Научная статья на тему 'Влияние препарата Ингавирин® (имидазолилэтанамида пентандиовой кислоты) на интерфероновый статус клеток в условиях вирусной инфекции'

Влияние препарата Ингавирин® (имидазолилэтанамида пентандиовой кислоты) на интерфероновый статус клеток в условиях вирусной инфекции Текст научной статьи по специальности «Фундаментальная медицина»

CC BY
1864
87
Поделиться
Ключевые слова
ВИРУС ГРИППА / ПРОТИВОВИРУСНАЯ АКТИВНОСТЬ IN VITRO / ПРОТИВОВИРУСНЫЙ ПРЕПАРАТ / ИМИДАЗОЛИЛЭТАНАМИД ПЕНТАНДИОВОЙ КИСЛОТЫ / ПЕРЕДАЧА СИГНАЛА ИНТЕРФЕРОНА / INFLUENZA VIRUS / ANTIVIRAL ACTIVITY "IN VITRO" / ANTIVIRAL DRUG / IMIDAZOLYL ETHANAMIDE PENTANDIOIC ACID / INTERFERONE SIGNALLING

Аннотация научной статьи по фундаментальной медицине, автор научной работы — Ашахер Томас, Крохин Артем, Кузнецова Ирина, Ленгл Йоханнес, Небольсин Владимир

Ингавирин® (имидазолилэтанамид пентандиовой кислоты) оригинальный противовирусный препарат, который применяется в России в качестве лечебного и профилактического средства при гриппе и других острых респираторных вирусных заболеваниях. Нами установлено, что имидазолилэтанамид пентандиовой кислоты (ИПК), не являясь интерфероногеном, повышает синтез интерфероновых рецепторов IFNAR и способствует усилению чувствительности клеток к сигналам интерферона, которые подавляются фактором патогенности вируса гриппа неструктурным белком NS1. ИПК способен стимулировать выработку противовирусных эффекторных белков PKR и МхА в зараженных клетках, противодействуя супрессорному действию вируса гриппа в отношении системы интерферона. Теоретическое обоснование клинической эффективности препарата Ингавирин® может быть подтверждено полученными данными о влиянии на систему врожденного иммунитета в условиях вирусной инфекции.

Похожие темы научных работ по фундаментальной медицине , автор научной работы — Ашахер Томас, Крохин Артем, Кузнецова Ирина, Ленгл Йоханнес, Небольсин Владимир

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Effect of the preparation Ingavirin® (imidazolyl ethanamide pentandioic acid) on the interferon status of cells under conditions of viral infection

Ingavirin® (imidazolyl ethanamide pentandioic acid) is an original antiviral drug, which is used in Russia for treatment and profilaxis of influenza and other acute viral infections. We confirmed that imidazolyl ethanamide pentandioic acid (IEPA), not being interferon inducer itself, enhances synthesis of both interferon-a/fi receptors (IFNAR) to interferone and cell sensitivity to interferone signalling, which was suppressed by NS1 protein pathogen factor of influenza virus. IEPA is able to promote antiviral effector proteins PKR and MxA in infected cells, in opposition to interferon system suppression by influenza virus. Theoretical ground of clinical efficacy of Ingavirine® could be confirmed by obtained data of influence to innate immune system during viral infection.

Текст научной работы на тему «Влияние препарата Ингавирин® (имидазолилэтанамида пентандиовой кислоты) на интерфероновый статус клеток в условиях вирусной инфекции»

оригинальные исследования

ОРИГИНАЛЬНЫЕ ИССЛЕДОВАНИЯ

© КОЛЛЕКТИВ АВТОРОВ, 2016 УДК 615.281.8.015.44

Томас Ашахер1, Артем Крохин1, Ирина Кузнецова1, Йоханнес Ленгл1, Владимир Небольсин2, Андрей Егоров1, Михаэль Бергманн1

влияние препарата ингдвирин® (имиддзолилэтАндмидА пентандиовой кислоты) на интерфероновый статус клеток в условиях вирусной инфекции

1 Отделение хирургии Медицинского университета Вены, Вэрингер Гуртел 18-20, 1090 Вена, Австрия;

2 ООО «Фарминтерпрайсез», 119571, г. Москва, просп. Вернадского, д. 86, строение 5

Ингавирин® (имидазолилэтанамид пентандиовой кислоты) — оригинальный противовирусный препарат, который применяется в России в качестве лечебного и профилактического средства при гриппе и других острых респираторных вирусных заболеваниях. Нами установлено, что имидазолилэтанамид пентандиовой кислоты (ИПК), не являясь интерфероногеном, повышает синтез интерфероновых рецепторов IFNAR и способствует усилению чувствительности клеток к сигналам интерферона, которые подавляются фактором патогенности вируса гриппа — неструктурным белком NS1. ИПК способен стимулировать выработку противовирусных эффекторных белков PKR и МхА в зараженных клетках, противодействуя супрессорному действию вируса гриппа в отношении системы интерферона. Теоретическое обоснование клинической эффективности препарата Ингавирин® может быть подтверждено полученными данными о влиянии на систему врожденного иммунитета в условиях вирусной инфекции. Ключевые слова: вирус гриппа; противовирусная активность in vitro; противовирусный препарат; имидазолилэтанамид пентандиовой кислоты; передача сигнала интерферона. Для цитирования: Томас Ашахер, Артем Крохин, Ирина Кузнецова, Йоханнес Ленгл, Владимир Небольсин, Андрей Егоров, Михаэль Бергманн. Влияние препарата Ингавирин® (имидазолилэтанамида пентандиовой кислоты) на интерфероновый статус клеток в условиях вирусной инфекции. Эпидемиология и инфекционные болезни. 2016; 21(4): 196-205. DOI: 10.18821/1560-9529-2016-21-4-196-205 Thomas Aschacher1, Artem Krokhin1, Irina Kuznetsova1, Johannes Langle1, VladimirNebolsin2, Andrej Egorov1, Michael Bergmann1

effect of the antiviral drug ingavirin® (imidazolyl ethanamide pentandioic acid) on the interferon status of cells under conditions of viral infection

1 Medical University of Vienna, Waehringer Guertel 18-20, Vienna, Austria; 2LLC «Pharmenterprises»; 86, building 5, Vernadskogo Prospect, Moscow, 119571, Russian Federation

Ingavirin® (imidazolyl ethanamide pentandioic acid) is an original antiviral drug, which is used in Russia for treatment and profilaxis of influenza and other acute viral infections. We confirmed that imidazolyl ethanamide pentandioic acid (IEPA), not being interferon inducer itself, enhances synthesis of both interferon-a/ft receptors (IFNAR) to interferone and cell sensitivity to interferone signalling, which was suppressed by NS1 protein — pathogen factor of influenza virus. IEPA is able to promote antiviral effector proteins PKR and MxA in infected cells, in opposition to interferon system suppression by influenza virus. Theoretical ground of clinical efficacy of Ingavirine® could be confirmed by obtained data of influence to innate immune system during viral infection.

Keywords: influenza virus; antiviral activity «in vitro»; antiviral drug; imidazolyl ethanamide pentandioic acid; interferone signalling.

For citation: Thomas Aschacher, Artem Krokhin, Irina Kuznetsova, Johannes Langle, Vladimir Nebolsin, Andrej Egorov, Michael Bergmann. Effect of the antiviral drug Ingavirin® (imidazolyl ethanamide pentandioic acid) on the interferon status of cells under conditions of viral infection. Epidemiologiya i Infektsionnye Bolezni. (Epidemiology and Infectious Diseases, Russian journal). 2016; 21(4): 196-205. (In Russ.) DOI: 10.18821/1560-9529-2016-21-4-196-205

For correspondence: Andrej Egorov, PhD, Medical University of Vienna, waehringer Guertel 18-20, Vienna, Austria, E-mail: aevirol@gmail.com

Conflict of interest. The authors declare no conflict of interest.

Funding. The study had no sponsorship.

Received 06.06.2016 Accepted 20.06.2016

Для корреспонденции: Андрей Егоров, доктор биол. наук, e-mail: aevirol@gmail.com

Введение

Несмотря на глобальные усилия по контролю над заболеваемостью гриппом с помощью вакцинации, вирус гриппа преодолевает поствакцинальный

иммунитет за счет быстрой эволюции с помощью механизмов антигенного дрейфа и шифта [1]. До тех пор, пока не будет создана эффективная универсальная гриппозная вакцина, сохраняется необходимость в применении противовирусных препаратов, способных предотвратить летальность и число осложнений при гриппозной инфекции. Производные амантадина в этой роли заменяются ингибиторами нейраминидазы. Однако Samson и соавт. предупреждают, что и осельтамивир и ремантадин способны провоцировать селекцию вирусных вариантов, резистентных к их действию, что находит отражение в рекомендациях Всемирной организации здравоохранения по лечению вирусных заболеваний, в которых штаммы, резистентные к осель-тамивиру, выделены в отдельный раздел [2, 3]. Есть сведения о штаммах вируса, резистентных в эксперименте к занамивиру [4]. Согласно данным, полученными Tokasaki и соавт. [6], после применения ингибитора нейраминидазы осельтамивира, имеет место снижение активации факторов врожденного и адаптивного иммунитета; в связи с чем, после проведенного курса лечения, переболевшие гриппом могут иметь сниженные показатели выработки специфических антител: иммуноглобулинов G, секреторных IgA и Т-лимфоцитов [5]. Это подтверждается данными эпидемиологических исследований, которые показывают, что успешно проведенная терапия ингибиторами нейраминидазы в первый сезон может приводить к повторному заражению гриппозной инфекцией в последующие сезоны [6]. Разработанные в 80-х годах прошлого века препараты интерферона первого типа и индукторы их выработки могут оказывать профилактическое действие в отношении гриппозной инфекции [7, 8]. К сожалению, они менее пригодны для лечения гриппа, поскольку в момент проявления клинической картины в плазме крови больных уже присутствуют значительные концентрации интерферонов и других провоспалительных цитокинов. К тому же есть данные свидетельствующие о том, что на пике гриппозной инфекции интерфероны первого типа могут усиливать развитие патологии легких и способствовать развитию острого респираторного дистресс синдрома (ОРДС) [9]. Индукция интерферо-ногенеза врожденного иммунитета для активации синтеза внутриклеточных противовирусных белков может быть не единственным объектом для фармакологического воздействия на активацию противовирусных резервов организма.

Ингавирин® (имидазолилэтанамид пентандиовой кислоты) — оригинальный противовирусный препарат, разработанный в России, который воздействует на ключевые механизмы системы врожденного иммунитета, которые вирус использует для колонизации организма. Ингавирин® имеет подтвержденную в рандомизированных контролируемых ис-

ORIGINAL INVESTIGATIONS

следованиях эффективность в качестве лечебного и профилактического средства в отношении гриппа и ряда других респираторных инфекций [10—12]. Серия ранних поисковых экспериментов позволила установить, что он играет важную роль в индукции синтеза противовирусных внутриклеточных белков, таких как PKR (Protein Kinase RNA-activated, про-теинкиназа R) и белок MxA (Myxovirus resistAnce protein), обеспечивающих противовирусную защиту клеток [13]. Возможно, именно поэтому мы видим его эффективность в отношении различных респираторных вирусов, помимо гриппа. Мы изучили влияние имидазолилэтанамида пентандиовой кислоты (ИПК) на такие факторы врожденного иммунитета, как индукция генов интерфероновых рецепторов IFNAR, активацию белка STAT-1 (преобразователь сигналов от интерфероновых рецепторов) и синтез противовирусных эффекторных белков: протеинки-назы R (PKR) и белка МхА. Мы убедились, что ИПК восстанавливает сигнальный путь интерферона во время вирусной инвазии. Это позволяет выдвинуть гипотезу о том, что ИПК способствует индукции генов противовирусной защиты и синтеза противовирусных эффекторных белков, противодействуя иммуносупрессорному действию вируса.

Материалы и методы

В исследовании мы использовали фармакологическую субстанцию препарата Ингавирин® — имидазолилэтанамид пентандиовой кислоты. Субстанцию разводили в культуральной среде и добавляли в лунки планшета с культурой клеток. В работе указаны конечные концентрации вещества в культуральной среде.

Клетки и вирусы. В исследовании использовались альвеолярные эпителиальные клетки человека (А549) из ANSI аккредитованного ISO сертифицированного источника; они поддерживались в специализированной питательной среде, содержащей 10% инактивированную фетальную сыворотку теленка. Также использовались клетки MDcK (Madin-Darby canine kidney — линии клеток почки собаки), которые поддерживались в среде без содержания серы. Культура первичных эндотелиальных клеток человека была предоставлена проф. С. Brostjan (MUV, Вена, Австрия). Культура клеток Vero поддерживалась в бессывороточной среде. Все типы клеток инкубировались при температуре 37°С во влажной атмосфере, содержащей 5% С02.

Вирусы гриппа A/PuertoRico/8/34 (H1N1) (PR8wí) и его мутант delNS1, с делецией гена NS1, были накоплены и титровались методом бляшкоо-бразования в культуре клеток Vero.

Тест интерфероновой стимуляции синтеза МхА белка. Клетки A549 обрабатывали имидазо-лилэтанамидом пентандиовой кислоты (1 мг/мл) за 24 или 8 ч до лизиса клеток. Стимуляция синтеза

оригинальные исследования

МхА белка проводилась путем добавления в среду интерферона (ИФНа) за 8 ч до лизиса клеток. Клетки лизировали с помощью цвиттер-ионного детергента и хранили при температуре -80°С до проведения теста иммуноблота.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Индукция PKR. Клетки А549 заражались вирусом или вирусом delNS1 при множественности заражения МОИ - 3 и/или обрабатывались ИПК (0—10 мг/мл) за 8, 12, 16 или 24 ч до лизиса клеток. Клетки лизировали с помощью цвиттер-ионного детергента и хранили при температуре -80°С до проведения иммуноблота.

Иммуноблот. Лизаты клеток подвергали белковому электрофорезу в градиентном полиакриламид-ном геле с последующим переносом на нитроцеллю-лозную мембрану 0,45 мкм. Окрашивание мембраны проводили, используя мышиные поликлональные антитела к МхА белку, мышиные поликлональные антитела к фосфорилированной РКЯ и мышиные моноклональные антитела к Р-актину (для загрузочного контроля при иммуноблоте). Визуализация специфических полос проводилась с помощью антимышиных антител, меченных пероксидазой хрена IgG (1:1000) путем измерения хемилюминесценции мембран, используя максимально чувствительный субстрат для хемилюминесценции и соответствующий аппаратно-программный комплекс.

Иммунофлюоресценция. Клетки А549 выращивались на покровных стеклах в лунках 6-луночных панелей для тканевых культур. Клетки подвергались воздействию ИПК в течение 16 ч и затем фиксировались 2% параформальдегидом в течение 10 мин при комнатной температуре. После 3-кратной отмывки клетки обрабатывались блокирующим раствором, содержащим 0,5% бычий сывороточный альбумин и 0,3М глицином в фосфатном буферном растворе. После отмывки, проводилось определение рецепторов клеток к интерферону с помощью обработки мышиными моноклональными антителами к субъединицам IFNAR-1 или IFNAR-2 в блокирующем растворе в течение 2 ч. Визуализация связывания первичных антител проводилась после 3-кратной отмывки буфером, содержащим 0,05% неионный сур-фактант полисорбат 20, с помощью вторичных меченных антител, разведенных в блокирующем растворе в течение 60 мин при комнатной температуре. Конфокальная микроскопия оценивалась с помощью прецизионной цифровой обработки изображений с высококонтрастного флюоресцентного микроскопа.

Иммуноферментный анализ. Концентрации белков ИФНа, ИФНР, ИФНу в клеточных супер-натантах или интерлейкина-6 (ИЛ-6) определяли по протоколу ферментсвязанных иммуносорби-рующих эссе.

Экспрессия генов цитокинов в полимеразной цепной реакции (ПЦР) в режиме реального времени

Тотальную РНК выделяли из суспензии клеток и обрабатывали свободной от РНКаз ДНКазой. Реакцию обратной транскрипции проводили с помощью набора оптимизированных реагентов для первичного синтеза цепочки кДНК из тотальной РНК. В полученных образцах точно измеряли концентрацию кДНК. При проведении ПЦР в режиме реального времени для выявления мРНК IFNAR использовали специализированный набор реактивов на высокоточном автоматическом термоциклере. Для оценки экспрессии IFNAR проводили нормализацию по гену ß-актина, уровень экспрессии оценивали модифицированным методом DDCt (Pfafff, 2001). Последовательности праймеров: IFNAR1: CACTGACTGTATATTGTGTGAAAGCCAGAG (прямой), cATcTATAcTGGAAGAAGGTTTAAGT-GATG (обратный); IFNAR2: ATTTCCGGTCCATC-TTATCAT (прямой), ACTGAACAACGTTGTG-TTCC (обратный); ß-актин: ACATGGAGAA-AAATcTGGcAc (прямой), GTAGcAcAGcTTc-TccTTAATGT (обратный).

Для оценки экспрессии мРНК цитокинов клетки А549 инкубировали с вирусом и/или ИПК в течение 8, 16 и 24 ч. При проведении ПЦР в режиме реального времени 1 мкг тотальной РНК подвергали обратной транскрипции со случайных праймеров (чтобы убедиться, что синтез цепочки успешно пройдет со всеми присутствующими вариантами молекул РНК). ПЦР проводили с использованием высокочувствительных и высокоспецифичных наборов премиксов в 384-луночных планшетах. Дизайн праймеров, использованных в реакции с асимметричным цианиновым красителем, был выполнен предварительно, с помощью специализированного программного обеспечения. Валидацию ПЦР-системы проводили с помощью высокочувствительной панели культуры тканей. Последовательности праймеров: GAPDH: CGGGTCAACGGATTTGGTC (прямой), TGGcAAcAATATccAcTTTAccAG (обратный); IL1B: GTACCTGAGCTCGCCAGTGA (прямой), TcGGAGATTcGTAGcTGGATG (обратный); IL6: GTACATCCTCGACGGCATCTC (прямой), GGCAAGTCTCCTCATTGAATC (обратный); CCL2: GCTCATAGCAGCCACCTTCA (прямой), ACAATGGTCTTGAAGATCACAGC (обратный); CCL5: CCCAGCAGTCGTCTTTGTCA (прямой), TGATGTACTCCCGAACCCATTT (обратный); TGFB1: TGGACATCAACGGGTTCACTAC (прямой), CCGGTTCATGCCATGAATG (обратный); TNF: ATGTTGTAGCAAACCCTCAAGCT (прямой), TTGGCCAGGAGGGCATT (обратный).

Уровень флюоресценции измеряли в режиме реального времени на автоматическом оборудовании методом ПЦР с валидированным программным обеспечением. Результаты получили с использованием метода DDCt как относительное количество

ORIGINAL INVESTIGATIONS

копии, соотнесенное к контролю не стимулированных клеток и нормализованное к среднему геометрическому значению для четырех эндогенных генов EEF1A1, UBC, GAPDH, и HPRT1 20.

Результаты

Влияние имидазолилэтанамида пентандио-вой кислоты на выработку интерферонов первого типа

Для исследования воздействия ИПК на выработку интерферонов а/р первого типа использовались изолированные из донорской крови периферические моноядерные клетки (PBMC), первичная культура фибробластов человека или перевиваемая культура клеток легочного эпителия А-549. Контрольные неинфицированные или инфицированные вирусом гриппа клетки обрабатывали ИПК в диапазоне концентраций от 10 до 10000 нг/мл. Вирусная инфекция осуществлялась штаммом PR8 или его вариантом с делетированным NS1 геном — DelNSl, известного способностью индуцировать интерферон [14, 15]. Оценку выработки интер-феронов первого и третьего типов проводили через 24—48 ч после инфекции или добавления препарата, используя метод иммуноферментного анализа. Оказалось, что ИПК не обладал способностью индуцировать выработку интерферонов а и в в культуре клеток и не оказывал существенного влияния на интерфероногенные свойства использованных вирусов ни на какой из исследованных культур клеток, независимо от концентраций препарата. На рис. 1 представлены данные о выработке интер-феронов первого типа первичными человеческими клетками. Видно, что только вирус, лишенный NS1, обладал интерфероногенной активностью.

При исследовании индукции генов (количественная ПЦР) интерферонов и провоспалительных ци-токинов в клетках А549 после их обработки ИПК, нами не было выявлено достоверного увеличения количества копий соответствующих мРНК ИЛ-6, МХБ-1 (моноцитарный хемоатрактантный белок 1), ТФРР (трансформирующий фактор роста бета) и RANTES (хемокин, экспрессируемый и секрети-руемый T-клетками при активации), ИФНа, ИФНр, ИЛ1в и ФНО (фактора некроза опухоли) (рис. 2).

Таким образом, имидазолилэтанамида пентан-диовой кислоты не обладал интерфероногенными свойствами в опытах in vitro.

Влияние имидазолилэтанамид пентандио-вой кислоты на синтез противовирусных эф-фекторных белков в клеточной культуре при наличии вирусной инфекции

Следующим этапом мы исследовали влияние ИПК на синтез и активацию внутриклеточных белков, вовлеченных в развитие противовирусного статуса клеток — белков PKR и МхА в культуре клеток при наличии вирусной инфекции.

350 с- 300 Д. 250 о. 200

В 150

I 100

S 50

о

<f

#

250

200

Ь В

I

150

100

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

50

Jf

150-,

s 100-

Q.

а£

В

I s 50-

S

А4

/ ^

<f

jp г

ш ш

®

J

у5

Рис. 1. Выработка интерферонов первого типа при стимуляции клеток вирусами гриппа и/или имидазолилэтанамидом пентандиовой кислоты.

а — выработка ИФНр человеческими фибробластами через 12 ч после стимуляции, б — выработка ИФНа человеческими мононуклеарными клетками периферической крови супернатант(МКПК СН) через 8 ч после стимуляции, в — выработка ИФНр человеческими МКПК СН через 8 ч после стимуляции. Вирусы: wt — вирус A/PR/8/34 дикого типа, delNS1 — вирус PR8 с удаленным NS1 геном; mock — нестимулированные клетки.

Синтез или активация белков PKR и МхА подавляются вирусом гриппа с помощью неструктурного белка NS1 [16—18]. Поэтому в качестве контроль-

оригинальные исследования

Рис. 2. Влияние имидазолилэтанамида пентандиовой кислоты и вирусной инфекции на экспрессию матричных РНК цитокинов в клетках A549. Группы стимуляции клеток вирусами, отдельно или в комбинации, обозначены на графике с ФНОа. mock — нести-мулированные клетки, wt — вирус A/PR/8/34 дикого типа, delNS 1 — вирус PR8 с удаленным NS1 геном. Тип цитокина обозначен на каждом графике сверху. Представленные данные являются средними значениями трех независимых ПЦР.

ных вирусов использовались следующие штаммы вируса гриппа: А/РГ/8/34 дикого типа (РГ8^) и его вариант с удаленным №1 геном Мутант-

ный вирус DelNS1 не способен ингибировать систему врожденного иммунитета и поэтому является

дефектным при репродукции в клетках животных, имеющих полноценную систему интерферона [19].

На рис. 3 и 4 представлены данные иммунобло-тов (Western blot), характеризующие накопление протеинкиназы-R и белка МхА после стимуляции

ORIGINAL INVESTIGATIONS

Рис. 3. Индукция фосфорилированных форм РКГ и р-актина в клетках А549 в ответ на стимуляцию имидазолилэтанамидом пентандиовой кислоты (1 мкг/л), вирусной инфекцией или их комбинацией. Молекулы факторов врожденного иммунитета РКГ и р-актин (обозначены слева) визуализированы с помощью специфических антител. Временные точки обозначены сверху.

клеток А-549. Мы наблюдали полное подавление вирусом дикого типа РЯ8 накопления активной (фосфорилированной) формы РКГ. Мутантный вирус DelNS1, напротив, оказывал сильное стимулирующее действие на активацию РКГ. В отсутствие вирусной инфекции ИПК оказывал слабое влияние на синтез фосфорилированной РКГ, незначительно повышая его уровень через 24 ч. При обработке ИПК клеток, инфицированных вирусом дикого типа, происходило увеличение уровня накопления фосфорилированной РКГ в вирус-инфицированных клетках до уровня, характерного для DelNS1 вируса. Таким образом, ИПК оказывал компенсаторное действие при супрессии РКГ вирусом дикого типа.

В отношении МхА белка наблюдалась схожая закономерность. Инфекция клеток вирусом дикого типа незначительно стимулировала синтез белка МхА, однако при добавлении в культуральную среду ИПК значительно увеличивался синтез МхА (рис. 4).

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Влияние имидазолилэтанамида пентандиовой кислоты на передачу сигнала интерферона

Индукция МхА белка всецело зависит от восприятия и проведения сигналов от поверхностных интерфероновых рецепторов в ядро клетки через систему белков Jak-STAT [20, 21]. Рецепторы интерферона состоят из двух субъединиц IFNAR-1 и IFNAR-2, которые формируют гетеродимерные молекулы [22]. Была исследована гипотеза, что Ингавирин® в начальной стадии инфекции может способствовать прохождению сигнала интерферона, ослабленного действием вируса. В качестве модели в количественной ПЦР был измерен уровень экспрессии мРНК указанных субъединиц интерфе-роновых рецепторов под воздействием имидазо-лилэтанамида пентандиовой кислоты в условиях вирусной инфекции и без неё. ИПК достоверно усиливал экспрессию мРНК субъединицы IFNAR2 и компенсировал иммуносупрессорное действие

Концентрация, Ингавирин , в мкг/мл

0 0,3 1 10 30 О 0,3 1 10 30

МхА

Не инфицированные клетки

Инфицированные клетки

Рис. 4. Индукция синтеза МхА белка в клетках А549. Инфицированные или не инфицированные вирусом группа PR8wt клетки подвергались одновременной обработке имидазолилэтанамидом пентандиовой кислоты в указанных концентрациях. Визуализация синтеза МхА белка осуществлялась с помощью антител в иммуноблоте через 24 ч.

оригинальные исследования

Рис. 5. Влияние имидазолилэтанамида пентандиовой кислоты на синтез субъединиц рецепторов интерферона в клетках А-549. а — экспрессия мРНК субъединиц П^АИ и IFNAR2 через 16 ч после стимуляции клеток препаратом ИПК; б — иммуноф-люоресцентный анализ поверхностной экспрессии белков субъединиц 1ЕМАГ-1 и 1ЕМАГ-2 через 24 ч после обработки клеток препаратом ИПК.

вируса гриппа в отношении субъединицы 1Е№АЛ (рис. 5, а). Иммунофлюоресцентный анализ экспрессии йКАП и на поверхности клеток А-549 (рис. 5, б) демонстрирует увеличение плотности итерфероновых рецепторов на поверхности клеток под влиянием имидазолилэтанамида пен-тандиовой кислоты.

На следующем этапе исследования было проведено изучение влияния ИПК на активацию (фосфорилирование) цитоплазматического белка STAT-1, являющегося ключевым передаточным звеном сигнала интерферона от рецептора к факторам транскрипции генов, стимулируемых интерфероном. На рис. 6 видно, что ИПК, в отличие от рекомбинантного интерферона в отсутствии вирусного стимула не способствовал активации STAT-1. ИПК усиливал фосфорилирование STAT-1 в клетках, инфицированных вирусом дикого типа по сравнению с клетками, не обработанных ИПК.

Таким образом, ИПК заметно компенсировал су-прессорное действие вируса на активацию белка STAT-1.

Для прямого измерения интерферонового статуса клетки А-549 были обработаны низкими концентрациями ИФНа, которые в норме не вызывают индукцию МхА. На рис. 7 показано, что обработка клеток 1 МЕ рекомбинантного интерферона-а не приводила к синтезу МхА белка. В то же время добавление в клеточную среду 1 мкг/мл имидазолилэтанамида пентандиовой кислоты способствовало появлению МхА специфических полос в иммуноблоте уже через 8 ч после начала стимуляции.

Таким образом, в результате серии экспериментов было показано, что имидазолилэтанамид пентандиовой кислоты способен усиливать транс-дукцию слабого сигнала интерферона путем активации синтеза компонентов интерфероновых ре-

2 часа 4 часа 6 часов 12 часов

А Б В Г АБВГАБВГ АБВГ

Рис. 6. Эффект имидазолилэтанамида пентандиовой кислоты на фосфорилирование БТАЛ. Клетки А549 были обработаны: а — только препаратом ИПК 1 мкг/мл; б — интерфероном-а 5 МЕ/мл; в — вирусом РГВ^!; г — вирусом РГВ^! и ИПК одновременно. Визуализация 8ТАТ1 в иммуноблоте проводилась через 16 ч после стимуляции клеток.

ORIGINAL INVESTIGATIONS

Интерферон Время, ч Ингавирин®

24

+

1 ME ЮМЕ

8 24 8 24

+ + - + +

[ 1 1 1 1 , L A ,

- 31 •1

МхА

Рис. 7. Индукция минтеза МхА белка в клетках А-549 под воздействием интерферона. Клетки обрабатывали рекомбинантным интерфероном а в присутствии или отсутствии имидазолилэтанамида пентандиовой кислоты (1 мкг/мл). Синтез МхА белка определяли в иммуноблоте через 8 или 24 ч.

цепторов, приводящую к накоплению интерферон-зависимого белка МхА.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Обсуждение

Ингавирин® (имидазолилэтанамид пентандиовой кислоты ) широко применяется в России в качестве антивирусного средства при респираторных инфекциях различной этиологии [23—25].

Целью данного исследования являлось доказательство гипотезы о воздействии препарата Ин-гавирин® на проведение сигнала интерферона в клетках, пораженных вирусом, и компенсаторного восстановления синтеза противовирусных белков PKR и MxA. В нашем эксперименте имидазоли-лэтанамид пентандиовой кислоты не приводил к экспрессии матричных РНК, провоспалительных цитокинов и хемокинов в обработанных клетках различной природы.

Действие препарата Ингавирин® in vitro было продемонстрировано на фоне вирусной инфекции. При заражении клеток вирусом гриппа дикого типа, на ранних этапах инфекции, происходит ограниченная выработка интерферонов и других факторов врожденного иммунитета ввиду имму-носупрессорного действия белка NS1, блокирующего дальнейший иммунологический ответ [16]. Добавление ИПК в культуральную среду клеток, зараженных вирусом гриппа PR8, способствовало существенному увеличению активной формы pP-KR и синтеза белка МхА, подавляемых вирусом. Накопление указанных белков в цитоплазме зараженных клеток может приводить к замедлению или остановке вирусной репродукции вследствие блокирования трансляции вирусных белков активированной PKR и нарушению транспортировки рибонуклеопротеиновых комплексов вируса при взаимодействии с МхА. Таким образом, препарат демонстрирует компенсацию иммуносупрессор-ного действия белка NS1 на систему интерферон-зависимых генов и белков клетки, модифицируя иммунологический ответ на вирусную инвазию.

Исследование механизма действия на стимуляцию синтеза и активацию противовирусных

белков в условиях вирусной инфекции при использовании ИПК, показало увеличение синтеза интерфероновых рецепторов и повышение чувствительности клеток к сигналам рекомбинант-ного интерферона-a. Полученные результаты свидетельствуют о том, что имидазолилэтанамид пентандиовой кислоты повышает чувствительность клеток к сигналам системы врожденного иммунитета, какими являются интерфероны первого типа.

Полученные результаты подтвердили гипотезу о том, что введение препарата Ингавирин® усиливает ослабленную вирусом передачу интерферо-нового сигнала внутри клетки, что может объяснить повышение способности клеток к раннему распознаванию вирусной инфекции и формированию антивирусного статуса эпителиальных клеток, ведущему к ограничению распространения вируса во время инкубационного периода. Важной находкой является тот факт, что усиление интерферонового сигналинга происходит только в эпителиальных клетках пораженных вирусом. Избирательность и выборочность воздействия может объяснить высокий профиль безопасности и хорошую переносимость препарата Ин-гавирин® в клинике. Избирательность действия гарантирует эффективность, высокий профиль безопасности и хорошую переносимость препарата Ингавирин®.

Дальнейшие исследования помогут определить другие возможные эффекты препарата Ингави-рин® на фоне развернутой клинической картины респираторной вирусной инфекции.

ЛИТЕРАТУРА

1. Bouvier N.M., Palese P. The biology of influenza viruses. Vaccine. 2008; 26 (Suppl. 4):D49-53. PubMed PMID: 19230160; PubMed Central PMCID: PMC3074182.

2. Samson M., Pizzorno A., Abed Y., Boivin G. Influenza virus resistance to neuraminidase inhibitors. Antiviral Res. 2013; 98(2): 174—85. doi: 10.1016/j.antiviral.2013.03.014. PubMed PMID: 23523943.

3. WHO Guidelines forPharmacologicalManagement of Pandemic Influenza A(H1N1) 2009 and Other Influenza Viruses. WHO

оригинальные исследования

Guidelines Approved by the Guidelines Review Committee. Geneva; 2010.

4. Little K. et al. Zanamivir-resistant influenza viruses with Q136K or Q136R neuraminidase residue mutations can arise during MDCK cell culture creating challenges for antiviral susceptibility monitoring. Euro Surveill. 2015; 20(45). doi: 10.2807/1560-7917.ES.2015.20.45.30060

5. Takahashi E., Kataoka K., Fujii K., Chida J., Mizuno D., Fukui M. et al. Attenuation of inducible respiratory immune responses by oseltamivir treatment in mice infected with influenza A virus. Microbes Infect. 2010; 12(10): 778—83. doi: 10.1016/j. micinf.2010.04.013. PubMed PMID: 20452454.

6. Shinahara W., Takahashi E., Sawabuchi T., Arai M., Hirotsu N., Takasaki Y. et al. Immunomodulator clarithromycin enhances mucosal and systemic immune responses and reduces reinfection rate in pediatric patients with influenza treated with antiviral neuraminidase inhibitors: a retrospective analysis. PLoS One. 2013; 8(7): e70060. doi: 10.1371/journal.pone.0070060. PubMed PMID: 23875018; PubMed Central PMCID: PMCPMC3714257.

7. Ершов Ф.И., Наровлянский А.Н. Использование индукторов интерферона при вирусных инфекциях. Вопр. вирусол. 2015; 60(2): 5—10.

8. Trinchieri G. Type I interferon: friend or foe? J. Exp. Med. 2010; 207(10): 2053—63. doi: 10.1084/jem.20101664. PubMed PMID: 20837696; PubMed Central PMCID: PMCPMC2947062.

9. Davidson S., Crotta S., McCabe T.M., Wack A. Pathogenic potential of interferon alphabeta in acute influenza infection. Nat. Commun. 2014; 5: 3864. doi: 10.1038/ncomms4864. PubMed PMID: 24844667; PubMed Central PMCID: PMCPMC4033792.

10. Шульдяков А.А., Ляпина Е.П., Кузнецов В.И., Зрячкин Н.И., Ситников И.Г., Перминова О.А. и др. Новые возможности терапии острых респираторных вирусных инфекций у детей. Вопросы практической педиатрии. 2015; 10(5): 21—8.

11. Геппе Н.А., Рейхарт Д.В., Небольсин В.Е., Голубев А.В., Арнаутов В.С. Оценка эффективности и безопасности препарата Ингавирин®: клинические результаты двойного слепого рандомизированного плацебо-контролируемого многоцентрового исследования III фазы по оценке клинической эффективности и безопасности препарата Ингавирин®, в суточной дозе 60 мг, однократно, для лечения гриппа и других ОРВИ у детей в возрасте 7—12 лет. Участковый педиатр. 2015; (4).

12. Колобухина Л.В., Меркулова Л.Н., Григорян С.С., Щелканов М.Ю., Оспельникова Т.П., Гусева О.А. и др. Эффективность и безопасность препарата Ингавирин® в лечении гриппа и других ОРВИ у взрослых. Справочник поликлинического врача. 2010; (9).

13. Levy D.E., Garcia-Sastre A. The virus battles: IFN induction of the antiviral state and mechanisms of viral evasion. Cytokine Growth Factor Rev. 2001; 12(2-3): 143—56. PubMed PMID: 11325598.

14. Ferko В., Stasakova J., Romanova J., Kittel C., Sereinig S., Katinger H. et al. Immunogenicity and protection efficacy of replication-deficient influenza A viruses with altered NS1 genes. J. Virol. 2004; 78(23): 13037—45. doi: 10.1128/JVI.78.23.13037-13045.2004. PubMed PMID: 15542655; PubMed Central PMCID: PMCPMC524997.

15. Stasakova J., Ferko В., Kittel C., Sereinig S., Romanova J., Katinger H. et al. Influenza A mutant viruses with altered NS1 protein function provoke caspase-1 activation in primary human macrophages, resulting in fast apoptosis and release of high levels of interleukins 1beta and 18. J. Gen. Virol. 2005; 86(Pt 1): 185— 95. doi: 10.1099/vir.0.80422-0. PubMed PMID: 15604446.

16. Hale B.G., Randall R.E., Ortin J., Jackson D. The multifunctional NS1 protein of influenza A viruses. J. Gen. Virol. 2008; 89(Pt 10): 2359—76. doi: 10.1099/vir.0.2008/004606-0. PubMed PMID: 18796704.

17. Geiss G.K., Salvatore M., Tumpey T.M., Carter V.S., Wang X., Basler C.F. et al. Cellular transcriptional profiling in influenza A virus-infected lung epithelial cells: the role of the nonstructural NS1 protein in the evasion of the host innate defense and its potential contribution to pandemic influenza. Proc. Natl. Acad. Sci. USA. 2002; 99(16): 10736—41. doi: 10.1073/ pnas.112338099. PubMed PMID: 12149435; PubMed Central PMCID: PMCPMC125029.

18. Egorov A., Brandt S., Sereinig S., Romanova J., Ferko В., Katinger D. et al. Transfectant influenza A viruses with long deletions in the NS1 protein grow efficiently in Vero cells. J. Virol. 1998; 72(8): 6437—41. PubMed PMID: 9658085; PubMed Central PMCID: PMCPMC109801.

19. Garcia-Sastre A., Egorov A., Matassov D., Brandt S., Levy

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

D.E., Durbin J.E. et al. Influenza A virus lacking the NS1 gene replicates in interferon-deficient systems. Virology. 1998; 252(2): 324—30. PubMed PMID: 9878611.

20. Haller O., Kochs G. Human MxA protein: an interferon-induced dynamin-like GTPase with broad antiviral activity. J. Interferon Cytokine Res. 2011; 31(1): 79—87. doi: 10.1089/jir.2010.0076. PubMed PMID: 21166595.

21. Horvath C.M. The Jak-STAT pathway stimulated by interferon alpha or interferon beta. Sci. STKE. 2004; 2004(260): tr10. doi: 10.1126/stke.2602004tr10. PubMed PMID: 15561979.

22. de Weerd N.A., Samarajiwa S.A., Hertzog P.J. Type I interferon receptors: biochemistry and biological functions. J. Biol. Chem. 2007; 282(28): 20053—7. doi: 10.1074/jbc.R700006200. PubMed PMID: 17502368.

23. Колобухина Л.В., Меркулова Л.Н., Щелканов М.Ю., Бурцева

E.И., Лаврищева В.В., Самохвалов Е.И. и др. Пандемический грипп в России: отличительные особенности клинического течения и отсутствие ранней этиотропной терапии как фактор риска развития тяжелых форм заболевания. Тер. арх. 2011; (9): 48—53.

24. Колобухина Л.В., Щелканов М.Ю., Меркулова Л.Н., Базарова М.В., Бурцева Е.И., Самохвалов Е.И. и др. Этиотропная терапия гриппа: уроки последней пандемии. Вестн. РАМН. 2011; (5): 35—40.

25. Шульдяков А.А., Ляпина Е.П., Кузнецов В.И. Современные принципы химиопрофилактики острых респираторных вирусных инфекций. Тер. арх. 2013; (11): 27—33.

REFERENCES

1. Bouvier N.M., Palese P. The biology of influenza viruses. Vaccine. 2008; 26 (Suppl. 4):D49-53. PubMed PMID: 19230160; PubMed Central PMCID: PMC3074182.

2. Samson M., Pizzorno A., Abed Y., Boivin G. Influenza virus resistance to neuraminidase inhibitors. Antiviral Res. 2013; 98(2): 174—85. doi: 10.1016/j.antiviral.2013.03.014. PubMed PMID: 23523943.

3. WHO Guidelinesfor Pharmacological Management of Pandemic Influenza A(H1N1) 2009 and Other Influenza Viruses. WHO Guidelines Approved by the Guidelines Review Committee. Geneva; 2010.

4. Little K. et al. Zanamivir-resistant influenza viruses with Q136K or Q136R neuraminidase residue mutations can arise during MDCK cell culture creating challenges for antiviral susceptibility monitoring. Euro Surveill. 2015; 20(45). doi: 10.2807/1560-7917.ES.2015.20.45.30060

5. Takahashi E., Kataoka K., Fujii K., Chida J., Mizuno D., Fukui M. et al. Attenuation of inducible respiratory immune responses by oseltamivir treatment in mice infected with influenza A virus. Microbes Infect. 2010; 12(10): 778—83. doi: 10.1016/j. micinf.2010.04.013. PubMed PMID: 20452454.

6. Shinahara W., Takahashi E., Sawabuchi T., Arai M., Hirotsu N., Takasaki Y. et al. Immunomodulator clarithromycin enhances mucosal and systemic immune responses and reduces re-infection

rate in pediatric patients with influenza treated with antiviral neuraminidase inhibitors: a retrospective analysis. PLoS One. 2013; 8(7): e70060. doi: 10.1371/journal.pone.0070060. PubMed PMID: 23875018; PubMed Central PMCID: PMCPMC3714257.

7. Ershov F.I., Narovlyansky A.N. [Usage of interferon inducers during viral infections]. Vopr. virusol. 2015; 60(2): 5—10. PubMed PMID: 26182650.

8. Trinchieri G. Type I interferon: friend or foe? J. Exp. Med. 2010; 207(10): 2053—63. doi: 10.1084/jem.20101664. PubMed PMID: 20837696; PubMed Central PMCID: PMCPMC2947062.

9. Davidson S., Crotta S., McCabe T.M., Wack A. Pathogenic potential of interferon alphabeta in acute influenza infection. Nat. Commun. 2014; 5: 3864. doi: 10.1038/ncomms4864. PubMed PMID: 24844667; PubMed Central PMCID: PMCPMC4033792.

10. Sheldyukov A.A., Lyapina E.P., Kuznetsov V.I., Zryachkin N.I., Sitnikov I.G., Perminova O.A. et al. New opportunities for acute viral infections therapy in children. Voprosy prakticheskoy pediatrii. 2015; 10(5): 21—8. (in Russian)

11. Geppe N.A., Reykhart D.V., Nebol'sin V.E., Golubev A.V., Arnautov V.S. Evaluation of efficasy and safety of Ingavirin®: clinical results of double-blind phase III randomised, placebo-controlled, multicenter trial for evaluation of efficasy and safety of Ingavirin®, 60 mg daily, for treatment of Influenza and other acute respiratory infections in children aged 7—12. Uchastkovyy pediatr. 2015; (4). (in Russian)

12. Kolobukhina L.V., Merkulova L.N., Grigoryan S.S., Schelkanov M.Yu., Ospel'nikova T.P., Guseva O.A. et al. Efficasy and safety of Ingavirin for treatment of Influenza and other acute viral infections in adults. Spravochnikpoliklinicheskogo vracha. 2010; (9).

13. Levy D.E., Garcia-Sastre A. The virus battles: IFN induction of the antiviral state and mechanisms of viral evasion. Cytokine Growth Factor Rev. 2001; 12(2-3): 143—56. PubMed PMID: 11325598.

14. Ferko B., Stasakova J., Romanova J., Kittel C., Sereinig S., Katinger H. et al. Immunogenicity and protection efficacy of replication-deficient influenza A viruses with altered NS1 genes. J. Virol. 2004; 78(23): 13037—45. doi: 10.1128/JVI.78.23.13037-13045.2004. PubMed PMID: 15542655; PubMed Central PMCID: PMCPMC524997.

15. Stasakova J., Ferko B., Kittel C., Sereinig S., Romanova J., Katinger H. et al. Influenza A mutant viruses with altered NS1 protein function provoke caspase-1 activation in primary human macrophages, resulting in fast apoptosis and release of high levels of interleukins 1beta and 18. J. Gen. Virol. 2005; 86(Pt 1): 185— 95. doi: 10.1099/vir.0.80422-0. PubMed PMID: 15604446.

16. Hale B.G., Randall R.E., Ortin J., Jackson D. The multifunctional

ORIGINAL INVESTIGATIONS

NS1 protein of influenza A viruses. J. Gen. Virol. 2008; 89(Pt 10): 2359—76. doi: 10.1099/vir.0.2008/004606-0. PubMed PMID: 18796704.

17. Geiss G.K., Salvatore M., Tumpey T.M., Carter V.S., Wang X., Basler C.F. et al. Cellular transcriptional profiling in influenza A virus-infected lung epithelial cells: the role of the nonstructural NS1 protein in the evasion of the host innate defense and its potential contribution to pandemic influenza. Proc. Natl. Acad. Sci. USA. 2002; 99(16): 10736—41. doi: 10.1073/ pnas.112338099. PubMed PMID: 12149435; PubMed Central PMCID: PMCPMC125029.

18. Egorov A., Brandt S., Sereinig S., Romanova J., Ferko B., Katinger D. et al. Transfectant influenza A viruses with long deletions in the NS1 protein grow efficiently in Vero cells. J. Virol. 1998; 72(8): 6437—41. PubMed PMID: 9658085; PubMed Central PMCID: PMCPMC109801.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

19. Garcia-Sastre A., Egorov A., Matassov D., Brandt S., Levy D.E., Durbin J.E. et al. Influenza A virus lacking the NS1 gene replicates in interferon-deficient systems. Virology. 1998; 252(2): 324—30. PubMed PMID: 9878611.

20. Haller O., Kochs G. Human MxA protein: an interferon-induced dynamin-like GTPase with broad antiviral activity. J. Interferon Cytokine Res. 2011; 31(1): 79—87. doi: 10.1089/jir.2010.0076. PubMed PMID: 21166595.

21. Horvath C.M. The Jak-STAT pathway stimulated by interferon alpha or interferon beta. Sci. STKE. 2004; 2004(260): tr10. doi: 10.1126/stke.2602004tr10. PubMed PMID: 15561979.

22. de weerd N.A., Samarajiwa S.A., Hertzog P.J. Type I interferon receptors: biochemistry and biological functions. J. Biol. Chem. 2007; 282(28): 20053—7. doi: 10.1074/jbc.R700006200. PubMed PMID: 17502368.

23. Kolobukhina L.V., Merkulova L.N., Shchelkanov M.Yu., Burtseva E.I., Lavrishcheva V.V., Samokhvalov E.I. et al. Pandemic influenza in Russia: specific features of clinical course and the absence of early etiotropic therapy as a risk factor of severe forms of the disease. Ter. arkh. 2011; 83(9): 48—53. PubMed PMID: 22145388. (in Russian)

24. Kolobukhina L.V., Shchelkanov M.Yu., Merkulova L.N., Bazarova M.V., Burtseva E.I., Samokhvalov E.I. et al. Etiotropic therapy of influenza: lessons from the last pandemic. Vestn. RAMN. 2011; (5): 35—40. PubMed PMID: 21786595.

25. Shul'dyakov A.A., Liapina E.P., Kuznetsov V.I. Current principles in the chemoprophylaxis of acute respiratory viral infections. Ter. arkh. 2013; 85(11): 27—33. PubMed PMID: 24432596. (in Russan)

Поступила 06.06.2016