CC BY
89
" I 'I '' 1
The Role of Human Genetic in the Natural Selection of Hepatitis in Ethnically Close Populations of Buryat
DOI: 10.17691/stm2018.10.3.3 Received January 10, 2018
S.I. Malov, MD, PhD, Assistant, Department of Infectious Diseases1; O. Baatarkhuu, PhD, Head of the Department of Infectious Diseases2;
0.B. Ogarkov, MD, DSc, Head of the Department of Epidemiology and Microbiology3; S. Ariunaa, MD, Hepatologist, Hepatology Unit4;
J. Baigalmaa, PhD, Epidemiologist, Department of Field Epidemiology and Training4; B. Davaakhuu, MD, Hepatologist, Hepatology Unit4;
D. Munk-Orshikh, Student2;
J. Ouynbileg, PhD, Virologist, Leading Specialist and Consultant on Biotechnologies5; L.A. Stepanenko, PhD, Senior Researcher, Research Institute of Biomedical Technologies1;
E.D. Savilov, MD, DSc, Professor, Chief Researcher3; Head of the Department of Epidemiology and Microbiology6;
L.V. Zherbanova, PhD, Head of the Republican Center of Hepatology7; T.A. Symbelova, MD, Head Physician7;
1.V. Malov, MD, DSc, Professor, Head of the Department of Infectious Diseases1
Irkutsk State Medical University, 1 Krasnogo Vosstaniya St., Irkutsk, 664003, Russia; 2Mongolian National University of Medical Sciences, 3 S. Zorig St., Ulaanbaatar, 14210, Mongolia; 3Scientific Center of Family Health Problems and Human Reproduction, 16 Timiryazeva St., Irkutsk, 664003, Russia;
"National Center for Communicable Diseases, Nam Yan Ju St., Bayanzurkh, Ulaanbaatar, 210648, Mongolia; 5National Center for Public Health, Mira St., Bayanzurkh, Ulaanbaatar, Mongolia; 6Irkutsk State Medical Academy of Postgraduate Education, a Branch of the Russian Medical Academy of Continuing Professional Education, 100 Yubileyny Microdistrict, Irkutsk, 664049, Russia; 7Republican Clinical Infectious Hospital, 9a Pirogova St., Ulan-Ude, Republic of Buryatia, 670047, Russia
The aim of the study was to assess the role of the innate immunity gene polymorphism in the population selection of hepatitis C virus (HCV) genotypes circulating in the ethnically close groups of Mongoloids: Buryats and Khalkha-Mongols.
Materials and Methods. Nucleotide polymorphisms of innate immunity genes were identified in 400 patients with chronic hepatitis C, including 200 people belonging to the ethnic group of Mongols living in Ulaanbaatar (Mongolia) and 200 to the ethnic group of Buryats living in Ulan-Ude (Republic of Buryatia). The control group (n=531) consisted of apparently healthy people comprising 220 Buryats and 311 Khalkha-Mongols. Genetic studies of twelve single-nucleotide polymorphisms of nine genes: IFNL1 (rs30461); IFNL3 (rs12979860 and rs8099917); IFNL4 (rs368234815); CD209 (rs4804803); TLR3 (rs3775291 and rs13126816); TLR7 (rs179008 and rs179009); IFITM (rs12252); MyD88 (rs6853); IFIH1 (rs1990760) have been performed in the mentioned selections of the sick and healthy individuals. When analyzing the genetic study results, frequencies of gene alleles and their combinations in the form of genotypes have been compared.
Results. The dominant prevalence of the HCV genotype 1 (98.0%) was found in the territory of Mongolia which appeared to be significantly higher (p<0.001) than its prevalence in the territory of Buryatia (66.0%). Among the genetic factors which can influence the formation of the circulating genotype structures in Buryat and Mongolian population, single-nucleotide polymorphisms in three genes (IFNL3, TLR3, and TLR7), the frequency of which differed significantly in the examined cohorts, have been detected. In the ethnical Buryat group, the search for the candidate genes in patients with chronic hepatitis C genotype 1 and non-1 (2 or 3, 2/3) has established that T allele of rs179008 TLR7 gene occurs 2 times more often in women with chronic hepatitis C infection caused by genotype 2/3 than by genotype 1 (p=0.04).
Conclusion. A low prevalence of HCV genotypes 2 and 3 among the population in the territory of Mongolia is likely to be caused by a rare frequency of the mutant T allele of TLR7 gene (rs179008) associated with the predisposition to HCV-2/3 infection, i.e. the situation that has been demonstrated in our work using the ethnical group of Buryats as an example.
Key words: viral hepatitis C; hepatitis C virus genotypes; gene polymorphisms; IFNL1 (rs30461); IFNL3 (rs12979860 and rs8099917); IFNL4 (rs368234815); CD209 (rs4804803); TLR3 (rs3775291 and rs13126816); TLR7 (rs179008 and rs179009); IFITM (rs12252); MyD88 (rs6853); IFIH1 (rs1990760).
Corresponding author: Sergey I. Malov, e-mail: [email protected]
Introduction
The development of prophylactic measures and implementation of direct-acting antiviral agents into clinical practice have resulted in stabilization of the morbidity level of chronic viral hepatitis C (CHC). Currently, according to WHO data, the number of patients with CHC has essentially reduced from 160 to 71 million people [1, 2]. In 2016, the 69th World Health Assembly adopted the resolution in which the incidence of viral hepatitis in the world was declared to decrease significantly by 2030 up to its complete elimination. It should be taken into account that more than 50% of all infected people on the planet are concentrated in the countries of the Asian-Pacific region [1]. In Asia, the highest figures of hepatocellular carcinoma and the occurrence of liver cirrhosis formation in the outcome of viral hepatitis diseases are observed [1].
Hepatitis C virus (HCV) possesses a high variability and a wide genotypic diversity. Specific HCVs prevail in separate geographical regions. For example, genotype 1 (HCV-1) dominates in the countries of South and North America, Australia, and Europe (53-71%), genotype 3 (HCV-3) is the most prevalent in Asia (40%), while genotype 4 (HCV-4) in the Middle East and North Africa (about 71%) [3]. Despite a great deal of information connected with the spread of HCV genotypes in concrete countries, the mechanism of forming stable epidemic genotypes in restricted geographical areas is not completely clear.
One of the highest incidence rates of viral hepatitis C in Asia is noted in Mongolia, HCV-1 b (98.8%) being the most prevalent of all genotypes [4, 5]. The phenomenon of HCV-1 absolute predominance is not observed in the neighboring Buryatia, China or in other Asian countries [3]. Such a high concentration of one genotype in the population of Mongolia is rather difficult to explain by a specific epidemiology of viral hepatitis C in this country or by the "founder effect". At the same time, in Russia, including the ethnically close Buryatia, the level of HCV-1 does not exceed 57.1% [6], and in China 56.8% [3].
A certain tolerance of the population to HCV-2/3 infection, when HCV-1 obtains selective advantage, is likely to be one of the explanations of this phenomenon. The given predisposition is supposed to be of the genetic nature and can be detected by the comparative study of the genetic polymorphism in the ethnically close population of Mongols and Buryats. The study of polymorphism of the innate immunity genes encoding the synthesis of membrane and intracellular adapter molecules, effectors of the immune response to HCV, may become important for the explanation of the causes of the natural selection of the dominant HCV genotype in the territory of Mongolia [7-9].
The aim of the study was to define the role of the polymorphism of innate immunity genes in the population selection of hepatitis C virus genotypes circulating in
the ethnically close groups of Mongoloids: Buryats and Khalkha-Mongols.
Materials and Methods
The investigations presented here have been carried out from 2013 to 2017 in the territory of Russia (Republic of Buryatia) and Mongolia. The material was collected in the medico-prophylactic settings of Buryatia and Mongolia: Republican Clinical Infectious Hospital (Ulan-Ude, Republic of Buryatia, Russia) and National Center for Communicable Diseases (Ulaanbaatar, Mongolia).
Single-nucleotide polymorphisms (SNP) in innate immunity genes were identified in 400 patients with CHC, including 200 people belonging to the ethnic group of Mongoloids living in Ulaanbaatar (Mongolia) and 200 to the ethnic group of Buryats living in Ulan-Ude (Republic of Buryatia, Russia). Among the representatives of the Mongoloid race, the ethnic group of Khalkha-Mongols is the most numerous making more than 85% of the total population [10].
Patients in both territories were selected using the method of continuous random sampling from those who addressed the Center of Hepatology of the Republican Clinical Infectious Hospital in Ulan-Ude (Republic of Buryatia, Russia) and National Center for Communicable Diseases in Ulaanbaatar (Mongolia). The diagnosis of CHC was established on the basis of history-taking, clinical examination, identification of hepatic transaminase activity, detection of anti-HCV IgG and HCV RNA. The control group (n=531) comprised apparently healthy people: 220 Buryats and 311 Khalkha-Mongols.
The genetic study was carried out in compliance with the Declaration of Helsinki (2013) and approved by the Ethics Committee of Irkutsk State Medical University. Informed consent for its conduction was obtained from all examined people.
Virus genotyping was performed using PCR method and AmpliSense-HCV-genotype kit (Central Research Institute of Epidemiology of Rospotrebnadzor of the Russian Federation).
To assess the probable effect of the genetic markers on the selection of a specific virus genotype dominant in the population, twelve SNPs of the nine genes were genetically studied in the given samples of the sick and healthy people: IFNL1 (rs30461); IFNL3 (rs12979860 and rs8099917); IFNL4 (rs368234815); CD209 (rs4804803); TLR3 (rs3775291 and rs13126816); TLR7 (rs179008 and rs179009); IFITM (rs12252); MyD88 (rs6853); IFIH1 (rs1990760). When choosing SNPs, the authors considered polymorphisms in the genes that encode the synthesis of the receptors or adapter molecules which are of great importance as antiviral factors of the innate immunity [11]. A preliminary analysis of the literature [7-9, 11, 12] showed the availability of signaling proteins whose genes have not been actually studied in viral hepatitis C but which play
an important role in providing inherited stability in other viral infections.
Molecular-genetic investigations were conducted using Rotor-Gene Q cycler (Qiagen, Germany) for real-time PCR. Definite gene sites were amplified with the help of appropriate primers. The genotypes of IFNL3 gene were analyzed using AmpliSence reagent kit (Central Research Institute of Epidemiology of Rospotrebnadzor of the Russian Federation) to identify SNPs of rs8099917 and rs12979860 by a real-time PCR technique. To determine other genotypes, primers
and probes of original design synthetized in company Syntol and company Eurogen (Russia) were employed (Table 1). To make amplification more effective, a "hot start" technique with TaqF polymerase (Interlabservice, Russia) was used. The PCR included sample denaturation at 95°C for 15 min, and the following 45 cycles: 95°C for 15 s, 60°C for 30 s.
The primary materials were statistically processed by means of standard parametric and nonparametric tests in Statistica 6.1 program (StatSoft Inc., USA). SNPStatus program (http://bioinfo.iconcologia.net/SNPStatus) was
Table 1
Variable sites of innate immunity genes and primers for their identification in PCR
Gene SNP Localization/ substitution character 5'->3'primers and probes for real-time PCR
IFNL1 rs30461 Chromosome 19, exon/nonsynonymous, Asn188Asp F GAAGGAGTAGGGCTCAGCGC R ACGCGAGACCTCAAATATGTGG 5'-(FAM)-GACGTTCTCAGACAC(A-LNA)GGT(C-LNA)C-(RTQ1) 5'-(R6G)-TGACGTTCTCAGACACA(G-LNA)GT(T-LNA)C-(BHQ2)
IFNL4 rs368234815 Chromosome 19, missense-mutation/— F CCTGCTGCAGAAGCAGAGAT R GCTCCAGCGAGCGGTAGTG 5'-(R6G)-AT-CGC-A(G-LNA)A-(A-LNA)(G-LNA)G-CC-(BHQ1) 5'-(FAM)AT-CGC-A(G-LNA)(C-LNA)(G-LNA)-GC-CC-(BHQ1)
CD209 rs4804803 Chromosome 19, promotor zone/— F ACTGTGTTACACCCCCTCCACTAG R AGGAAAGCCAGGAGGTCACA 5'(R6G)-CTGC-(C-LNA)(C-LNA)(A-LNA)-CCCTTGC-(BHQ1) 5'(FAM)-CTGC(C-LNA)(T-LNA)(ALNA)-CCCTTGC-(BHQ1)
TLR3 rs3775291 Chromosome 4, exon/nonsynonymous, Leu412Phe F CCAAGAGAAAGCATCACTCTCTATTTTTG R GTTTGCGAACTTTGACAAATGAAACATT 5'(R6G)-CCCTTACA(C-LNA)ATA(T-LNA)T(C-LNA)AACC-(BHQ2) 5'(FAM)-CCCTTACA(C-LNA)ATA(C-LNA)T(C-LNA)AACC-(RTQ1)
rs13126816 Chromosome 4, intron/— F GCAACGGAAAAGGCAATCTAGAAGA R AAGTCTTGAAGTTCAGTGAGCGA 5'(R6G)-AACCTCC(C-LNA)AT(T-LNA)TT(G-LNA)CTC(BHQ2) 5'(FAM)-ACCTCC(C-LNA)AT(C-LNA)TT(G-LNA)CTC(RTQ1)
TLR7 rs179008 Chromosome X, exon/nonsynonymous, Gln11Leu F GGTGTTTCCAATGTGGACACTG R ACATCCAGAGTGACATCACAGG 5'(FAM)-TTATGTTAAAAAGGATAAGAATT(A-LNA)G(T-LNA)C-(RTQ1) 5'(R6G)-TTATGTTAAAAAGGATAAGAATT(T-LNA)G(T-LNA)C-(BHQ2)
rs179009 Chromosome X, intron 2/— F TTTGCTAAAGAGCTAAGATGCTAA R TTCAGCTGTCTAAACAGCATCC 5'(FAM)-GTAACTGACAAATACA(G-LNA)TC(T-LNA)TGG-(RTQ1) 5'(R6G)-GTAACTGACAAATACA(T-LNA)C(G-LNA)TGG-(BHQ2)
IFITM rs12252 Chromosome 11, missense-mutation/— F GGACACCATGAATCACACTGTC R TGAGCATTCCCTGGGGCCATA 5'-(FAM)TTCTTCTCTCCTGTCAAC(A-LNA)G(C-LNA)G(RTQ1) 5'-(R6G)CTTCTTCTCTCCTGTCAA(C-LNA)AG(T-LNA)G(BHQ2)
MyD88 rs6853 Chromosome 3, 3'UTR/— F ATTTAGCTGCCATGCACCTGTC R GCGTACAAAACATGTAGAAGATGC 5'-(FAM)-GGGCATTTTAAAGCCAT(C-LNA)TC(A-LNA)AG-(RTQ1) 5'-(R6G)TGGGCATTTTAAAGCCA(T-LNA)CTC(G-LNA)A-(BHQ2)
IFIH1 rs1990760 Chromosome 2, exon/nonsynonymous, Ala946Thr F CATTTGCAGATGATTTCACCATTTA R GATTCTTTCCCTTTGATACTTATAG 5'-(FAM)-TTTACATTGTAAGAGAAA(C-LNA)AAA(A-LNA)CAC-(RTQ1) 5'-(R6G)CTTTACATTGTAAGAGAAA(C-LNA)AAA(G-LNA)CA-(BHQ2)
used for statistical analysis of the candidate genetic studies. Each SNP was statistically analyzed according to different research models: codominant, dominant, recessive, overdominant, and log-additive. And the model with the least value of the Akaike information criterion for each gene polymorphism was assumed as the most probable [13]. Frequency of gene alleles and their combination in the form of genotypes was compared while analyzing the results of the genetic studies. Distribution of the genotypes across each locus was tested for the compliance with Hardy-Weinberg
law. OR (odds ratio) was calculated at 95% confidence interval. Wolf-Holden method was used to calculate OR at a zero value [14]. Significance was defined as p<0.05.
Results
A comparative analysis of the clinical and laboratory indices in Mongols and Buryats with CHC is given in Table 2.
Clinical symptomatology did not show anything special in the course of CHC.
Table 2
Clinical and laboratory characteristics of patients with chronic hepatitis C in the ethnic groups of Buryats and Mongols (M±m)
Parameters Buryats, n=200 Khalkha-Mongols, n=200 P
Age (years) 41.8±0.9 43.5±0.8 >0.05
Gender, male (%) 40.6±3.8 39.7±3.6 >0.05
Body mass (kg) 70.2±1.5 71.0±1.1 >0.05
Height (cm) 163.8±1.2 161.6±0.9 >0.05
Body mass index 26.2±0.9 27.2±0.8 >0.05
Supposed disease duration (years) 3.4±0.4 4.9±0.3 >0.05
Latent course (% (abs. number)) 40.0±3.5 (80) 40.0±3.5 (80) >0.05
Astenovegetative syndrome (% (abs. number)) 54.0±3.5 (108) 58.0±3.5 (116) >0.05
Heaviness and pains in the right hypochondrium (% (abs. number)) 25.0±3.1 (50) 27.0±3.1 (54) >0.05
Sclera icteritiousness (% (abs. number)) 5.0±1.5 (10) 4.5±1.5 (9) >0.05
Hepatomegaly (% (abs. number)) 25.0±3.1 (50) 22.0±2.9 (44) >0.05
Splenomegaly (% (abs. number)) 9.5±2.1 (19) 9.5±2.1 (19) >0.05
ALT (Units/L) 78.7±4.4 88.2±4.3 >0.05
AST (Units/L) 59.0±3.0 67.3±3.4 >0.05
Bilirubin (|imol/L) 15.0±0.6 14.0±0.4 >0.05
Neutrophils (*109/L) 2.9±0.2 3.0±0.2 >0.05
Erythrocytes (*1012/L) 4.83±0.5 4.93±0.1 >0.05
Leukocytes (*109/L) 6.1±0.2 6.0±0.1 >005
Thrombocytes (*109/L) 225.1±5.6 218.6±5.3 >0.05
Hemoglobin (g/L) 144.9±1.5 149.0±1.2 <0.05
Total cholesterol (mmol/L) 4.7±0.1 5.1±0.2 >0.05
Triglycerides (mmol/L) 1.2±0.1 1.4±0.2 >0.05
Glucose (mmol/L) 5.47±0.1 5.34±0.1 >0.05
Table 3
Proportion of hepatitis C virus genotypes having caused chronic viral hepatitis C in the ethnic group of Buryats and Mongols (M±m)
Region Genotype 1 Genotype 2 Genotype 3
abs. number % abs. number % abs. number %
Republic of Buryatia, n=200 132 66.0±3.3 10 5.0±1.5 58 29.0±3.2
Mongolia, n=200 196 98.0±1.0 2 1.0±0.7 2 1.0±0.7
P <0.001 <0.05 <0.001
Note: p — statistical significance of value differences in comparing the groups of Buryats and Khalkha-Mongols.
The only statistically significant difference of such index as the level of hemoglobin in the blood reflects the physiological reaction of the body to the climatic and geographical conditions of Mongols habitation. The city of Ulaanbaatar is situated on the intermontane plateau at a height of 1300-1350 m above sea level which is 600-800 m higher than Ulan-Ude [10].
The variety of HCV genotypes was studied based on the analysis of 200 PCR-positive blood samples from CHC patients living in Buryatia and 200 in Mongolia (Table 3). HCV-1 (98.0%) was established to prevail in Mongols with CHC which is significantly higher (p<0.001) than in Buryats (66.0%). The proportion of
other genotypes in each of the compared groups was essentially lower. Thus, HCV-2 and HCV-3 made 2.0% in Mongols and 34.0% in Buryats (p<0.001). In addition to the mentioned variants, single patients with the combination of two or more genotypes were revealed as well as those with anomalous HCV genotypes which were excluded from the statistical analysis in order to keep the sample representative.
At the first stage of our work, the prevalence of the variable sites of the examined genes in the populations of healthy people in the ethnical groups of Buryats and Mongols was compared (Table 4).
In these people, significant differences were
Ta bl e 4
Prevalence of single-nucleotide polymorphisms of innate immunity genes among healthy people in the ethnic groups of Buryats and Mongols
Gene, SNP Genotypes/alleles Mongols, n=311 (abs. number/%) Buryats, n=220 (abs. number/%) OR (95% CI) p
IFNL1, rs30461 TT 273/87.8 180/81.8 1.0 —
CT 33/10.6 36/16.4 1.65 (1.00-2.75) 0.051
CC 5/1.6 4/1.8 1.21 (0.32-4.58) 0.78
Dominant model 273 180 1.0 —
38 40 1.60 (0.99-2.59) 0.056
Recessive model 306 216 1.0 —
5 4 1.13 (0.30-4.27) 0.85
IFNL3, rs12979860 CC 255/82.0 171/77.7 1.0 —
CT 48/15.4 38/17.3 1.18 (0.74-1.88) 0.49
TT 8/2.6 11/5.0 2.05 (0.81-5.20) 0.12
Dominant model 255 171 1.0 —
56 49 1.30 (0.85-2.00) 0.22
Recessive model 303 209 1.0 —
8 11 1.99 (0.79-5.04) 0.14
IFNL3, rs8099917 TT 259/83.3 166/75.5 1.0 —
TG 48/15.4 46/20.9 1.50 (0.95-2.34) 0.078
GG 4/1.3 8/3.6 3.12 (0.93-10.53) 0.054
Dominant model 259 166 1.0 —
52 54 1.62 (1.06-2.49) 0.026
Recessive model 307 212 1.0 —
4 8 2.90 (0.86-9.74) 0.072
IFNL4, rs368234815 TT/TT 255/82.0 170/77.3 1.0 —
TT/AG 48/15.4 40/18.2 1.25 (0.79-1.98) 0.34
AG/AG 8/2.6 10/4.5 1.88 (0.73-4.85) 0.19
Dominant model 255 170 1.0 —
56 50 1.34 (0.87-2.05) 0.18
Recessive model 303 210 1.0 —
8 10 1.80 (0.70-4.65) 0.22
CD209, rs4804803 AA 243/78.2 167/75.9 1.0 —
AG 62/19.9 46/20.9 1.08 (0.70-1.66) 0.73
GG 6/1.9 7/3.2 1.70 (0.56-5.14) 0.34
Dominant model 243 167 1.0 —
68 53 1.13 (0.75-1.71) 0.55
Recessive model 305 213 1.0 —
6 7 1.67 (0.55-5.04) 0.36
The end of Table 4
Gene, SNP Genotypes/alleles Mongols, n=311 fcbs. number/%) Buryats, n=220 fcbs. number/%) OR (95% CI) p
TLR3, rs3775291 GG 134/43.1 128/58.2 1.0 —
AG 152/48.9 83/37.7 0.57 (0.40-0.82) 0.0023
AA 25/8.0 9/4.1 0.38 (0.17-0.84) 0.014
Dominant model 134 128 1.0 —
177 92 0.54 (0.38-0.77) 0.00061
Recessive model 286 211 1.0 —
25 9 0.49 (0.22-1.07) 0.067
TLR3, rs13126816 GG 224/72.0 136/61.8 1.0 —
AG 80/25.7 75/34.1 1.54 (1.06-2.26) 0.025
AA 7/2.3 9/4.1 2.12 (0.77-5.82) 0.14
Dominant model 224 136 1.0 —
87 84 1.59 (1.10-2.30) 0.013
Recessive model 304 211 1.0 —
7 9 1.85 (0.68-5.05) 0.22
TLR7*, rs179008 AA 182/98.4 119/90.1 1.0 —
AT 2/1.1 10/7.6 7.65 (1.65-35.52) 0.0025
TT 1/0.5 3/2.3 4.59 (0.47-44.63) 0.15
Dominant model 182 119 1.0 —
3 13 6.63 (1.85-23.75) 0.00097
Recessive model 184 129 1.0 —
1 3 4.28 (0.44-41.60) 0.17
TLR7*, rs179009 CC 155/83.8 105/79.6 1.0 —
CT 26/14.1 25/18.9 1.42 (0.78-2.59) 0.25
TT 4/2.1 2/1.5 0.74 (0.13-4.10) 0.73
Dominant model 155 105 1.0 —
30 27 1.33 (0.75-2.36) 0.33
Recessive model 181 130 1.0 —
4 2 0.70 (0.13-3.86) 0.68
IFITM3, rs12252 CC 68/21.9 56/25.5 1.0 —
CT 177/56.9 109/49.5 0.75 (0.49-1.15) 0.18
TT 66/21.2 55/25.0 1.01 (0.61-1.67) 0.96
Dominant model 68 56 1.0 —
243 164 0.82 (0.55-1.23) 0.34
Recessive model 245 165 1.0 —
66 55 1.24 (0.82-1.86) 0.31
MyD88, rs6853 AA 295/94.9 205/93.2 1.0 —
AG 16/5.1 15/6.8 1.35 (0.65-2.79) 0.42
GG 0/0 0/0 — —
Dominant model 295 205 1.0 —
16 15 1.35 (0.65-2.79) 0.42
Recessive model 311 220 1.0 —
0 0 — —
IFIH1, rs1990760 CC 201/64.6 128/58.2 1.0 —
CT 90/28.9 75/34.1 1.31 (0.90-1.91) 0.16
TT 20/6.5 17/7.7 1.33 (0.67-2.64) 0.41
Dominant model 201 128 1.0 —
110 92 1.31 (0.92-1.87) 0.13
Recessive model 291 203 1.0 —
20 17 1.22 (0.62-2.38) 0.56
* For the genes mapped on X chromosome genotype distribution was performed only for females.
Ta bl e 5
Prevalence of single-nucleotide polymorphisms of TLR7 (rs179008) gene among patients with chronic hepatitis C of genotype 1 and non-1 compared to patients with chronic hepatitis C (non-1 genotype) in the ethnic group of Buryat females (abs. number/%)
Genotype of TLR7 (rs179008) gene Chronic hepatitis C, genotype 1, n=79 Chronic hepatitis C, non-1 genotype, n=41 OR (95% CI) P
AA 69/87.3 30/73.2 1.0 —
AT 7/8.9 8/19.5 2.63 (0.87-7.91) 0.078
TT 3/3.8 3/7.3 2.30 (0.44-12.06) 0.31
Dominant model 69 30 1.0 —
10 11 2.53 (0.97-6.59) 0.053
Recessive model 76 38 1.0 —
3 3 2.00 (0.39-10.38) 0.40
A allele 145/91.8 68/82.9 1.0 —
T allele 13/8.2 14/17.1 2.30 (1.02-5.15) 0.0397
Note: p — statistical significance of value differences in comparing patients with chronic hepatitis C genotype 1 and CHC non-1 genotype; * statistical significance of value differences for the genes mapped on X chromosome, genotype distribution was performed for females
established to be in the frequency of one SNP gene encoding interferons synthesis and three SNP genes encoding toll-like endosomal pattern recognition receptors (TLR). Thus, in healthy Mongols, GG genotype rs3775291 of TLR3 gene occurred more rarely (OR=0.54; CI=0.38-0.77; p=0.0006). But significantly more frequently were TT genotype rs8099917 of IFNL3 (OR=1.62; CI=1.06-2.49; p=0.026), GG genotype rs13126816 of TLR3 (OR=1.59; CI=1.10-2.30; p=0.013), and AA genotype rs179008 of TLR7 (OR=6.63; CI=1.85-23.75; p=0.00097). The latter genotype also differed by the fact that 98.4% of the representatives of Mongol ethnic group were carriers of the dominant AA homozygous variants and only in three examined people minor T allele was detected in the genotype composition.
The found differences in the frequency of these four candidate genes in healthy people of both ethnical groups provided the basis for their further investigations as potential genetic factors for predisposition to HCV-1 infection and tolerance to HCV-2/3. The comparative analysis of SNPs in the mentioned genes in the Buryats and Mongols ethnic groups with HCV-1-induced CHC has established some regular patterns. TT genotype rs8099917 of IFNL3 (65.9 and 77.7% in Buryats (p=0.005), 73.5 and 83.3% in Mongols (p=0.002), respectively) and GG genotype rs3775291 of TLR3 (47.0 and 61.8% in Buryats (p=0.007), 56.1 and 72.0% in Mongols (p=0.0002)) occurred in both groups significantly less rarely than in healthy people.
Comparison of the genotype SNP variety of genes IFNL3 (rs8099917), TLR3 (rs3775291 and rs13126816), TLR7 (rs179008) in CHC patients infected with HCV-1 and HCV-2/3 was performed only in the cohort of the sick Buryats as only single CHC patients with non-1
genotype of HCV are revealed in Mongolia. The analysis conducted did not permit us to established association between virus genotypes and SNP genotypes of the examined genes. However, the allele analysis found significantly higher frequency of T allele among Buryat females infected with non-1 genotype of HCV (Table 5).
Discussion
The investigation showed that the structure of HCV genotypes was essentially different in Mongolia and in neighboring Buryatia. Dominant prevalence of HCV-1 (98.0%) was detected in the territory of Mongolia which is significantly higher (p<0.001) than its prevalence in the territory of Buryatia (66.0%). As the groups were fully comparable in their clinical, laboratory, and age-sex indices, it is natural to assume that the predominance of virus genotype 1 among Mongols may be caused by polymorphism of innate immunity genes which create selective advantages for the circulation of the given genotype or prevent HCV-2/3 circulation due to genetic tolerance to the infection. The first works on this subject performed in ethnical groups of Caucasians were the investigations of Wietzke-Broun with co-authors (2006) and Askar with co-authors (2009) [15, 16]. In one of them, the SNP of the interferon regulatory factor IRF-1 gene, which provides genetic resistance to HCV-3a, was described [15]. In another work, a TT homozygous genotype rs3775291 of the TLR3 gene whose carriers are not ill with HCV-1 was detected [16]. The search for a mechanism of this phenomenon has led the authors to the conclusion that active reactions of innate immunity underlie the resistance of some people to HCV-1 a. In the people of the Caucasian race having TT genotype
rs377529, a strong expression of the TLR3 gene in the hepatic cells was found which provides a subsequent activation of the interferon regulatory factor-3 (IRF-3) and nuclear factor kB (NF-kB) leading to the intensive production of interferon-p and proinflammatory cytokines [16].
SNPs of the three genes (IFNL3, TLR3, and TLR7), the frequency of which significantly differed in the examined cohorts, were detected in the present work among the genetic factors which can influence formation of the structures of the circulating HCV genotypes in the population of Buryats and Mongols.
Genotypes of IFNL3 variable sites are referred to one of the first polymorphisms described in viral hepatitis C having association with a spontaneous clearance of the virus and a response to the antiviral treatment with interferon and ribavirin [17]. In the present investigation, it has been ascertained that TT genotype of rs8099917 in IFNL3 gene favorable for the spontaneous HCV clearance is significantly more common in the population of healthy Mongols than in Buryats.
Other SNPs, the distribution of which significantly differed among healthy Mongols and Buryats, were localized in genes TLR3 (rs3775291, rs13126816) and TLR7 (rs179008). TLRs are referred to pattern recognition receptors and actively participate in triggering and regulation of cytokine inflammation. TLR3 and TLR7 receptors are localized transmembraneously on the endosome whereto the virus gets after internalization. These receptors recognize single- and double-stranded RNA, which is formed in the process of replication and particle assembly of practically all RNA-containing viruses. Polymorphism of TLR genes can influence both virus recognition (processing) and activation of the signaling pathway causing inflammation (signaling). The comparison of the polymorphisms of both genes showed significant differences in their frequency in the examined ethnical groups. Thus, examination of practically healthy population of Mongols and Buryats revealed three candidate genes the SNPs of which may influence the structure of HCV genotypes circulating in the population.
Further investigations were focused on the analysis of the mentioned four polymorphisms in the three candidate genes IFNL3, TLR3, and TLR7 in the population of Mongols and Buryats ill with CHC caused by various virus genotypes. A more frequent occurrence of the favorable TT genotype rs8099917 of IFNL3 gene among healthy people in comparison with patients with CHC caused by HCV-1 among both Mongols and Buryats confirms a well-known fact about genetic resistance of carriers of the given genotype to HCV infection [17]. The obtained data showed that application of rs8099917 SNP of IFNL3 gene as a prognostic factor for Caucasians and Negroids is acceptable for the ethnic groups of Mongoloids living in the territory of Buryatia and Mongolia.
In addition to the SNP of IFNL3 gene, one more
variable site rs13126816 of TLR3 gene, the GG genotype of which marks the resistance to HCV-1-induced viral hepatitis C. This SNP was also universal and concerned both ethnical groups. Carriers of GG genotype had a lower risk of getting sick compared to other individuals: 2 times among Mongols and 1.8 times among Buryats. The previous study of this SNP in Caucasians [18] showed that macrophages of the people carrying G allele are capable of quick and intense production of interferon-p. According to the study performed in the USA in the ethnic groups of Caucasians, Afro-Americans and Latin Americans [18], rs13126816 G allele of TLR3 gene was associated with a high frequency of HCV-1 spontaneous clearance. The same SNP was associated with the resistance of individuals to herpesvirus [19]. Thus, two SNPs (rs8099917 IFNL3 and rs13126816 TLR3), the wild genotypes of which determine the resistance of their carriers to HCV-1 infection, were detected in the examined groups.
The search for gene genotypes involved in the reactions of innate immunity in patients with CHC caused by HCV genotypes 1 and 2/3 did not find their significant differences in the groups. But at the same time, the analysis by separate alleles has established that rs179008 T allele of TLR7 gene occurred two times more in women with CHC caused by genotype 2/3 than by genotype 1 (p=0.04). The rs179008 SNP of TLR7 gene is localized in exon 3 of the X chromosome. This SNP is nonsynonymous by its character and is characterized by the substitution of glutamine (Gln) for leucine (Leu) in the encoded protein. As a result, the signaling peptide of TLR7 receptor displays functional degeneracy [20]. In response to synthetic inductors in the dendrite cells and hepatocytes of the minor T allele carriers, low expression of IFNL1 mRNA, IL-10RP, and IL-28Ra is observed [21]. Besides, T allele is associated with a high viral load, poor response to antiviral therapy, and predisposition to a rapid progression of HIV infection in women [21, 22]. Mononuclears of healthy people, carriers of T allele, weakly produce interferon-a in vitro in response to the interferon inductors [22]. Higher frequency of the mutant TLR7 gene in women with CHC caused by virus genotype 1 is obviously the consequence of a weak interferon and cytokine response to the infection.
HCV-2/3 is known to display a higher sensitivity to interferon-a in contrast to HCV-1 and HCV-4. Genetic disorder of interferon-a synthesis in response to HCV-2/3 infection is rather an important factor of providing a long-term persistence of the given virus genotypes. A rare presence of TT genotype rs179008 of TLR7 gene (0.5%) among the Mongolian population determines population resistance to HCV-2/3 infection and stipulates absolute domination of HCV-1. The causes of the absence of the minor mutant rs179008 T allele of TLR7 gene require additional investigations and may lie in the specific genotype structure not only of HCV but other viruses in which reactions of innate immunity play a significant role. A copy number of TLR7 gene, the frequency of which
among the Mongolian population remains unexplored, may be of some importance.
Conclusion
The investigations performed enabled us to detect a candidate TLR7 gene, the variable sites of which (rs179008) occur with various frequency in Buryat women with virus genotype 1 and non-1 (2/3). T allele frequency is more than twice greater in patients with non-1 genotype (17.1 and 8.2%, respectively). A low prevalence of HCV genotypes 2 and 3 among the population in Mongolia territory is likely to be caused by a rare frequency of the mutant T allele (rs179008) of TLR7 gene associated with the predisposition to HCV-2/3 infection demonstrated in our work using the ethnical group of Buryats as an example.
Study funding. The work was supported by the Russian Foundation for Basic Research, grant No.16-54-44047.
Conflicts of interest. The authors have no conflicts of interest related to the present study.
References
1. Lavanchy D. Evolving epidemiology of hepatitis C virus. Clin Microbiol Infect 2011; 17(2): 107-115, https://doi. org/10.1111/j.1469-0691.2010.03432.x.
2. Global hepatitis report 2017. Geneva: World Health Organization; 2017.
3. Gower E., Estes C., Blach S., Razavi-Shearer K., Razavi H. Global epidemiology and genotype distribution of the hepatitis C virus infection. J Hepatol 2014; 61(1 Suppl): S45-S57, https://doi.org/10.1016/j jhep.2014.07.027.
4. Baatarkhuu O., Kim D.Y., Ahn S.H., Nymadawa P., Dahgwahdorj Y., Shagdarsuren M., Park J.Y., Choi J.W., Oyunbileg J., Oyunsuren T., Han K.H. Prevalence and genotype distribution of hepatitis C virus among apparently healthy individuals in Mongolia: a population-based nationwide study. Liver Int 2008; 28(10): 1389-1395, https://doi. org/10.1111/j.1478-3231.2008.01820.x.
5. Malov S.I. Sravnitel'naya kliniko-epidemiologicheskaya kharakteristika virusnogo gepatita C na sopredel'nykh territoriyakh Rossii i Mongolii. Avtoref. dis. ... kand. med. nauk [Comparative clinical and epidemiological characteristics of viral hepatitis C on the cross-border regions of Russia and Mongolia. PhD Thesis]. Moscow; 2017.
6. Nikitina G.Yu., Semenenko T.A., Gotvyanskaya T.P., Hahaeva I.B., Konopleva M.V., Nikolaeva O.G., Yarosh L.V., Kozhevnikova L.K., Suslov A.P. The prevalence of parenteral hepatitis markers among the medical personnel in the Russian Federation regions with different intensity of epidemic process. Klinicheskaya mikrobiologiya i antimikrobnaya khimioterapiya 2017; 19(2): 161-167.
7. Ryan E.J., Dring M., Ryan C.M., McNulty C., Stevenson N.J., Lawless M.W., Crowe J., Nolan N., Hegarty J.E., O'Farrelly C. Variant in CD209 promoter is associated with severity of liver disease in chronic hepatitis C virus infection. Hum Immunol 2010; 71(8): 829-832, https://doi. org/10.1016/j.humimm.2010.05.007.
8. Jiménez-Sousa M.A., Rallón N., Berenguer J., Pineda-Tenor D., López J.C., Soriano V., Guzmán-Fulgencio M., Cosín J., Retana D., García-Álvarez M., Miralles P., Benito J.M., Resino S. TLR3 polymorphisms are associated with virologic response to hepatitis C virus (HCV) treatment in HIV/HCV coinfected patients. J Clin Virol 2015; 65: 62-67, https://doi.org/10.1016/jjcv.2015.02.004.
9. Barkhash A.V., Perelygin A.A., Babenko V.N., Brinton M.A., Voevoda M.I. Single nucleotide polymorphism in the promoter region of the CD209 gene is associated with human predisposition to severe forms of tick-borne encephalitis. Antiviral Res 2012; 93(1): 64-68, https://doi. org/10.1016/j.antiviral.2011.10.017.
10. Kruchkin Yu.N. Sovremennaya Mongoliya. Entsiklopedicheskii spravochnik [Modern Mongolia. Encyclopedic reference book]. Ulan-Bator; 2011; 1154 p.
11. Simbirtsev A.S. Cytokines in the pathogenesis of infectious and noninfectious human diseases. Meditsinskiy akademicheskiy zhurnal 2013; 13(3): 18-41.
12. Obaid A., Ahmad J., Naz A., Awan F.M., Paracha R.Z., Tareen S.H., Anjum S., Raza A., Baumbach J., Ali A. Modeling and analysis of innate immune responses induced by the host cells against hepatitis C virus infection. Integr Biol (Camb) 2015; 7(5): 544-559, https://doi.org/10.1039/c4ib00285g.
13. Akaike H. A new look at the statistical model identification. IEEE Transactions on Automatic Control 1974; 19: 716-723, https://doi.org/10.1109/tac.1974.1100705.
14. Pevnitsky L.A. Statistical assessment of associations between HLA antigens and diseases. Vestnik AMN SSSR 1988; 7: 48-51.
15. Wietzke-Braun P., Maouzi A.B., Mänhardt L.B., Bickeböller H., Ramadori G., Mihm S. Interferon regulatory factor-1 promoter polymorphism and the outcome of hepatitis C virus infection. Eur J Gastroenterol Hepatol 2006; 18(9): 991997, https://doi.org/10.1097/01.meg.0000224478.89545.76.
16. Askar E., Bregadze R., Mertens J., Schweyer S., Rosenberger A., Ramadori G., Mihm S. TLR3 gene polymorphisms and liver disease manifestations in chronic hepatitis C. J Med Virol 2009; 81(7): 1204-1211, https://doi. org/10.1002/jmv.21491.
17. Tanaka Y., Nishida N., Sugiyama M., Kurosaki M., Matsuura K., Sakamoto N., Nakagawa M., Korenaga M., Hino K., Hige S., Ito Y., Mita E., Tanaka E., Mochida S., Murawaki Y., Honda M., Sakai A., Hiasa Y., Nishiguchi S., Koike A., Sakaida I., Imamura M., Ito K., Yano K., Masaki N., Sugauchi F., Izumi N., Tokunaga K., Mizokami M. Genome-wide association of IL28B with response to pegylated interferonalpha and ribavirin therapy for chronic hepatitis C. Nat Genet 2009; 41(10): 1105-1109, https://doi.org/10.1038/ng.449.
18. Qian F., Bolen C.R., Jing C., Wang X., Zheng W., Zhao H., Fikrig E., Bruce R.D., Kleinstein S.H., Montgomery R.R. Impaired toll-like receptor 3-mediated immune responses from macrophages of patients chronically infected with hepatitis C virus. Clin Vaccine Immunol 2013; 20(2): 146-155, https://doi.org/10.1128/cvi.00530-12.
19. Svensson A., Tunbäck P., Nordström I., Padyukov L., Eriksson K. Polymorphisms in toll-like receptor 3 confer natural resistance to human herpes simplex virus type 2 infection. J Gen Virol 2012; 93(Pt 8): 1717-1724, https://doi.org/10.1099/ vir.0.042572-0.
20. Fakhir F.Z., Lkhider M., Badre W., Alaoui R., Meurs E.F., Pineau P., Ezzikouri S., Benjelloun S. Genetic variations in tolllike receptors 7 and 8 modulate natural hepatitis C outcomes
and liver disease progression. Liver Int 2018; 38(3): 432-442, https://doi.org/10.1111/liv. 13533.
21. Askar E., Ramadori G., Mihm S. Toll-like receptor 7 rs179008/Gln11Leu gene variants in chronic hepatitis C virus infection. J Med Virol 2010; 82(11): 1859-1868, https://doi. org/10.1002/jmv.21893.
22. Schott E., Witt H., Neumann K., Bergk A., Halangk J., Weich V., Müller T., Puhl G., Wiedenmann B., Berg T. Association of TLR7 single nucleotide polymorphisms with chronic HCV-infection and response to interferon-a-based therapy. J Viral Hepat 2008; 15(1): 71-78, https://doi. org/10.1111/j.1365-2893.2007.00898.x.
