Antimicrobial Resistance and Virulence Genes of Campylobacter jejuni Isolates from Diarrheic Sheep Текст научной статьи по специальности «Биологические науки»

2022, Scienceline Publication

Worlds Veterinary Journal

World Vet J, 12(2): 186-196, June 25, 2022

DOI: https://dx.doi.org/10.54203/scil.2022.wvj24

Antimicrobial Resistance and Virulence Genes of Campylobacter jejuni Isolates from Diarrheic Sheep

Amani Hafez

Department of Animal Health, Infectious Diseases Unit, Desert Research Center, Cairo, Egypt Corresponding author's Email: amani.hafez@yahoo.com

ABSTRACT

One of the important agents causing gastroenteritis worldwide is Campylobacter jejuni (C. jejuni). The current study aimed to detect five virulence genes (flaA, virB11, ciaB, iam, and dnaJ) and two antibiotic resistance genes (gyrA and tetO) in C. jejuni obtained from sheep stool. The virulence genes were detected by PCR in 64 C. jejuni strains. The phenotypic resistance to five selected antibiotics (Ciprofloxacin, Erythromycin, Gentamycin, Streptomycin, and Tetracycline) was screened with the microdilution method. The isolates with antibiograms were tested for detection of gyrA and tetO genes via PCR using specific primers. The virulence genes flaA (32%) and dnaJ (29%) had the highest prevalence. The tested isolates of C. jejuni revealed high resistance to both quinolone (68.3%) and tetracycline groups (48.4%) with an increased prevalence of antibiotic resistance of gyrA and tetO genes. Gentamycin and erythromycin offered better alternative drugs for the treatment of campylobacteriosis. To generalize the findings, extensive profiling that involves more virulence genes is required in several strains of Campylobacter.

Keywords: Antibiotic resistance, Campylobacter jejuni, Sheep, Virulence genes INTRODUCTION

Campylobacter is a zoonotic infection that causes foodborne diarrhea in people all over the world (Sheppard and Maiden, 2015; Babazadeh and Ranjbar, 2022). The most common Campylobacter species that cause different infections in sheep, including enteritis, colitis, and reproductive disorders, are Campylobacter jejuni (C. jejuni), Campylobacter fetus subspecies fetus, and Campylobacter coli (C. coli, ilhan et al., 2021). Sheep breeding represents a large and essential part of animal husbandry in Egypt, and consequently, diarrhea caused by Campylobacter species can influence the production characteristics in Egypt.

Campylobacter species are globally found in soil, water, and food, so they can be in the gall bladder and the intestine without any clinical signs as a result of contact with contaminated sources, such as animal stool, genital excretions, and aborted tissues (Indykiewicz et al., 2021). Wild and domestic animals have been identified as potential carriers of this bacteria (Rukambile et al., 2019). Campylobacter species are present in the gut of many animal species with interspecies transmission risk. Campylobacter species, such as C. jejuni and C. coli, can be isolated from different farm animals, including cattle, sheep, and goats. Comparing sheep and goat breeding farms, sheep are more potential carrier of C. jejuni as a contaminant (Pao, et al., 2014).

Healthy sheep act as reservoirs where the bacteria are intermittently excreted in their feces, particularly in stressful situations (birth, weaning, and changes in feeding systems) although their activity is rapidly inactivated on pastureland at high temperatures. It is worth noting that the presence of wild birds in sheep farms raises the potentiality of lamb infection, especially at very young ages (Sproston et al., 2010).

The gene expression for motility, colonization, invasion, and excretion of toxins is believed to be an essential cause of disease progression (Dasti et al., 2010). Bacterial cell movement involving the coordination of many genes (such as flaA) is responsible for the bacteria passage through the gastrointestinal environment (Park, 2002) where Campylobacter delivers many cell surface proteins encoded by several genes (such as virB11, ciaB, and iam) that support adhesion and invasion of enterocytes (Dasti, et al., 2010). Furthermore, C. jejuni can produce defense factors such as cytokines and enzymes like superoxide dismutase to get rid of superoxide radicals as a defense mechanism against oxidative damage.

Campylobacteriosis is considered a self-limiting disease. In acute cases, macrolides Macrolides, fluoroquinolones, and aminoglycosides are classified as critically important antimicrobials, while tetracycline is considered a highly important antimicrobial (World Health Organisation, 2018). Unfortunately, nowadays there is a growing trend of antibiotic resistance among Campylobacter species mainly due to misuse of antibiotics (Wieczorek et al., 2017). Therefore, the present study was designed to find the prevalence of virulence and antimicrobial resistance genes of C. jejuni isolated from sheep suffering from diarrhea.

ISSN 2322-4568

> R i.

a a : : 2 C

0

1 —

G

HH

N A L

A R

T

HH

C L

E

186

MATERIALS AND METHODS

Ethical approval

Ethical approval was not necessary for this study; however, samples were collected as per standard sample collection procedure and consent was taken from the animal owners with their signature using a prescribed consent form (License No. AHRI 42102017), according to local Egyptian laws.

Collection of Campylobacter jejuni isolates

A total of 262 fecal samples were collected from sheep aged 2-3 years (Barki sheep ewes and Rams) suffering from different levels of watery diarrhea. The clinical signs included diarrhea, decreased appetite, and vomiting with or without fever. The feces were usually watery or bile streaked with mucus and sometimes blood. The animals were obtained from different sheep herds on the Northwest coast of Egypt. All collected samples were transferred in sterile plastic bags and refrigerated up to the time of investigation (within 24 hours after collection). Campylobacter isolation was performed by the culture method following a study by Hagos et al. (2021). The strains were grown on blood-based agar (BD BBLTM, United States) with 5% defibrinated sheep blood and incubated at 42°C for 48 hours under microaerobic conditions (85% nitrogen, 10% carbon dioxide, and 5% oxygen). The strains were confirmed as C. jejuni or C. coli using Lior's biotyping scheme (Lior, 1984) and the PCR technique based on the highly conserved gene glyA (serine hydroxymethyltransferase, Quino et al., 2022).

DNA extraction and PCR

All Campylobacter isolates were subjected to DNA extraction following the instructions of QIAamp DNA Mini kit (Qiagen, Germany, Catalogue no.51504) with slight modifications. Briefly, 10 ^l of proteinase K and 200 ^l of lysis buffer were added to 200 ^l of the sample DNA and incubated at 56°C for 10 minutes. Then, 200 ^l of absolute ethyl alcohol was added to the lysate. The sample was washed and centrifuged. Nucleic acid was obtained in 100 ^l of elution buffer. Then, the PCR technique was carried out for thermophilic Campylobacter species (C. jejuni and C. coli, Iraola et al., 2012).

Investigation of virulence genes

Campylobacter isolates were examined for the virulence genes of flaA (responsible for motility) and virBll (for adhesion and colonization). In Addition, the gene markers of ciaB and iam (for the Campylobacter invasiveness) were also amplified. The primer sets targeting the 23S rRNA gene of Campylobacter species, and the virulence genes of flaA, dnaJ, virBII, iam, and ciaB were used and specific amplified products were detected at 217, 177, 494, 518, and 527 bp, respectively. The amplicons were detected using capillary electrophoresis. Primer sequences, target genes, amplicon sizes, and cycling conditions are illustrated in Table 1. PCR conditions and techniques for all the above genes were based on a study by Datta et al. (2003).

Table 1. PCR primers used for Campylobacter detection and antimicrobial resistance genes

Targetgenes Primers sequences Amplified segment Reference

23S Rrna TATACCGGTAAGGAGTGCTGGAG ATCAATTAACCTTCGAGCACCG - 650 Wang et al. (2008)

FlaA TCCAAATCGGCGCAAGTTCA TCAGCCAAAGCTCCAAGTCC 217 Zheng et al. (2006)

DnaJ ATTGATTTTGCTGCGGGTAG ATCCGCAAAAGCTTCAAAAA - 177 Chansiripornchai and Sasipreeyajan (2009)

virBll TCTTGTGAGTTGCCTTACCCCTTTT CCTGCGTGTCCTGTGTTATTTACCC - 494 Datta et al. (2003)

Iam GCGCAAATATTATCACCC TTCACGACTACTACTATGCGG - 518 Wieczorek, (2011)

ciaB TGC GAG ATT TTT CGA GAA TG TGC CCG CCT TAG AAC TTA CA 527 Zheng et al. (2006)

tetO GGCGTTTTGTTTATGTGCG ATGGACAACCCGACAGAAGC 559 Gibreel et al. (2004)

gyrA GATGGTTTAAAGCCTGTTCAT CGCCATACCTACAGCTATACC - 423 Lindmark et al. (2004)

Antimicrobial resistance

Campylobacter jejuni isolates were evaluated for the resistance to selected antimicrobial agents with the microdilution method using microtitration plates. The five tested antimicrobial drugs are the most common ones used in the treatment of Campylobacter infections. Solutions of each tested antibiotic included streptomycin, ciprofloxacin, tetracycline, erythromycin, and gentamicin solutions (Table 2). Mueller Hinton broth with 2.5% lysed horse blood was prepared. The inoculated plates were incubated at 37°C for 48 hours in a microaerophilic atmosphere (the same conditions as above). The parameters for individual antibiotics, including interpretation criteria, were based on recommendations issued by the CLSI guidelines (McDermott et al., 2005). Quality control was done using a reference strain of C. jejuni (ATCC 33560). The detailed parameters for testing are shown in Table 2.

Investigation of antibiotic resistance genes

Once the identification was performed, the isolates were screened for the existence of resistance genes to quinolone, the Thr-86-lle mutations in the quinolone resistance-determining region (QRDR) of the gyrA gene in C. jejuni and the tetracycline resistance gene (tetO) were amplified and identified using PCR with two specific primer sets for amplification at 423 and 559 bp.

Sequence

PCR products were purified using QIAquick PCR Product extraction kit (Qiagen, Valencia). Bigdye Terminator V3.1 cycle sequencing kit (Perkin-Elmer) was used for the sequence reaction which was then purified using Centrisep spin column. DNA sequences were obtained by Applied Biosystems3130 Genetic Analyzer (HITACHI, Japan), a BLAST® analysis (Basic Local Alignment Search Tool) was initially performed to establish sequence identity to GenBank accessions (Altschul et al., 1990). The phylogenetic tree was created by the MegAlign module of LasergeneDNAStar version 12.1 (Thompson et al., 1994), and Phylogenetic analyses were done using maximum likelihood, neighbor-joining, and maximum parsimony in MEGA6 (Tamura et al., 2013).

RESULTS

Investigation of Campylobacter jejuni spacemen

A total of 262 samples from sheep feces (235 diarrhea and 27 non-diarrhea) yielded 64 C. jejuni strains (24.4%). Two C. jejuni strains were found in stool samples that appeared to be non-diarrheal, and 62 C. jejuni strains were found in clearly diarrheal stool samples.

Detection of antimicrobial susceptibility of Campylobacter jejuni isolates

Of the 5 antibiotics tested, the highest phenotypic resistance exhibited by C. jejuni from stool samples was against ciprofloxacin (68.3%), followed by tetracycline, streptomycin, gentamycin, and erythromycin as 48%, 4%, 27.5%, 6.3%, and 4.5%, respectively while complete susceptibility (100%) was detected against gentamycin (Table 2). The highest prevalence of resistant strains was against type 4 of antibiotics (24%) while resistance to type 5 was the least (5%, Figure 1).

Investigation of antibiotic resistance genes in Campylobacter jejuni

Following the detection of phenotypic resistance to the chosen antibiotics, the resistance of gyrA and tetO genes was detected using PCR. The tetO gene which is liable for tetracycline-resistant was detected at 595 bp while the gyrA gene which is responsible for the quinolone resistance was detected at 423 bp (Figure 2). A comparison of the presence of selected antibiotic resistance genes with the phenotypic resistance is shown in Table 3. As can be seen, the resistance in the evaluated genes is more common in isolates that showed phenotypical resistance.

Detection of virulence genes in Campylobacter jejuni isolates

A total of 24.4% of examined stool samples contained C. jejuni. The proportion of the virulence genes in C. jejuni isolates is displayed in Figure 3. The results revealed that the flaA gene (93%), which encodes the motility, is the most prevalent virulence gene in C. jejuni isolates followed by dnaJ encodes heat shock protein (ATPase activity), and ciaB; encodes invasion in 88% and 42%, respectively. Two genes of virBII and iam recorded the minimal frequency as 7.3% and 6.8%, respectively.

Investigation of phylogenetic relationship

Based on the analysis of 23S rRNA, dendrograms help to determine simmilarites and difference between the isolates when compared to the reference strains (Figure 5). The graphs illustrate that C. jejuni isolates differ significantly. According to present dendrogram, the 5 analyzed isolates (3, 4, 6, 7, and 11) are characterized by genetic variation (Figure 6). Strains 3, 4, and 6 are closely linked with a smaller degree of relatedness to strain 11, however, strain 7 has a lot of genetic diversity, compared to the other strains. 0K095294, 0K095295, 0K095296, 0K095297, and 0K095298 are the accession numbers of isolates 3, 4, 6, 7, and 11, respectively. However, all strains were similar to C. jejuni strains present in gene bank by 98.3-100% (Figure 6).

188

Table 2. Profiles of antimicrobial-resistant Campylobacter jejuni for different antibiotics

. Antibiotic dilution C.jejuni dilution Resistance in fecal

nti iotic (mg/L) (mg/L) isolates (%)

Ciprofloxacin 0.03-64 C5 683

Tetracycline 0.125-256 1 48.4

Streptomycin 0.25-512 4 27.5

Gentamycin 0.125-256 2 6.3

Erythromycin 0.25-512 4 4.5

Figure 1. Campylobacter jejuni with antimicrobial resistance

Table 3. Relationship between genotypic and phenotypic resistance to ciprofloxacin and tetracycline in Campylobacter

jejuni

Detection of the gyrA gene in Campylobacter jejuni isolates Detection of the tetO gene in Campylobacter

(%) jejuni isolates (%)

Cipro-R Cipro-S Tet-R Tet-S

78.3 35.5 43.6 21.7

Cipro-R: Isolate with phenotypic resistance to ciprofloxacin. Cipro-S: Isolate with phenotypic susceptibility to ciprofloxacin. Tet-R: Isolate with phenotypic resistance to tetracycline. Tet-S: Isolate with phenotypic susceptibility to tetracycline

A

tetO gene samples were positive at 559bp except sample at lane 1

B

gyrA gene all samples were positive at 177bp

Figure 2. Genotypic characterization of antimicrobial resistance in Campylobacter jejuni. A: Detection of tetO gene, B: Detection of gyrA gene.

189

Figure 3. Prevalence of virulence genes in Campylobacter jejuni from Barki sheep stool

A: flaA gene samples were positive (32%) at 217bp except sample at lanes 1, 2, 3, 4, 5, 6, 7, 8, 11, 12, 14, and 15

15 I 14 I 13 I 12 I 11 I 10 I 9 I 8 I P I L I 7 I 6 I 5 I 4 I 3 I 2 I 1 I N

B: virBIIgene samples were positive (15%) at 494 bp except sample at lanes 1, , 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 and 15

1000

518 bp Si

100

C: iam gene samples were positive (29%) at 518 bp except sample at lanes 1, 3, 4, 5, 6, 7, 8, 9, and 15

D: ciaB gene samples were positive (27%) at 518 bp except sample at lanes 5, 6, 7, 8, 13, 14, and 15

E: 23S rRNA samples were positive at 650 bp except sample at lanes 12 and 15

Figure 4. Detection of virulence genes and 23S rRNA of Campylobacter jejuni isolates from Barki sheep stool. A: Detection offlaA gene. B: Detection of virBII. C: Detection of iam gene. D: Detection of ciaB gene. E: Detection of 23S rRNA

190

Figure 5. Campylobacter jejuni phylogenetic relationship

Figure 6. Sequence distance of 5 Campylobacter jejuni isolates from Egypt, compared with 24 Campylobacter jejuni in the gene bank

DISCUSSION

The intermittent nature of Campylobacter infection explains why there are different reports on this type of infection and impeding the discovery of its source (Havelaar et al., 2013). It is established that poultry is the main source of human infection (Ranjbar and Babazadeh, 2017; Nur-Aziera-Aina et al., 2020), Campylobacter spp. is also highly prevalent in ruminants all over the world (Babazadeh and Ranjbar, 2022). There is growing data that the ruminants play a pivotal role in the spreading campylobacteriosis to humans as cattle and sheep are considered the second most important reservoir after broiler for the transmission of C. jejuni infection to humans (Roux et al., 2013).

0f 302 fecal samples from sheep in Shiraz, Iran, 67.8% were positive for the presence of Campylobacter species isolates showed high resistance to cephalothin (83%) and ciprofloxacin (67.7%, Khoshbakht et al., 2016). Regarding the

191

obtained results of the current study, there was no antibiotic that could trigger the sensitivity of all Campylobacter isolates. Fluoroquinolones are one of the recommended drugs for campylobacteriosis treatment. The Campylobacter strains resistant to ciprofloxacin were established in the late 1980s, indicating that the animals play a key role in generating and transmitting the resistant bacteria. At Present, C. jejuni resistance to fluoroquinolones is increasing worldwide which poses a threat to public health (Wieczorek, 2011). The current findings indicated that the treatment with fluoroquinolones has become inefficient as some Campylobacter strains are resistant to this class of antibiotics (Bolinger and Kathariou, 2017).

Antibiotic resistance was high against the ciprofloxacin (68.3%), and this is consistent with a previous prevalence report in South Africa where rates of Campylobacter resistance to fluoroquinolones have been reported between 14.8% and 51.3% (Kepner et al., 2003). These results show that Campylobacter resistance to fluoroquinolones can increase over the years. Therefore, constant monitoring is necessary as Campylobacter species can mutate (Luo et al., 2003).

High tetracycline resistance has been recognized globally. Modifications in media to test C. jejuni isolates from several countries in the European Union indicated a resistance of about 45% (Aleksic at al., 2021). In the present study, there was relatively higher tetracycline resistance (48.4%). The higher resistance of C. jejuni to the tetracycline group may be due to the overuse of this group of antibiotics as they are given to treat most infections in the veterinary field in Egypt (Schiaffino et al., 2018). The comparatively high co-resistance of some strains of C. jejuni to tetracycline and/or ciprofloxacin is also important due to their clinical significance in the treatment of severe cases of campylobacteriosis. Therefore, the best solution is to use other groups of antibiotics, such as aminoglycosides and macrolides, and to use them only in severe cases where mild forms of Campylobacter should be considered a self-limiting infection.

In the current study, C. jejuni strains from sheep stool were examined for resistance to ciprofloxacin. An increase in C. jejuni resistance to ciprofloxacin was detected (68.3%), which was similar to previous studies in Poland (Wieczorek and Osek, 2013) and other EU countries (EFSA, 2014a; EFSA, 2014b). It must be taken into consideration that the prevalence of resistance can change significantly over time (p < 0.05), amino acids substitution is the main cause of fluoroquinolones resistance in Campylobacter (Wieczorek and Osek, 2013). The most common silent mutations in the quinolone resistance determination region of gyrA are presented in Table 3. Thr86Ile substitution in the gyrase reveals high-level resistance to this antibiotic group (Payot et al., 2006). In agreement and confirmation of this and other similar studies (Duarte et al., 2014), the Thr86Ile substitution was the most detected amino acid change. On the other hand, further mechanisms of resistance, such as alteration in the outer membrane permeability and efflux systems, have been reported (Charvalos et al., 1996) and these may explain the detection of phenotypic resistance without amino acid changes in gyrA in the tested strains.

It is noteworthy that the silent mutation in Campylobacter species was reported in both resistant and sensitive strains to ciprofloxacin and a high number of combinations of transitions and mutations may exist. The current work confirmed these results, and some silent mutations that are frequently observed at Ser-119 ^ His, Glu-131 ^ Glu, and Ser-157 ^ Ser correspond to mutations detected in Campylobacter strains isolated in Finland and Brazil (Hakanen et al., 2002).

In the present study, gentamycin and erythromycin exhibited a lower resistance at 6.3% and 4.5%, respectively. Therefore, they offered a better alternative drug for the treatment of campylobacteriosis. It is interesting to note that when using macrolides (erythromycin) in treatment, attention should be devoted to testing resistance to erythromycin.

The mechanism through which the Campylobacter species cause enteritis is a complex process depending on many factors where specific genes are implicated in all virulence stages of adhesion, colonization, invasion, and toxin production (Bolton, 2015). To evaluate the pathogenicity of the Campylobacter isolates in the present study, the existence of five essential genes coding the virulence factors, such as the motility (flaA), invasive (iam and ciaB), ATPase activity (dnaJ), and adhesion (virBII) genes in the isolates have been investigated.

The first step in pathogenesis is intestinal colonization. This requires the motility of the microbe into the mucus layer that covers the enterocytes. Campylobacter motility is granted by the polar flagella in 'cork-screw' shape movement allowing them to effectively penetrate and overcome this mucus barrier (Haag et al., 2012). The flagellin protein encoded by the flaA gene is considered the most virulence factor that has been studied and characterized in Campylobacter species (Hermans et al., 2011).

The higher prevalence offlaA gene (93%) among the Campylobacter isolates in the present study is nearly consistent with an Egyptian study by Abd El-Hamid et al. (2019), where the flaA gene was detected in all isolates (100%). On the other hand, the flaA gene prevalence was inconsistent with other published studies where the prevalence was 87.5%. This discrepancy can be attributed to the identification of a higher number of virulence genes.

The second step in pathogenesis is adhesion. Gene liable for the adhesion of C. jejuni is virBII that is responsible for producing the IV secretory system protein and is located on the pVir plasmid. It has been reported that strains that show a mutation in the virB11 sequence have a much lower ability in adhesion and penetration when compared with the original strains, and hence, lower pathogenicity (Bacon et al., 2000). In the present study, the gene was detected in 7.3% of the isolates, which was in accordance with the previous work with a prevalence rate of 9.7% (Abd El-Hamid et al.,

2019). One of the most crucial genes for adhesion and invasion is the ciaB gene (Campylobacter invasive antigen B). The ciaB gene has been reported to be involved in the invasion of the enterocytes and plays a significant role in colonization (O Croinin and Backert, 2012). and was detected in 42% of the tested strains. The low frequency of the ciaB gene in the clinical isolates disagrees with other previously published data reporting 100% detection of this virulence gene in their isolates (Biswas et al., 2011). Therefore, the results obtained from the current study confirm the claim that not all Campylobacter strains having the ciaB gene can adhere to or invade enterocytes. This indicates the presence of other factors than those coded by the ciaB gene on Campylobacter surfaces, and this perception is confirmed by previous studies (Bolton, 2015). In accordance with the current study, a lower prevalence of ciaB (76.4%) has been measured in Qatar, while the prevalence range of 52.4-71.4% was reported in Asia and 51.5-66.7% in the Arabian Peninsula (Carvalho et al., 2001).

Another invasion-associated marker (iam) gene is one of the most essential factors for the invasion of the host cell and was detected in the current study with a prevalence of 6.8%. This prevalence is considered too low, compared to earlier studies where the prevalence reaches 85%. This divergence may be due to the scarcity of iam in the isolated Campylobacter strains and therefore, its role in the Campylobacter pathogenesis should be further assessed (Wieczorek et al., 2018).

The bacterial response to the thermal stress is mainly via the expression of heat shock proteins. These proteins play an important role in thermotolerance. They act as chaperones to improve the folding of cellular protein, and degradation of possibly deleterious misfolded proteins. Several heat shock proteins were identified in the C. jejuni, including DnaJ, DnaK, GroESL, and ClpB genes. However, the most important one is dnaJ gene, as any mutation in C. jejuni unable the bacteria to colonize the enterocytes (Konkel et al., 1998). In the present work, dnaJ gene was detected in 88% of all tested sheep fecal samples. Relatively similar results were reported by many authors (Redondo et al., 2019) who verified the importance of dnaJ gene for colonization.

CONCLUSION

Campylobacteriosis control and prevention in sheep requires an understanding of the transmission routes, antibiogram, and virulence abilities of the isolates. The results gained in the current study demonstrated the presence of Campylobacter isolates and different degrees of resistance. The prevalence of the resistance may mainly be attributed to the misuse of antibiotics used for the treatment of Campylobacter infections, such as ciprofloxacin and tetracycline. Although the isolated strains carried both virulence and antibiotic resistance genes, continuous monitoring of the prevalence of Campylobacter strains and identification of associated genes for virulence and antibiotic resistance is urgently required to update effective treatment schedules for Campylobacter infection.

Finally, it is worth mentioning that the presence of virulence genes is an important predictor of strain virulence although it may not exactly predict the virulence of the isolated Campylobacter strains. Additionally, negative PCR results do not mean that there is no gene but could be attributed to a different primer binding site sequence or the presence of another gene with a similar function. To generalize the findings, extensive profiling that includes more virulence genes is required for other strains of Campylobacter.

DECLARATIONS

Acknowledgments

The author would like to express their appreciation for the scientific assistance provided by the Desert Research Center (DRC) in Cairo, Egypt. This article did not receive any financial support.

Author's contribution

Amani Hafez performs collection, preparation, processing, and analysis of samples, isolation of bacteria, data acquisition, writing, preparation, and revision of the manuscript. The author has read and approved the data and final draft of the manuscript.

Competing interests

The author has declared no conflict of interest.

Ethical consideration

The author checked the manuscript for ethical issues, such as plagiarism, consent to publish, misconduct, data fabrication and/or falsification, double publishing and/or submission, and redundancy.

193

REFERENCES

Abd El-Hamid MI, Abd El-Aziz NK, Samir M, El-Naenaeey EY, Abo Remela EM, Mosbah RA, and Bendary MM (2019). Genetic diversity of Campylobacter jejuni isolated from avian and human sources in Egypt. Frontiers in Microbiology, 10: 2353. DOI: https://www.doi.org/10.3389/fmicb.2019.02353

Aleksic E, MiljkoviC-SelimoviC B, Tambur Z, Aleksic N, Biocanin V, and Avramov S (2021). Resistance to antibiotics in thermophilic campylobacters. Frontiers in Medicine. 8: 763434. DOI: https://doi.org/10.3389/fmed.2021.763434

Altschul SF, Gish W, Miller W, Myers EW, and Lipmanl DJ (1990). Basic Local Alignment Search Tool. Journal of Molecular Biology, 215: 403-410. DOI: https://www. doi.org10.14202/vetworld.2019. 664-670

Babazadeh D and Ranjbar R (2022). Campylobacter species in the Middle East. Journal of Veterinary Physiology and Pathology. 2022; 1(1): 1-9. Available at: https://jvpp.rovedar.com/article 120791.html

Bacon DJ, Alm RA, Burr DH, Hu L, Kopecko DJ, Ewing CP, Trust TJ, and Guerry P (2000). Involvement of a plasmid in virulence of Campylobacter jejuni 81-176. Infection and Immunity Journal, 68(8): 4384-4390. DOI: https://www.doi.org/10.1128/IAI.68.8.4384-4390.2000

Biswas D, Hannon SJ, Townsend HGG, Potter A, and Allan BJ (2011). Genes coding for virulence determinants of Campylobacter jejuni in human clinical and cattle isolates from Alberta, Canada, and their potential role in colonization of poultry. International Journal of Microbiology, 14: 25-32. DOI: https://www.doi.org/10.2436/20.1501.01.132

Bolinger H and Kathariou S (2017). The Current State of Macrolide Resistance in Campylobacter spp. Trends and Impacts of Resistance Mechanisms. Applied and Environmental Microbiology, 83: e00416-e00417. DOI: https://www.doi.org/10.1128/AEM.00416-17

Bolton DJ (2015). Campylobacter virulence and survival factors. Food Microbiology, 48: 99-108. DOI: https://www.doi.org/10.1016/j.fm.2014.11.017

Carvalho ACT, Ruiz-Palacios GM, Ramos-Cervantes P, Cervantes LE, Jiang X, and Pickering LK (2001). Molecular characterization of invasive and non-invasive Campylobacter jejuni and Campylobacter coli isolates. Journal of Clinical Microbiology, 39(4): 1353-1359. DOI: https://www.doi.org/10.1128/JCM.39.4.1353-1359.2001

Chansiripornchai N and Sasipreeyajan J (2009). PCR detection of four virulence-associated genes of Campylobacter jejuni isolates from Thai broilers and their abilities of adhesion to and invasion of INT-407 cells. Journal of Veterinary Medical Science, 71(6): 839-844. DOI: https://www.doi.org/10.1292/jvms.71.839

Charvalos E, Peteinaki E, Spyridaki I, Manetas S, and Tselentis Y (1996). Detection of ciprofloxacin resistance mutations in Campylobacter jejuni gyrA by nonradioisotopic single-strand conformation polymorphism and direct DNA sequencing. Journal of Clinical Laboratory Analysis, 10: 129-133. DOI: https://www.doi.org/10.1002/(SICI)1098-2825(1996)10:3<129::AID-JCLA3>3.0.CQ;2-6

Dasti JI, Tareen AM, Lugert R, Zautner AE, and Gross U (2010). Campylobacterjejuni: a brief overview on pathogenicity associated factors and disease-mediating mechanisms. International Journal of Medical Microbiology, 300: 205-211. DOI: https://www.doi.org/10.1016/j.ijmm.2009.07.002

Datta S, Niwa H, and Itoh K (2003). Prevalence of 11 pathogenic genes of Campylobacter jejuni by PCR in strains isolated from humans, poultry meat and broiler and bovine faeces. Journal of Medical Microbiology, 52(4): 345-348. DOI: https://www.doi.org/10.1099/jmm.0.05056-0

Duarte A, Santos A, Manageiro V, Martins A, Fraqueza MJ, Canifa M, Dominguesa FC, and Oleastrob M (2014). Human, food and animal Campylobacter spp. isolated in Portugal: high genetic diversity and antibiotic resistance rates. International Journal of Antimicrobial Agents, 44: 306-313. DOI: https://www. doi. org/10.1016/j.ij antimicag .2014.06.012

EFSA (2014a). The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2012. EFSA Journal, 12(2): 3547. DOI: https://www.doi.org/10.2903/j.efsa.2014.3547

EFSA (2014b). The European Union Summary Report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2012. EFSA Journal, 12(3): 3590. DOI: https://www.doi.org/10.2903/j.efsa.2014.3590

Gibreel A, Tracz DM, Nonaka L, Ngo TM, Connell SR, and Taylor DE (2004). Incidence of antibiotic resistance in Campylobacter jejuni isolated in Alberta, Canada, from 1999 to 2002, with special reference to tet(O)-mediated tetracycline resistance. Antimicrobial Agents and Chemotherapy, 48(9): 3442-3450.

DOI: https://www.doi.org/10.1128/AAC.48.9.3442-3450.2004

Haag LM, Fischer A, Otto B, Grundmann U, Kühl AA, Göbel UB, Bereswill S, and Heimesaat MM (2012). Campylobacter jejuni infection of infant mice: acute enterocolitis is followed by asymptomatic intestinal and extra-intestinal immune responses. European Journal of Microbiology and Immunology, 2(1): 2-11. DOI: https://www.doi.org/10.1556/eujmi.2.2012.1.2

Hagos Y, Gugsa G, Awol N, Ahmed M, Tsegaye Y, Abebe N, and Bsrat A (2021). Isolation, identification, and antimicrobial susceptibility pattern of Campylobacter jejuni and Campylobacter coli from cattle, goat, and chicken meats in Mekelle, Ethiopia. PloS one, 16(2), e0246755. DOI: https://doi.org/10.1371/journal.pone.0246755

Hakanen A, Jalava J, Kotilainen P, Jousimies-Somer H, Siitonen A and Huovinen P (2002). gyrA polymorphism in Campylobacter jejuni: detection of gyrA mutations in 162 C. jejuni isolates by single-strand conformation polymorphism and DNA Sequencing. Antimicrob Agents Chemother, 46: 2644-2647. DOI: https://www.doi.org/10.1128/AAC.46.8.2644-2647.2002

Havelaar AH, Ivarsson S, Löfdahl M, and Nauta MJ (2013). Estimating the true incidence of campylobacteriosis and salmonellosis in the European Union, 2009. Epidemiology and Infection, 141: 293-302. DOI: http://www.

doi.org/10.1017/S0950268812000568

Hermans D, Van Deun K, Martel A, Van Immerseel F, Messens W, Heyndrickx M, Haesebrouck F, and Pasmans F (2011). Colonization factors of Campylobacter jejuni in the chicken gut. Veterinary research, 42(1): 1-14. DOI: http: //www. veterinaryresearch.org/content/42/1/82

îlhan Z, Ekin ÎH, Gülaydin Ö (2021). Determination of Campylobacter fetus subsp. fetus and Campylobacter jejuni in Aborted Sheep Fetuses by Multiplex PCR Assay. Israel Journal of Veterinary Medicine, 76 (4): 161-167. Available at: http : //www. ij vm. org. il/sites/default/files/ilhan. pdf

Indykiewicz P, Andrzejewska M, Minias P, S'pica D, and Kowalski J (2021). Prevalence and Antibiotic Resistance of Campylobacter spp. in Urban and Rural Black-Headed Gulls Chroicocephalus ridibundus. EcoHealth, 18: 147-156. DOI: https://www.doi.org/10.1007/s10393-021-01540-0

Iraola G, Hernandez M, Calleros L, Paolicchi F, Silveyra S, Velilla A, Carretto L, Rodríguez E, and Pérez R (2012). Application of a multiplex PCR assay for Campylobacter fetus detection and subspecies differentiation in uncultured samples of aborted bovine fetuses. Journal of Veterinary Science, 13(4): 371-376. DOI: https://www.doi.org/10.4142/jvs.2012.13.4.371

Kepner DE, Turnidge J, McCarthy LR, and Master RN (2003). Low levels of fluoroquinolone resistance in Escherichia coli. A five-year trend in Australia measured through the use of TSN Database Australia. Communicable diseases intelligence quarterly report, 27: 89-91. PMID: 12807281.

Khoshbakht R, Tabatabaei M, Hoseinzadeh S, Raeisi M, Aski HS, and Berizi E (2016). Prevalence and antibiotic resistance profile of thermophilic Campylobacter spp. of slaughtered cattle and sheep in Shiraz, Iran. Veterinary Research Forum, 7(3): 241. PMCID: PMC5094166.

Konkel ME, Kim BJ, Klena JD, Young CR, and Ziprin R (1998) Characterization of the thermalstress response of Campylobacter jejuni. Infection and Immunity Journal, 66(8): 3666-3672. DOI: https://www.doi.org/10.1128/IAI.66.8.3666-3672.1998

Lior H (1984). New, extended biotyping scheme for Campylobacter jejuni, Campylobacter coli, and Campylobacter laridis. Journal of Clinical Microbiology, 20: 636-640. DOI: https://www.doi:10.1128/jcm.20.4.636-640.1984

Luo N, Sahin O, Lin J, Michel LO and Zhang Q (2003). In vivo selection of Campylobacter isolates with high levels of fluoroquinolone resistance associated with gyrA mutations and the function of the CmeABC e_ux pump. American Society for Microbiology, 47: 390-394. DOI: https://www.doi.org/10.1128/AAC.47.1.390-394.2003

McDermott PF, Bodeis-Jones SM, Fritsche TR, Jones RN, Walker RD (2005). Broth microdilution susceptibility testing of Campylobacter jejuni and the determination of quality control ranges for fourteen antimicrobial agents. Journal of clinical microbiology, 43(12): 6136-6138. DOI: https://www.doi.org/10.1128/JCM.43.12.6136-6138.2005

Nur-Aziera-Aina CMN, Nur-Syafiqah MN, and Zaidah AR (2020). Detection of campylobacter jejuni among commercial broiler chickens in east-coast Malaysia. Journal of World's Poultry Research, 10 (2): 367-370. DOI: https://dx.doi.org/10.36380/jwpr.2020.42

Ó Cróinín T and Backert S (2012). Host epithelial cell invasion by Campylobacter jejuni: Trigger or zipper mechanism?. Front Cell Infection Microbiology, 2: 25. DOI: https://www.doi.org/10.3389/fcimb.2012.00025

Pao S, Hagens BE, Kim C, Wildeus S, Ettinger MR, Wilson MD, Watts BD, Whitley NC, Porto-Fett ACS, Schwarz JG, et al. (2014). Prevalence and molecular analyses of Campylobacter jejuni and Salmonella spp. in co-grazing small ruminants and wild-living birds. Livestock Science, 160 (1): 163-171. DOI: https://doi.org/10.1016/j.livsci.2013.11.020

Park SF (2002). The physiology of Campylobacter species and its relevance to their role as foodborne pathogens. International journal of Food Microbiology, 74: 177-188. DOI: https://www.doi.org/10.1016/S0168-1605(01)00678-X

Payot S, Bolla JM, Corcoran D, Fanning S, Mégraud F, and Zhang Q (2006). Mechanisms of fluoroquinolone and macrolide resistance in Campylobacter species. Microbes and Infection, 8: 1967-1971. DOI: https://www.doi.org/10.1016/j.micinf.2005.12.032

Pitkänen T (2013). Review of Campylobacter spp. in drinking and environmental waters. Journal of Microbiological Methods, 95(1): 39-47. DOI: https://www.doi.org/10.1016/j.mimet.2013.06.008

Quino W, Caro-Castro J, Hurtado V, Flores-León D, Gonzalez-Escalona N, and Gavilan RG (2022). Genomic Analysis and Antimicrobial Resistance of Campylobacter jejuni and Campylobacter coli in Peru. Frontiers in microbiology, 12. DOI: https://www.doi.org/10.3389/fmicb.2021.802404

Ranjbar R and Babazadeh D (2017). Contact with poultry and animals increases risk of Campylobacter infections in adults of Ardabil province, Iran. Universa Medicina, 36(1): 59-67. https://doi.org/10.18051/UnivMed.2017.v36.59-67

Redondo N, Carroll A, and McNamara E (2019). Molecular characterization of Campylobacter causing human clinical infection using whole-genome sequencing: Virulence, antimicrobial resistance and phylogeny in Ireland. PloS one, 14(7): e0219088. DOI: https://www.doi.org/10.1371/journal.pone.0219088

Roux F, Sproston E, Rotariu O, MacRae M, Sheppard SK, Bessell P, Smith-Palmer A, Cowden J, Maiden MCJ, Forbes KJ et al. (2013). Elucidating the etiology of human Campylobacter coli infections. PLoS ONE, 8: e64504. DOI: https://www.doi.org/10.1371/journal.pone.0064504

Rukambile E, Sintchenko V, Muscatello G, Kock R, and Alders R (2019). Infection, colonization and shedding of Campylobacter and Salmonella in animals and their contribution to human disease: a review. Zoonoses Public Health, 66: 562-578. DOI: https://www.doi.org/10.1111/zph.12611

Schiaffino F, Colston JM, Paredes-Olortegui M, François R, Pisanic N, Burga R, Peñataro-Yori P, and Kosek MN (2018). Antibiotic resistance of Campylobacter species in a paediatric cohort study. Antimicrob Agents Chemother, 63(2): e01911-01918. DOI: https://www.doi.org/10.1128/AAC.01911-18

Sheppard SK and Maiden MC (2015). The evolution of Campylobacter jejuni and Campylobacter coli. Cold Spring Harbor Perspectives in Biology, 7: a018119. DOI: https://www.doi. org/10. 1101 /cshperspect. a018119

Sproston EL, Ogden ID, MacRae M, Forbes KJ, Dallas JF, Sheppard SK, Cody A, Colles F, Wilson MJ, and Strachan NJC (2010). Multi- locus sequence types of Campylobacters carried by flies and slugs acquired from local ruminant faeces. Journal of applied microbiology, 109(3): 829-838. DOI: ~https://www.doi.org/10.1111/j.1365-2672.2010.04711.x

Tamura K, Stecher G, Peterson D, Filipski A, and Kumar S (2013). MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution, 30: 2725-2729. DOI: https://www.doi.org/10.1093/molbev/mst197

195

Thompson JD, Higgins DG, and Gibson TJ (1994). Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22(22): 4673-4680. DOI: https://www.doi.org/10.1093/nar/22.22.4673

Wang L, Yaeger MJ, Hoffman LJ, and Zhang Q (2008). Emergence of a tetracycline- resistant Campylobacter jejuni clone associated with outbreaks of ovine abortion in the United States. Journal Clinical Microbiology, 46(5): 1663-1671. DOI: https://www.doi.org/10.1128/JCM.00031-08

Wieczorek K (2011). Resistance to quinolones and tetracycline and its molecular background among Campylobacter strains isolated in Poland. Biology Bulletin of The Veterinary Institute, 55(4): 613-618. Available at: https://www.semanticscholar.org/paper/Resistance-to-quinolones-and-tetracycline-and-its-Wieczorek/8cf3ac15dad942ce13cf02efe1f3606cf1782269

Wieczorek K and Osek J (2013). Antimicrobial resistance mechanisms among Campylobacter. BioMed Research International, 2013: e340605. DOI: https://www.doi.org/10.1155/2013/340605

Wieczorek K, Denis E, Lachtara B, and Osek J (2017). Distribution of Campylobacter]'ejuni multilocus sequence types isolated from chickens in Poland. Poultry Science, 96: 703-709. DOI: https://www.doi.org/10.3382/ps/pew343

Wieczorek K, Wolkowicz T, and Osek J (2018). Antimicrobial Resistance and Virulence-Associated Traits of Campylobacter jejuni isolated from poultry food chain and humans with diarrhea. Frontiers in Microbiology, 9: 1508. DOI: https://www.doi.org/10.3389/fmicb.2018.01508

World Health Organisation (2018). Critically Important Antimicrobials for Human Medicine 6th Revision. Available at: https://www.who.int/foodsafety/publications/antimicrobials-sixth/en/

Zheng J, Meng J, Zhao S, Singh R, and Song W (2006). Adherence to and invasion of human intestinal epithelial cells by Campylobacter jejuni and Campylobacter coli isolates from retail meat products. Journal of Food Protection, 69(4): 768-774. DOI: https://wwwdoi.org/10.4315/0362-028X-69.4768

196