CC BY
19
УДК 631.81:579
DOI 10.18286/1816-4501-2021-4-61-65
ВЫЯВЛЕНИЕ ГЕНОВ ФЕРМЕНТОВ У БАКТЕРИЙ ВИДА BACILLUS SUBTILIS
МЕТОДОМ REAL-TIME PCR
Сульдина Екатерина Владимировна, ассистент кафедры «Микробиология, вирусология, эпизоотология и ветеринарно-санитарная экспертиза»
Феоктистова Наталья Александровна, кандидат биологических наук, доцент кафедры «Микробиология, вирусология, эпизоотология и ветеринарно-санитарная экспертиза»
Богданов Ильгизар Исмаилович, кандидат ветеринарных наук, доцент кафедры «Микробиология, вирусология, эпизоотология и ветеринарно-санитарная экспертиза»
Молофеева Надежда Ивановна, кандидат биологических наук, доцент кафедры «Микробиология, вирусология, эпизоотология и ветеринарно-санитарная экспертиза» ФГБОУ ВО Ульяновский ГАУ
432017, г. Ульяновск, бульвар Новый Венец, 1; тел. 8(8422) 49-55-63; Email: e.suldina2006@yandex.ru
Ключевые слова: Bacillus subtilis, полимеразно-цепная реакция, фитаза, нитрогеназа, щелочная фас-фотаза, гены, REAL-TIME PCR.
Почва - жизненно важный и ценный природный ресурс, поддерживающий жизнь на Земле. Нормальное функционирование почвы зависит от баланса ее структуры и состава, а также физико-химических и биологических свойств. Часто этот баланс нарушается при воздействии различных абиотических, биотических и антропогенных факторов. Следовательно, восстановление почвы имеет первостепенное значение для предотвращения возможного неблагоприятного воздействия на живые системы и сохранения окружающей среды для будущих поколений. Различные исследования подтвердили эффективность внесения ризобак-терий для улучшения показателей плодородия почвы, повышения показателей роста и урожайности сельскохозяйственных культур. Бактерии вида Bacillus subtilis - одни из самых распространенных ризобактерий, применяемых в сельском хозяйстве. Многие штаммы B. subtilis способны фиксировать атмосферный азот, солюбилизировать фосфор и калий, тем самым способствуя увеличению количества необходимых для питания растений макроэлементов в почве. Целью данной работы стал поиск генов, отвечающих за синтез ферментов фитазы, нитрогеназы и щелочной фосфатазы у штаммов бактерий вида Bacillus subtilis методом ПЦР в режиме реального времени. Для определения наличия генов, кодирующих синтез искомых ферментов у Bacillus subtilis, проведен анализ in-silico аннотированных геномов данного вида бактерии представленных в информационной базе данных NCBI. Далее был произведен подбор праймеров для скрининга целевых участков. По результатам проведенного исследования у 10 из 19 выделенных штаммов Bacillus subtilis присутствовали все три искомые участка ДНК, отвечающие за синтез ферментов фитазы, нитрогеназы и щелочной фосфатазы.
Исследование выполнено при финансовой поддержке РФФИ и Ульяновской области в рамках научного проекта № 19-416-730004
Введение
Почва - жизненно важный и ценный природный ресурс, поддерживающий жизнь на Земле [1]. Нормальное функционирование почвы зависит от баланса ее структуры и состава, а также физико-химических и биологических свойств [2]. Часто этот баланс нарушается при воздействии различных абиотических, биотических и антропогенных факторов [3-7].
Следовательно, восстановление почвы имеет первостепенное значение для предотвращения возможного неблагоприятного воздействия на живые системы и сохранения окружающей среды для будущих поколений [8-9].
Различные исследования подтвердили
эффективность внесения ризобактерий для повышения показателей роста и урожайности сельскохозяйственных культур [10-13].
Благоприятный эффект от применения ри-зобактерии связывают с продуцированием различных видов усилителей роста, вторичных метаболитов, внеклеточных ферментов, фитогор-монов, азотфиксацией, солюбилизацией фосфора и калия [14]. Бактерии вида Bacillus subtilis пользуются набольшим спросом и широко применяются благодаря своей жизнеспособности и высокой устойчивости [11] для защиты многих видов растений при абиотических стрессах [1516] азотфиксации, улучшения биодоступности макро- и микронутриентов и индукции систем-
ной устойчивости у растений [17-19].
В связи с этим цель данной работы - поиск генов, отвечающих за синтез ферментов фитазы, нитрогеназы и щелочной фосфатазы у штаммов бактерий вида Bacillussubtilis методом ПЦР в режиме реального времени.
Материалы и методы исследований Штаммы бактерий: в работе были использованы 19 штаммов бактерии вида Bacillus subtilis, полученные из музея кафедры микробиологии, вирусологии, эпизоотологии и ВСЭ Ульяновского ГАУ.
Культуры бактерий обладали типичными для данного вида культуральными, морфологическими и биохимическими свойствами.
Питательные среды и реактивы: 2,5х реакционная смесь в присутствии красителя EVA GREEN (Синтол, Россия), набор реагентов «ПРОБА-РАПИД» для выделения ДНК (ДНК-технологии, Россия).
Лабораторная посуда и оборудование: центрифуга Микроспин FV-2400 (BioSan, Латвия), центрифуга Eppendorf 5804, Центрифуга/ вортекс для пробирок (BioSan, Польша), ламинарный бокс БМБ-И-«Ламинар-С»-1 2 (ЛамСи-стем, Россия), Твердотельный термостат TDB-120 (BioSan, Польша), центрифуга-встряхиватель медицинская серии СМ-50М (ELMI, Польша), ам-плификатор детектирующий «ДТ прайм» (ДНК-технология, Россия).
Результаты исследований Для определения наличия генов, кодирующих синтез ферментов фитазы, нитрогеназы и щелочной фосфатазы у Bacillus subtilis, проведен анализ in-silico аннотированных геномов данного вида бактерии, представленных в информационной базе данных NCBI, в результате чего были установлены гены, кодирующие синтез эти ферментов.
Далее был произведен подбор прайме-ров для скрининга целевых участков. В результате нами были использованы следующие пары праймеров:
для детекции фермента фосфатазы прямой (f) 5'-3' TAGAAGCGCAAACCCGGAAA обратный(г)3'-5' TTTTCCAGCCTGCCTCAAGC; для нитрогеназы
прямой (f) AACAGCCTGCTTCGGGTCTG обратный (r) 3'-5' GCTCGGCAGCTTTCCACATC; для фитазы
прямой (f) 5'-3' GACCGTGCGACAGGAGATCA обратный (r) 3'-5' GCCAAGTCCGAAACCGAGAA Амплификацию проводили по протоколу: 1. Предварительная денатурация -950C в
течение 5 минут, 1 цикл.
2. Денатурация - 950C в течение 10 сек, Отжиг- 59 0C в течении 40 сек, Элонгация 720C на 10 сек, 30 циклов.
Для проведения реакции ПЦР использовали 2,5х реакционную смесь в присутствии красителя EVA GREEN (Синтол, Россия). Детекцию результата амплификации проводили при помощи канала FAM. Результаты представлены в таблицах 1-3 и на рисунках 2-4.
Таблица 1
Результаты амплификации праймерной системы для детекции гена кодирующего фос-фатазу бактерии Bacillus subtilis
Номер лунки Идентификатор пробирки Cp, Fam Результат
A1 Bs-1 30,1 +
A2 Bs-2 29,8 +
A3 Bs-3 30,2 +
A4 Bs-4 29,5 +
A5 Bs-5 31,0 +
A6 Bs-6 29,9 +
1 A7 Bs-7 30,0 +
A8 Bs-8 30,2 +
A9 Bs-9 28,7 +
A10 Bs-10 29,5 +
A11 Bs-11 29,2 +
A12 Bs-12 30,2 +
B1 Bs-13 30,7 +
B2 Bs-14 29,8 +
B3 Bs-15 34,3 +
■ B4 Bs-16 29,7 +
B5 Bs-17 29,9 +
B6 Bs-18 29,9 +
B7 Bs-19 28,9 +
Рис. 2 - Результаты амплификации праймерной системы для детекции гена кодирующего фосфатазу бактерии Bacillus subtilis
Таблица 2
Результаты амплификации праймерной системы для детекции гена кодирующего ни-трогеназу бактерии Bacillus subtilis
Номер лунки Идентификатор пробирки Ct, Fam Результат
A1 Bs-1 -
A2 Bs-2 26,3 +
A3 Bs-3 29,6 +
A4 Bs-4 23,0 +
A5 Bs-5 19,6 +
A6 Bs-6 -
A7 Bs-7 -
A8 Bs-8 29,1 +
A9 Bs-9 -
A10 Bs-10 35,6 +
A11 Bs-11 36,3 +
A12 Bs-12 36,2 +
B1 Bs-13 -
B2 Bs-14 -
B3 Bs-15 -
B4 Bs-16 -
1 B5 Bs-17 -
B6 Bs-18 21,5 +
B7 Bs-19 19,1 +
Рис. 3 - Результаты амплификации праймерной системы для детекции гена кодирующего нитрогеназу бактерии Bacillus subtilis
Таблица 3
Результаты амплификации праймерной системы для детекции гена кодирующего фи-тазу бактерии Bacillus subtilis
Номер лунки Идентификатор пробирки Cp, Fam Результат
A1 Bs-1 -
A2 Bs-2 32,3 +
A3 Bs-3 31,3 +
A4 Bs-4 31,5 +
A5 Bs-5 32,6 +
A6 Bs-6 -
1 A7 Bs-7 -
A8 Bs-8 31,4 +
A9 Bs-9 -
A10 Bs-10 31,7 +
A11 Bs-11 31,5 +
A12 Bs-12 31,7 +
B1 Bs-13 -
B2 Bs-14 -
B3 Bs-15 -
B4 Bs-16 -
B5 Bs-17 -
B6 Bs-18 30,7 +
B7 Bs-19 25,9 +
Рис. 4 - Результаты амплификации праймерной системы для детекции гена кодирующего фитазу бактерии Bacillus subtilis
По результатам проведенного исследования только у 10 из 19 выделенных штаммов Bacillus subtilis присутствовали все три искомые участка ДНК, отвечающие за синтез ферментов щелочной фосфатазы, нитрогеназы и фитазы.
Обсуждение
Бактерии вида Bacillus subtilis обладают широким спектром защитных и способствующих росту растений способностей (солюбили-зация почвенного фосфора, калия, усиление азотфиксации, биоконтроль патогенов). В связи с этим они имеют большое значение для биотехнологической промышленности и сельского хозяйства. Самым большим преимуществом ис-
пользования Bacillus subtilis в качестве биологического инокулята в сельском хозяйстве и смежных областях является способность производить эндоспоры с пролонгированной жизнеспособностью и высокой устойчивостью [20], что позволяет легко создавать на их основе различные типы биокомпозиций для применения в широком диапазоне агроклиматических условий.
В данной работе была установлена потенциальная способность выделенных нами из внешней среды штаммов Bacillus subtilis к солю-билизации почвенного фосфора, калия и азот-фиксации за счет продуцирования ферментов фитазы, нитрогеназы и щелочной фосфатазы.
Заключение
По результатам проведенного исследования у 10 из 19 выделенных штаммов Bacillus subtilis присутствовали все три искомые участка ДНК, отвечающие за синтез ферментов фитазы, нитрогеназы и щелочной фосфатазы.
Таким образом, были определены канди-датные бактериальные штаммы Bacillus subtilis для разработки биокомпозиции способствующей повышению коэффициента усвоения минеральных компонентов удобрений.
Библиографический список
1. Shah V., Daverey A. Phytoremediation: A multidisdplinary approach to clean up heavy metal contaminated soil //Environmental Technology & Innovation. - 2020. - Т. 18. - С. 100774.
2. Shi T. et al. Visible and near-infrared reflectance spectroscopy—An alternative for monitoring soil contamination by heavy metals //Journal of hazardous materials. - 2014. - Т. 265. - С. 166-176.
3. Ali A. et al. Application of wood biochar in polluted soils stabilized the toxic metals and enhanced wheat (Triticum aestivum) growth and soil enzymatic activity //Ecotoxicology and environmental safety. - 2019. - Т. 184. - С. 109635.
4. Ali A. et al. Apricot shell-and apple tree-derived biochar affect the fractionation and bioavailability of Zn and Cd as well as the microbial activity in smelter contaminated soil //Environmental Pollution. - 2020. - Т. 264. - С. 114773.
5. Zhao X. et al. A comprehensive investigation of hazardous elements contamination in mining and smelting-impacted soils and sediments // Ecotoxicology and environmental safety. - 2020. - Т. 192. - С. 110320.
6. Bennett J. A., Klironomos J. Mechanisms of plant-soil feedback: interactions among biotic and abiotic drivers //New Phytologist. - 2019. - Т. 222. -№. 1. - С. 91-96.Saeid A., Prochownik E., Dobrowol-
ska-Iwanek J. Phosphorus solubilization by Bacillus species //Molecules. - 2018. - T. 23. - №. 11. - P. 2897.
7. Kumar A. et al. Plant growth-promoting rhizobacteria (PGPR): perspective in agriculture under biotic and abiotic stress //Crop improvement through microbial biotechnology. - Elsevier, 2018. -C. 333-342.
8. Yang X. et al. Remediation of heavy metal contaminated soils by organic acid extraction and electrochemical adsorption //Environmental Pollution. - 2020. - T. 264. - C. 114745.
9. Jeyasundar P. G. S. A. et al. Green remediation of toxic metals contaminated mining soil using bacterial consortium and Brassica juncea //Environmental Pollution. - 2021. - T. 277. - C. 116789.
10. Wang Q. et al. Influence of tea saponin on enhancing accessibility of pyrene and cadmium phytoremediated with Lolium multiflorum in co-contaminated soils //Environmental Science and Pollution Research. - 2016. - T. 23. - №. 6. - C. 57055711.
11. Sarawaneeyaruk S. et al. Enhancing plant growth under municipal wastewater irrigation by plant growth promoting rhizospheric Bacillus spp // Journal of King Saud University-Science. - 2019. - T. 31. - №. 3. - C. 384-389.
12. Manoj S. R. et al. Understanding the molecular mechanisms for the enhanced phytoremediation of heavy metals through plant growth promoting rhizobacteria: A review //Journal of environmental management. - 2020. - T. 254. - C. 109779.
13. Tang Y. et al. Significance of manganese resistant Bacillus cereus strain WSE01 as a bioinoc-ulant for promotion of plant growth and manganese accumulation in Myriophyllum verticillatum //Science of The Total Environment. - 2020. - T. 707. - C. 135867.
14. Balseiro-Romero M. et al. Use of plant growth promoting bacterial strains to improve Cy-tisus striatus and Lupinus luteus development for potential application in phytoremediation //Science of The Total Environment. - 2017. - T. 581. - C. 676688.
15. Bharti N. et al. Exiguobacterium oxidotol-erans, a halotolerant plant growth promoting rhizobacteria, improves yield and content of secondary metabolites in Bacopa monnieri (L.) Pennell under primary and secondary salt stress //World Journal of Microbiology and Biotechnology. - 2013. - T. 29. -№. 2. - C. 379-387.
16. Esitken A. et al. Effects of plant growth promoting bacteria (PGPB) on yield, growth and nutrient contents of organically grown strawberry //
Scientia horticulturae. - 2010. - T. 124. - №. 1. - C. 62-66.
17. Berg G. Plant-microbe interactions promoting plant growth and health: perspectives for controlled use of microorganisms in agriculture // Applied microbiology and biotechnology. - 2009. -T. 84. - №. 1. - C. 11-18.
18. Perez-Garcia O. et al. Heterotrophic cultures of microalgae: metabolism and potential products //Water research. - 2011. - T. 45. - №. 1. - C. 11-36.
19. Bottini R., Cassan F., Piccoli P. Gibberellin production by bacteria and its involvement in plant growth promotion and yield increase //Applied microbiology and biotechnology. - 2004. - T. 65. - №. 5. - C. 497-503.
20. Alina S. O., Constantinscu F., Petru^a C. C. Biodiversity of Bacillus subtilis group and beneficial traits of Bacillus species useful in plant protection // Romanian Biotechnological Letters. - 2015. - T. 20. - №. 5. - C. 10737-10750.
DETECTION OF ENZYME GENES OF BACTERIA OF BACILLUS SUBTILIS SPECIES BY REAL-TIME PCR
Suldina E.V., Feoktistova N.A., Bogdanov I.I., Molofeeva N.I. FSBEI HE Ulyanovsk SAU 432017, Ulyanovsk, Novyi Venets boulevard, 1; Tel. 8 (8422) 49-55-63; e-mail: e.suldina2006@yandex.ru
Keywords: Bacillus subtilis, polymerase chain reaction, phytase, nitrogenase, alkaline fasfotase, genes, REAL-TIME PCR.
Soil is a vital and valuable natural resource that sustains life on earth. Appropriate soil functioning depends on the balance of its structure and composition, as well as physical, chemical and biological properties. Often, this balance is disturbed under the influence of various abiotic, biotic and anthropogenic factors. Therefore, soil restoration is of great importance in order to prevent possible adverse effects on living systems and to preserve the environment for future generations. Various studies confirmed the effectiveness of introduction of rhizobacteria to improve soil fertility, increase growth and productivity of agricultural crops. Bacillus subtilis is one of the most common rhizobacteria used in agriculture. Many B. subtilis strains are capable of fixing atmospheric nitrogen, solubilizing phosphorus and potassium, thereby contributing to an increase in the amount of macroelements necessary for plant nutrition in soil. The aim of this work was to search for genes responsible for synthesis of phytase, nitrogenase, and alkaline phosphatase enzymes in strains of bacteria of Bacillus subtilis species by real-time PCR. To determine the presence of genes encoding the synthesis of the desired enzymes in Bacillus subtilis, an in-silico analysis of the annotated genomes of this bacterial species presented in the NCBI information database was carried out. Then the selection of primers for screening the target spots was made. According to the results of the study, 10 out of 19 isolated Bacillus subtilis strains contained all three required DNA regions responsible for synthesis of phytase, nitrogenase, and alkaline phosphatase enzymes.
Bibliography:
1. Shah V., Daverey A. Phytoremediation: A multidisciplinary approach to clean up heavy metal contaminated soil //Environmental Technology & Innovation. - 2020. - T. 18. - C. 100774.
2. Shi T. et al. Visible and near-infrared reflectance spectroscopy—An alternative for monitoring soil contamination by heavy metals //Journal of hazardous materials. - 2014. - T. 265. - C. 166-176.
3. Ali A. et al. Application of wood biochar in polluted soils stabilized the toxic metals and enhanced wheat (Triticum aestivum) growth and soil enzymatic activity //Ecotoxicology and environmental safety. - 2019. - T. 184. - C. 109635.
4. Ali A. et al. Apricot shell-and apple tree-derived biochar affect the fractionation and bioavailability of Zn and Cd as well as the microbial activity in smelter contaminated soil //Environmental Pollution. - 2020. - T. 264. - C. 114773.
5. Zhao X. et al. A comprehensive investigation of hazardous elements contamination in mining and smelting-impacted soils and sediments //Ecotoxicology and environmental safety. - 2020. - T. 192. - C. 110320.
6. Bennett J. A., Klironomos J. Mechanisms of plant-soil feedback: interactions among biotic and abiotic drivers //New Phytologist. - 2019. - T. 222. - №.
1. - C. 91-96.Saeid A., Prochownik E., Dobrowolska-Iwanek J. Phosphorus solubilization by Bacillus species //Molecules. - 2018. - T. 23. - №. 11. - P. 2897.
7. Kumar A. et al. Plant growth-promoting rhizobacteria (PGPR): perspective in agriculture under biotic and abiotic stress //Crop improvement through microbial biotechnology. - Elsevier, 2018. - C. 333-342.
8. Yang X. et al. Remediation of heavy metal contaminated soils by organic acid extraction and electrochemical adsorption //Environmental Pollution. -2020. - T. 264. - C. 114745.
9. Jeyasundar P. G. S. A. et al. Green remediation of toxic metals contaminated mining soil using bacterial consortium and Brassica juncea //Environmental Pollution. - 2021. - T. 277. - C. 116789.
10. Wang Q. et al. Influence of tea saponin on enhancing accessibility of pyrene and cadmium phytoremediated with Lolium multiflorum in co-contaminated soils //Environmental Science and Pollution Research. - 2016. - T. 23. - №. 6. - C. 5705-5711.
11. Sarawaneeyaruk S. et al. Enhancing plant growth under municipal wastewater irrigation by plant growth promoting rhizospheric Bacillus spp //Journal of King Saud University-Science. - 2019. - T. 31. - №. 3. - C. 384-389.
12. Manoj S. R. et al. Understanding the molecular mechanisms for the enhanced phytoremediation of heavy metals through plant growth promoting rhizobacteria: A review //Journal of environmental management. - 2020. - T. 254. - C. 109779.
13. Tang Y. et al. Significance of manganese resistant Bacillus cereus strain WSE01 as a bioinoculant for promotion of plant growth and manganese accumulation in Myriophyllum verticillatum //Science of The Total Environment. - 2020. - T. 707. - C. 135867.
14. Balseiro-Romero M. et al. Use of plant growth promoting bacterial strains to improve Cytisus striatus and Lupinus luteus development for potential application in phytoremediation //Science of The Total Environment. - 2017. - T. 581. - C. 676-688.
15. Bharti N. et al. Exiguobacterium oxidotolerans, a halotolerant plant growth promoting rhizobacteria, improves yield and content of secondary metabolites in Bacopa monnieri (L.) Pennell under primary and secondary salt stress //World Journal of Microbiology and Biotechnology. - 2013. - T. 29. - №.
2. - C. 379-387.
16. Esitken A. et al. Effects of plant growth promoting bacteria (PGPB) on yield, growth and nutrient contents of organically grown strawberry //Scientia horticulturae. - 2010. - T. 124. - №. 1. - C. 62-66.
17. Berg G. Plant-microbe interactions promoting plant growth and health: perspectives for controlled use of microorganisms in agriculture //Applied microbiology and biotechnology. - 2009. - T. 84. - №. 1. - C. 11-18.
18. Perez-Garcia O. et al. Heterotrophic cultures of microalgae: metabolism and potential products //Water research. - 2011. - T. 45. - №. 1. - C. 11-36.
19. Bottini R., Cassan F., Piccoli P. Gibberellin production by bacteria and its involvement in plant growth promotion and yield increase //Applied microbiology and biotechnology. - 2004. - T. 65. - №. 5. - C. 497-503.
20. Alina S. O., Constantinscu F., Petrufa C. C. Biodiversity of Bacillus subtilis group and beneficial traits of Bacillus species useful in plant protection // Romanian Biotechnological Letters. - 2015. - T. 20. - №. 5. - C. 10737-10750.
