Научная статья на тему 'ВЫДЕЛЕНИЕ ИЗ ПОЧВ УЗБЕКИСТАНА БАКТЕРИАЛЬНОГО ШТАММА Ochrobactrum intermedium PDB – 3, ЕГО ХАРАКТЕРИСТИКА И МОЛЕКУЛЯРНАЯ ИДЕНТИФИКAЦИЯ'

ВЫДЕЛЕНИЕ ИЗ ПОЧВ УЗБЕКИСТАНА БАКТЕРИАЛЬНОГО ШТАММА Ochrobactrum intermedium PDB – 3, ЕГО ХАРАКТЕРИСТИКА И МОЛЕКУЛЯРНАЯ ИДЕНТИФИКAЦИЯ Текст научной статьи по специальности «Биологические науки»

CC BY
6
1
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
Ochrobactrum intermedium / микроорганизмы / биодеструкция пестицидов / идентификaция / MALDI-TOF MS / 16 S рRNK / Ochrobactrum intermedium / microorganisms / biodegradation of pesticides / identification / MALDI-TOF MS / 16 S rRNK

Аннотация научной статьи по биологическим наукам, автор научной работы — Косимов Диёрбек Илхом Угли, Эргашев Рустамбек Бахтиёр Угли, Зайнитдинова Людмила Ибрахимовна, Мавжудова Азиза Маджидовна

Из почв Узбекистана выделен микроорганизм, устойчивый к хлорпирифосу до 100 мг/л, а также ципермет-рину и ДДТ. Изучены его морфолого-культуральные свойства. С использованием идентификации на основании анализа MALDI – TOF MS и молекулярно-генетических исследований 16 S рРНК штамм определен как Оchrobactrum intermedium.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по биологическим наукам , автор научной работы — Косимов Диёрбек Илхом Угли, Эргашев Рустамбек Бахтиёр Угли, Зайнитдинова Людмила Ибрахимовна, Мавжудова Азиза Маджидовна

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

ISOLATION, CHARACTERISATION AND MOLECULAR IDENTIFICATION OF A NEW BACTERIAL STRAIN Ochrobactrum intermedium PDB – 3 IN THE CONDITIONS OF UZBEKISTAN

Microorganism resistant to chlorpyrifos up to 100 mg/l, as well as cypermethrin and DDT, was isolated from the soils of Uzbekistan. Mmorphological and cultural properties have been studied. The strain was identified as Ochrobactrum intermedium using identification based on MALDI-TOF MS analysis and molecular genetic studies of 16 S rRNA.

Текст научной работы на тему «ВЫДЕЛЕНИЕ ИЗ ПОЧВ УЗБЕКИСТАНА БАКТЕРИАЛЬНОГО ШТАММА Ochrobactrum intermedium PDB – 3, ЕГО ХАРАКТЕРИСТИКА И МОЛЕКУЛЯРНАЯ ИДЕНТИФИКAЦИЯ»

DOI - 10.32743/UniChem.2023.114.12.16283

ВЫДЕЛЕНИЕ ИЗ ПОЧВ УЗБЕКИСТАНА БАКТЕРИАЛЬНОГО ШТАММА Ochrobactrum intermedium PDB - 3, ЕГО ХАРАКТЕРИСТИКА И МОЛЕКУЛЯРНАЯ ИДЕНТИФИКАЦИЯ

Косимое Диёрбек Илхом угли

PhD, мл. науч. сотр. Института микробиологии АНРУз, Республика Узбекистан, г. Ташкент E-mail: diyor-qosimov91@mail.ru

Эргашее Рустамбек Бахтиёр угли

мл. науч. сотр. Института микробиологии АН РУз, Республика Узбекистан, г. Ташкент

Зайнитдиноеа Людмила Ибрахимоена

д-р биол. наук, проф., Института микробиологии АН РУз, Республика Узбекистан, г. Ташкент

Маежудоеа Азиза Маджидоена

канд. биол. наук, ст. науч. сотр., Института микробиологии АН РУз, Республика Узбекистан, г. Ташкент

ISOLATION, CHARACTERISATION AND MOLECULAR IDENTIFICATION OF A NEW BACTERIAL STRAIN Ochrobactrum intermedium PDB - 3 IN THE CONDITIONS OF UZBEKISTAN

Diyorbek Kosimov

PhD, junior researcher Institute of Microbiology of the Academy of Sciences of the Republic of Uzbekistan, Republic of Uzbekistan, Tashkent

Rustambek Ergashev

Junior Researcher Institute of Microbiology of the Academy of Sciences of the Republic of Uzbekistan, Republic of Uzbekistan, Tashkent

Lyudmila Zaynitdinova

Doctor of Biological Sciences prof., Institute of Microbiology of the Academy of Sciences of the Republic of Uzbekistan, Republic of Uzbekistan, Tashkent

Aziza Mavjudova

Ph.D. senior researcher Institute of Microbiology of the Academy of Sciences of the Republic of Uzbekistan, Republic of Uzbekistan, Tashkent

Библиографическое описание: ВЫДЕЛЕНИЕ ИЗ ПОЧВ УЗБЕКИСТАНА БАКТЕРИАЛЬНОГО ШТАММА Ochrobactrum intermedium PDB - 3, ЕГО ХАРАКТЕРИСТИКА И МОЛЕКУЛЯРНАЯ ИДЕНТИФИКАЦИЯ // Universum: химия и биология : электрон. научн. журн. Косимов Д.И. [и др.]. 2023. 12(114). URL:

https://7universum.com/ru/nature/archive/item/16283

№ 12(114)_химия и биология_декабрь, 2023 г.

АННОТАЦИЯ

Из почв Узбекистана выделен микроорганизм, устойчивый к хлорпирифосу до 100 мг/л, а также ципермет-рину и ДДТ. Изучены его морфолого-культуральные свойства. С использованием идентификации на основании анализа MALDI - TOF MS и молекулярно-генетических исследований 16 S рРНК штамм определен как Ochrobactrum intermedium.

ABSTRACT

Microorganism resistant to chlorpyrifos up to 100 mg/l, as well as cypermethrin and DDT, was isolated from the soils of Uzbekistan. Mmorphological and cultural properties have been studied. The strain was identified as Ochrobactrum intermedium using identification based on MALDI-TOF MS analysis and molecular genetic studies of 16 S rRNA.

Ключевые слова: Ochrobactrum intermedium, микроорганизмы, биодеструкция пестицидов, идентификaция, MALDI-TOF MS, 16 S рRNK.

Keywords: Ochrobactrum intermedium, microorganisms, biodegradation of pesticides, identification, MALDI-TOF MS, 16 S rRNK.

Введение. Почвенные микроорганизмы играют важную роль в поддержании биологического баланса в жизни нашей планеты. В почве содержатся бактерии, грибы и вирусы в разных количествах в зависимости от почвенных условий [1]. В свою очередь, плодородие почвы и накопление органического вещества в течение короткого времени зависят от численности бактерий [2]. Продукты жизнедеятельности микроорганизмов в почве играют важную роль в увеличении содержания питательных веществ в почве, роста растений, а также играют являются основным компонентом питательных цепочек [3]. Микроорганизмы в почве также играют важную роль в преобразовании питательных веществ в форму, пригодную для использования растениями [4]. Для лучшего роста и получения хорошего урожая сельхозкультур широко используются различные пестициды. Почвенные микроорганизмы выполняют множество функций, не только определяя плодородие почвы, но, также, способствуя трансформации многих ксенобиотиков, которые могут быть для них источником питательных веществ и энергии [5]. Многие почвенные микроорганизмы расщепляют органические вещества с высокой или низкой скоростью, если загрязняющие вещества распределены равномерно, а также при отсутствии ингибирования активности деструктивных микроорганизмов [6].

В настоящей работе приводятся данные по выделению и изучению микроорганизмов, устойчивых к различным пестицидам из образцов почв с фермерских полей, на которых многие годы использовались различные пестициды.

Материалы и методы

Сбор и характеристика почв. Образцы почв отбирались с фермерского поля (Узбекистан), на котором в течение многих лет использовались пестициды такие как хлорпирифос, циперметрин, и другие. Почва была отобрана с глубины 0-15 см. Полученные образцы очищались от крупных включений и анализировались в лабораторных условиях.

Образцы и реактивы. Для выделения микроорганизмов и определения микробного пейзажа использовались питательные среды, описанные в пособиях Егорова А.Е. и Нетрусова. А.И. [7]. Для выделения микроорганизмов использовались следующие

питательные среды: МПА, МПБ (производства HiMedia Pvt Ltd Mumbai, India). В работе используется pH-метр Metler toledo.

Выделение ДНК. Первоначально готовили питательный бульон, затем вносили в бульон бактериальную культуру и культивировали при 30°С в течение 12 ч. Затем из бактериальной культуры выделяли бактериальную ДНК с помощью набора реактивов РИБО-преп (ИнтерЛабСервис, Россия). Выделение ДНК проводили согласно протоколу, прилагаемому к набору. Выделенные образцы ДНК проверяли с помощью 0,9% агарозы и спектрофотометра. Образцы ДНК хранили при -20°С.

АмплифишЩия гена 16S рРНК методом ПЦР. Ген 16S рРНК был выбран для молекулярно-генетической идентификации бактериальных культур. Общий объем реакции амплификации составил 20 мкл с использованием готового лиофилизирован-ного набора ПЦР-ядер («Изоген», Россия). Праймеры (5 пикомоль/мкл) добавляли по 2 мкл, свободные нуклеотиды — по 2,5 мкл, а к ДНК — 2 мкл по 20 нг/мкл [8]. Ферменты и свободные нуклеотиды находятся в готовой упаковке и помещаются в каждый раствор отдельно в виде лиофилизата. Вносилось 10 мкл буфера и доводилось до 20 мкл дистиллированной водой.

Результаты и обсуждение

Для выделения устойчивых к пестицидам микроорганизмов использовали сероземную почву с фермерского поля, которая в течение ряда лет обрабатывалась пестицидами хлорпирифос, ципермет-рин и другими. В лабораторных условиях образцы почв дополнительно загрязняли пестицидами хлорпи-рифос+циперметрин. Обработанные образцы выдерживали в термостате в течение месяца при 300С для адаптации микроорганизмов к пестициду. Через месяц образцы (по 10 г почвы) вносили в колбы Эр-ленмейера, содержашие питательный бульон и инкубировали на роторном шейкере при 150 об/мин при 300 С в течение 48 часов. В результате таких пассажей выделяли изоляты устойчивые к данным концентрациям пестицида. Было выделено 17 изолятов, способных расти и размножатся на среде с пестицидами. Изоляты № 3, 6, 11, 16 показали хороший рост при концентрации хлорпирифоса до 50 мг/кг.

В следующей серии опытов была увеличена концентрация хлорпирифоса до 100 мг/л. По результатам изучения устойчивости к хлорпирифосу выделенных микроорганизмов был выбран изолят № 3 (рисунок 1),

который показывал хороший и стабильный рост (титр клеток до 107 КОЕ/г) при концентрации пестицида 100 мг/л.

Рисунок 1. Выделение микроорганизмов из загрязненной пестицидами почвы: а - сероземная почва; б - общий микробный пейзаж; с - суточная культура выделенной бактерии;

д - клетки, окрашенные по Грамму

Проведен первичный анализ MALDI - TOF MS. Для более точной идентификации была определена

нуклеотидная последовательность по методу 16 S rRNK (рисунок 2).

CTGATCC GCGA ТТА С ТА GC GA ТТСС А А СТТС A TGC A CTCGA GTTGC A GA GTGCA А ТСС GA A CTGA GA TGGCT TTTGGA GATTA G СТО А СА С ICG CGTGCTCGCTGCC СА С TGTCA СС А СС AITGTA GCA CG TGTGTA G ССС AGCCC GT A A GGGC СА TGA GGA С TTGA CGTCA ТСС CCA ССТТС СТС ТС GGCTTA ТСА С CGGC A GTC ССС ТТА GA GTGCC СА А СТ GA A TGCTGGCA А СТА A GGGCGA GGGTTGCGC 1С GTTGCGG GA СТТА А С CCA А СА ТСТС A CGA С A CGA GC TG A CGA CAGCCATGCAGCACCTCTCTCCGATCCAGCCGAACTGAAGGATAGTGTCTCCACTAACCGCGA GGC TGGTA A GGTICTGCGCGTTGCITCGAA ТТА A A CCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTrT GA GTTTTA А 1С TTGCGA С CGTA СТССС СА GGC GGA A TGTTTA A TGC GTTA GCTGCGC СА С CGA A GA GTA А А С ТССС СА A CGGCTA А СА ТТСА TCGTTTA CGGC GTGG А СТА CCA G GGTA ТСТА A TCCTGTITGCTCCC СА CG СГГТС GCA С СТ СА G CGTC A GTA A TGG ТСС A GTGA GCC GCCTTC GCC A CTGGTCTTC CTCCG А А ТА ТСТА CGA А ТТТС А ССТСТА СА СТ CGG А А ТТССА СТСА СС 1С ТА СС А ТА CIC A A GA С ТА А С A GTA ТСА A A GGCA GTTC СС GGGGTTGA GC ССС GGG

Рисунок 2. Нуклеотидная по

Данные о последовательности гена 16S рРНК штамма PDB-3 Ochrobactrum intermedium обрабатывали с использованием программного обеспечения Unigene Ver35 и Chromas, и пики с низким уровнем достоверности удаляли. Затем последовательности ДНК были подвергнуты BLAST против базы данных нуклеотидов NCBI. Очень похожие последовательности ДНК выравнивали с помощью программы

тельность штамма PDB - 3

MegaX и алгоритма ClustalW. Полученные результаты показали 100 % сходство с видом Ochrobactrum intermedium. Филогенетическое дерево было построено с использованием алгоритма Neighbor join в программе MegaX (рисунок 3).

Рисунок 3. Филогенетическое дерево шj

Было подтверждено, что данный штамм принадлежит к виду охробактрум, и принадлежит к таксономии группы охробактрумов. Таким образом, штамм Ochrobactrum intermedium PDB-3 показал очень близкое сходство - 100 (99,6) % к штаммам Ochrobactrum intermedium. Это свидетельствует о том, что изучаемый штамм действительно относится

Научная классификaция

памма Ochrobactrum intermedium PDB-3

к типу Ochrobactrum intermedium. Штамм был зарегистрирован в базе данных Национального центра биотехнологической информации (NCBI): GenBank: OL587509.1. Этот вид бактерий впервые был описан в 1998 году [9]. В таблице № 1 приведена научная классификация Ochrobactrum intermedium.

Таблица 1.

Ochrobactrum Intermedium

Царство Тип Класс Порядок Семейство Род Вид

Bacteria Proteobacteria Alpha Proteobacteria Rhizobiales Brucellaceae Ochrobactrum Ochrobactrum intermedium

На основании недавних исследований по сравнению геномов род Ochrobactrum был реклассифици-рован, а его виды включены в род Brucella [10, 11]. Известно, что Ochrobactrum intermedium разлагает многие загрязнители в том числе пестициды [12].

Выделенный нами штамм также показал хороший рост и размножение в среде с пестицидами.

Таким образом полученный штамм может служить основой для дальнейшего использования в процессе биоремедиации почв, загрязненных хлорпирифосом и циперметрином.

Список литературы:

1. Murugalatha N Kannan, Sonam Sethi, Anoop Badoni, Vinay Chamoli and Naveen Chandra Bahuguna. Isolation and characterization of bacterial isolates from agriculture field soil of Roorkee region. Journal of Pharmacognosy and Phytochemistry 2018; SP5: 108-110.

2. Kummerer K. Resistance in the environment. Journal of Antimicrobial Chemotherapy. 2004; 45:311-320.

3. Paul EA, Clark FE. Soil Microbiology and Biochemistry. 2nd Edition. New York. Academic press, 1996, 225-229.

4. Tuge AJ, Lewandowski AM. Soil Biology Primer [online]. Available: www.statlab.iastate.edu/survey/SQI/soil_biol-ogy_primer.htm November 4, 2010.

5. Т.Я. Ашихмина, А.В. Колупаев, А.А. Широких. Биотрансформatsiя пестицидов в наземных экосистемах (обзор литературы). Теоретическая и прикладная экология №2, 2010. Ст. 1 - 9.

№ 12 (114)

UNIVERSUM:

химия и биология

• 7universum.com

декабрь, 2023 г.

6. Т.Н. Волгина, В.Т. Новиков, Д.В. Регузова. Пути распространения пестицидов в объектах окружающей среды. региональные проблемы. 2010. Том 13, № 1. С. 76-81.

7. Нетрусов А.И., Егоров М.А., Захарчук Л.М. Практикум по микробиологии. -М.: Академия, 2005. С. 96-242.

8. A. de Lillo, F.P. Ashley, R.M. Palmer, M.A. Munson, L. Kyriacou, A.J. Weightman, W.G. Wade. Novel subgingival bacterial phylotypes detected using multiple universal polymerase chain reaction primer sets. Oral Microbiol Immunol 2006 Feb;21(1):61-8.

9. Julian Velasco, Conchi Romero, Ignacio Lopez-Got%, Jose Leiva, Ramon Diaz and Ignacio Moriyon.Evaluation of the relatedness of Brucella spp. and Ochrobactrum anthropi and description of Ochrobactrum intermedium sp. nov., a new species with a closer relationship to Brucella spp. International Journal of Systematic Bacteriology (1 998), 48,

10. Oren A, Garrity GM. 2020. List of new names and new combinations previously effectively, but not validly, published. Int J Syst Evol Microbiol 70: 4043-4049. https://doi.org/10.1099/ijsem.0.004244.

11. Hördt A, López MG, Meier-Kolthoff JP, Schleuning M, Weinhold L-M, Tindall BJ, Gronow S, Kyrpides NC, Woyke T, Göker M. 2020. Analysis of 1,000+ type-strain genomes substantially improves taxonomic classification of Alphaproteobacteria. Front Microbiol 11:468. https://doi.org/10.3389/fmicb.2020.00468.

12. Jiang B, Zhang N, Xing Y, Lian L, Chen Y, Zhang D, Li G, Sun G, Song Y. 2019. Microbial degradation of organ-ophosphorus pesticides: novel degraders, kinetics, functional genes, and genotoxicity assessment. Environ Sci Pollut Res Int 26:21668-21681. https://doi.org/10.1007/s11356-019-05135-9.

759-768.

i Надоели баннеры? Вы всегда можете отключить рекламу.