4, IL4RA, and FCERIB genes and asthma severity. J Allergy Clin Immunol. - 2000. - 106:135-140.
2. Kauppi P., Lindblad-Toh K., Sevon P., Toivonen H. T., Rioux J. D., Villapakkam A., et al. A second-generation association study of the 5q31 cytokine gene cluster and the interleukin-4 receptor in asthma. Genomics - 2001, - 77:35-42.
3. Wjst, Kruse S., Illig T., Deichmann K.: Asthma and IL-4 receptor alpha gene variants. Eur J. Immunogenet - 2002, - 29:263-268.
4. Bottini N., Borgiani P., Otsu A., Saccucci P., Stefanini L., Greco E., et al. IL-4 receptor alpha chain genetic polymorphism and total IgE levels in the English population: two-locus haplotypes are more informative than individual SNPs. Clin Genet - 2002, - 61:288-292.
5. Cui T., Wang L., Wu J., Hu L., Xie J. Polymorphisms of IL-4, IL-4R alpha, and AICDA genes in adult allergic asthma. J Huazhong Univ Sci Technolog Med Sci - 2003, - 23:134-137.
DOI: http://dx.doi.org/10.20534/ESR-16-11.12-75-78
Nazirov Feruz Gafurovich, doctor of medical sciences, Republican Specialized Center of Surgery named after ac. V. Vakhidov, Tashkent, Uzbekistan Ibadov Ravshan Alievich, doctor of medical sciences Republican Specialized Center of Surgery named after ac. V. Vakhidov, Tashkent, Uzbekistan Abralov Hakimjon Kabuljonovich, doctor of medical sciences, Republican Specialized Center of Surgery named after ac. V. Vakhidov, Tashkent, Uzbekistan Julamanova Dono Ikramovna, doctor, Republican Specialized Center of Surgery named after ac. V. Vakhidov, Tashkent, Uzbekistan Ibragimov Sardor Khamdamovich, doctor, Republican Specialized Center of Surgery named after academician V. Vakhidov, Tashkent, Uzbekistan Republican Specialized Center of Surgery named after academician V. Vakhidov, Tashkent, Uzbekistan)
E- mail: [email protected]
Experience and comparative analysis of application results of regulated subclavian-pulmonary artery anastomosis in patients with tetralogy of Fallot
Abstract: The article summed up the consolidated analysis of close results of classical subclavian-pulmonary artery anastomosis (Blalock-Taussig shunt) and modified via a vascular Fogarty catheter for patients with Tetralogy of Fallot. It was noted that the major complications in the early postoperative period are hypervolemia of pulmonary circulation, postoperative bleeding and the development of acute heart failure. It is proved that the active application of the author's method for managing cardiopulmonary hemodynamics using Fogarty catheter allows significantly reduce the mortality rate of 1.6% and avoid anastomosis hyperfunction and the development of cardio-pulmonary insufficiency.
Keywords: Tetralogy of Fallot subclavian-pulmonary artery anastomosis hypervolemia of pulmonary circulation.
