CC BY
4
© NIKOLAEVA P.A., MORYACHKOV R. V., RALDUGINA V. N., NAUMOVA IU. O., NOVIKOVA T. M., SPIRIDONOVA V. A. UDC 577.22
DOI: 10.20333/25000136-2022-5-111-113
Structural analysis of thrombin-binding G-aptamers in presence of bivalent ions
P.A. Nikolaeva1, R. V. Moryachkov2,3, V. N. Raldugina4, Iu. O. Naumova4, T. M. Novikova4, V. A. Spiridonova4
1 Department bioimformatics and bioengineery, Lomonosov Moscow State University, Moscow 119992, Russian Federation
2 Federal Research Center «Krasnoyarsk Science Center SB RAS», Krasnoyarsk 660036, Russian Federation
3 Kirensky Institute of Physics, Krasnoyarsk 660036, Russian Federation
4 Belozersky Institute of physical chemical biology, Lomonosov Moscow State University, Moscow 119992, Russian Federation
Abstract. The aim of this study was to examine 3D structures of DNA aptamers, thrombin inhibitors. •The main objective was to study 3D structure 15TBA, RE31, NU172 aptamers using the small-angle X-ray scattering method. The size of 15TBA was 4.5 nm, which corresponds to a partially unfolded conformation. The CD spectrum of Nu172 in the presence of 50 mM strontium ions indicates the presence of an antiparallel G-quadruplex, the concentration o f which drops at 50°C. NU172 does not have a rigid structure, apparently due to the presence of a guanine residue in the GT loop. The NU172 aptamer does not form a stable conformation in solution either without ions or with Ba2+ and Sr2+ ions. • It was shown that there is possibility of aptamers transition from one conformation to another dependently on concentration and temperature confirms that the potassium ion is a unique stabilizing ion of natural molecules containing G-quadruplexes.
Key words: 3D structures, DNA aptamers, thrombin inhibitors, G-quadruplexes.
Conflict of interest. The authors declare the absence of obvious and potential conflicts of interest associated with the publication of this article. Citation: Nikolaeva PA, Moryachkov RV, Raldugina VN, Naumova IuO, Novikova TM, Spiridonova VA. Structural analysis of thrombin-binding G-aptamers in presence of bivalent ions. Siberian Medical Review. 2022;(5):111-113. DOI: 10.20333/25000136-2022-5-111-113
One of the popular areas in molecular medicine is a construction and application synthetic oligonucleotides (including modified) - aptamers. Aptamers possess ability of forming nonstandard DNA structures, which play vital role in regulations of cell processes. One of such conformations are G-quadruplexes consisting of several G-tetrads (fig.1).
Small-angle X-ray scattering (SAXS) method allows to obtain extensive information about biomolecules, such as information about size and shape of macromolecules, intermolecular association, domains and linker flexibility, ligands binding. SAXS data is used in combination with alternative methods for studying structure of macromolecules (e.g. X-ray crystallography, circular dichroism (CD), molecular dynamics and metadynamics), but it also can be used as an independent method.
In this study, thrombin-binding aptamers 15TBA [1], RE31 [2], NU172 [3], were examined (table). These aptamers structurally belong to a same class of aptamers, G-quadruplex aptamers. Therefore, some structural similarities can be identified, in particular, presence of following domains: duplex, transition and G-quadruplex domains as well as presence of dinucleotide loops (TT or TG) and trinucleotide loop.
The aim of this study was to examine 3D structures of DNA aptamers, thrombin inhibitors.
The aim of this study was to examine 3D structures of DNA aptamers, thrombin inhibitors. The main objective was to study 3D structure 15TBA [1], RE31 [2], NU172 [3] aptamers using the SAXS method (fig.1). Structure of these aptamers has been discovered earlier using X-Ray crystallography method [1, 3, 4], however, structure in solution and in crystal might differ. Experiments were carried out at the BioMUR beamline in the National Research Center "Kurchatov Institute" at the temperatures 5oC, 20oC, 38oC, 45oC, and 50oC. Concentrations of barium and strontium were varied from 0mM to 50mM (0mM,
15TB A RE31 Nu 172
Figure 1. Structure of DNA aptamers to thrombin.
0.5mM, 5mM, 50mM) for all aptamers (fig.2). A) Pair distance distribution function (PDDF) p(r) based on the SAXS data of 15TBA without ions at various temperatures from 5oC to 45oC. At 5-38oC the structure is more compact. B) p(r) function based on the SAXS data of 15TBA in buffer with 50 mM Barium ion at various temperatures. It is observed the average compact structure of 15TBA at all temperatures with the slight decreasing the folded state. C) p(r) based on the SAXS data of 15TBA in buffer with 50 mM Strontium ion at various temperatures. SAXS data about the aptamer structure shows the similar signal, the maximum size D fluctuates in the range 4.5-5.5 nm. D) CD
max °
of 15TBA. The lines show the results of the CD of 15TBA in a buffer without ion at different temperatures from 5oC up to 500C. There is signal which corresponds to antiparallel G-qua-druplex. Signal almost fully disappears at 20oC. E) CD of 15TBA. The green lines show the results of the CD of 15TBA in a buffer with 50 mM strontium ion at different temperatures from 5oC up to 50oC. There is signal which corresponds to both parallel and antiparallel G-quadruplex. The black line shows the result of the CD of 15TBA in a buffer with 50 mM Barium ion at different temperatures from 5oC. F) CD of 15TBA. The lines show the re-
Table
Sequence of DNA aptamers to thrombin
Aptamer Sequence
15TBA GGTTGGTGTGGTTGG
RE31 GTGACGTAGGTTGGTGTGGTTGGGGCGTCAC
NU172 CGCCTAGGTTGGGTAGGGTGGTGGCG
Nikolaeva P.A., Moryachkov R. V., Raldugina V. N. et al.
Structural analysis of thrombin-binding g-aptamers in presence of bivalent ions
DE F
Figure 2. SACS and circular dichroism data DNA aptamers to thrombin (description in text).
Figure 3. SACS and circular dichroism data DNA aptamers RE31 (description in text).
suits of the CD of 15TBA in a buffer with 50 mM Barium ion at different temperatures from 5oC up to 50oC.
According to the SAXS data, the size of 15TBA was 3.5-4.5 nm, and melting the aptamer is more distinguish without ions in the buffer (fig.3). A) PDDF based on the SAXS data of RE31 without ions at various temperatures. Melting point is observed at the temperatures 38°C and higher. At 5-20oC structure is more compact. B) PDDF based on the SAXS data of RE31 in buffer with 50 mM Barium ion at various temperatures. There is a probability of oligomerization of the aptamer, since the different D values
° 1 max
are observed at the different temperatures. C) PDDF based on the SAXS data of RE31 in buffer with 50 mM Strontium ion at various temperatures. While the RE31 aptamer melts at about 38°C without ions, its melting point is shifted in presence of Strontium ions to 50°C. D) CD of RE31. The lines show the results of the CD of RE31 in a buffer with 50 mM Barium ion at different tem-
112
peratures from 5oC up to 50oC. There is signal which corresponds to antiparallel G-quadruplex. E) CD of RE31. The lines show the results of the CD of RE31 in a buffer with 50 mM Strontium ion at different temperatures from 5oC up to 50oC. There is signal which corresponds to antiparallel G-quadruplex.
CD spectrum of RE31 in the presence of 50 mM strontium ions indicates presence of an antiparallel G-quadruplex, concentration of which drops at 50°C.
According to the results of the SAXS experiment, aptamer showed has two different sizes, 6 and 7.5-8 nm, which approximately corresponds to the G-quadruplex conformation for 6 nm (the slight discrepancy in sizes between SAXS and X-ray Diffraction (XRD) data is most likely due to the fact that the movement and flexibility of molecule in solution is not restricted, while in the crystal it is rigidly fixed). The second size variation - 7-8 nm - corresponds to a partially unfolded conformation (fig.4). A) PDDF p(r) based on
Siberian Medical Review. 2022;(5):111-113
the SAXS data of Nu172 without ions at various temperatures. All the results at 5oC - 45oC show unfolded or partially unfolded state of the molecule without ions in the buffer. B) PDDF based on the SAXS data of Nu172 in buffer with 50 mM Barium ion at various temperatures. The partially unfolded conformation of Nu172 is preserved at all temperatures with slight increasing the flexibility at higher degrees. D) PDDF based on the SAXS data of Nu172 in buffer with 50 mM Strontium ion at various temperatures. All curves correspond to the partially unfolded conformation of the aptamer molecule with higher value D in comparison to the SAXS curves
max
for RE31 with Ba ions in the buffer. E) CD of Nu172. The lines show the results of the CD of Nu172 in a buffer with 50 mM Barium ion at different temperatures from 50C up to 500C. There is signal which corresponds to antiparallel G-quadruplex. E) CD of Nu172. The lines show the results of the CD of Nu172 in a buffer with 50 mM Strontium ion at different temperatures from 5oC up to 50oC. There is signal which corresponds to antiparallel G-quadruplex; however, it significantly weakens at 20oC.
The CD spectrum of Nu172 in the presence of 50 mM strontium ions indicates the presence of an antiparallel G-quadru-plex, the concentration of which drops at 50°C.
NU172 does not have a rigid structure, apparently due to the presence of a guanine residue in the GT loop, the average size according to SAXS data was 6-7 nm, which corresponds to a partially unfolded conformation. According to the SAXS results, the NU172 aptamer does not form a stable conformation in solution either without ions or with Ba2+ and Sr2+ ions.
Conclusions
1. Using SAXS method, the sizes of the molecules included in these complexes were characterized.
2. Circular dichroism spectra shows presence of antiparallel quadruplexes at a certain concentration of barium and strontium ions at low temperatures.
3. Aptamers thermal stability has been examined and existence of a set of conformers, which are both quadruplex structures and partially unfolded molecules, has been showed.
4. It was shown that there is a possibility of aptamers transition from one conformation to another dependently on concentration
and temperature confirms that the potassium ion is a unique stabilizing ion of natural molecules containing G-quadruplexes.
The study was supported by a grant from the Russian Science Foundation (project number 21-73-20240).
References
1. Padmanabhan K, Tulinsky A. An Ambiguous Structure of a DNA 15-mer Thrombin Complex. Acta Crystallographica. 1996;D52:272-282
2. Tomilin FN, Moryachkov R, Shchugoreva I, Zabluda VN, Peters G, Platunov M, Spiridonova V, Melnichuk A, Atrokhova A, Zamay SS, Ovchinnikov SG, Zamay GS, Sokolov A, Zamay TN, Berezovski MV, Kichkailo AS. Four steps for revealing and adjusting the 3D structure of aptamers in solution by small-angle X-ray scattering and computer simulation. Analytical and Bioanalytical Chemistry. 2019;411(25):6723-6732. DOI: 10.1007/s00216-019-02045-0
3. Troisi R, Napolitano V,Spiridonova V, Krauss IR, Sica F. Several structural motifs cooperate in determining the highly effective anti-thrombin activity of NU172 aptamer. Nucleic Acids Research, 2018;(46):12177-12185. DOI: 10.1093/nar/gky990
4. Krauss IR, Spiridonova V, Pica A, Napolitano V, Sica F. Different duplex/quadruplex junctions determine the properties of anti-thrombin aptamers with mixed folding, Nucleic Acids Research. 2016;(44):983-991.
Author information
Polina A. Nikolaeva, researcher, Department bioimformatics and bioengineery Lomonosov Moscow State University; Address: 1, Leninskie Gory Str., Moscow, Russian Federation 119992; Phone: +7(495)9391000; e-mail: nïkolaevapa@gmaïl.com
Roman V. Moryachkov, researcher, Federal Research Center «Krasnoyarsk Science Center SB RAS»; Address: 50, Akademgorodok Str., Krasnoyarsk, Russian Federation 660036; Kirensky Institute of Physics; Address: 50, Akademgorodok Str., Krasnoyarsk, Russian Federation 660036; Phone: +7(391)2432635; e-mail: mrv@iph.krasn.ru; http://orcid.org/0000-0002-0409-779X
Vasilisa N. Raldugina, researcher, Belozersky Institute of physical chemical biology Lomonosov Moscow State University; Address: 1, Leninskie Gory Str., Moscow, Russian Federation 119992; Phone: +7(495)9391000; e-mail: fxb@genebee.msu.su
Julia O. Naumova, researcher, Belozersky Institute of physical chemical biology Lomonosov Moscow State University; Address: 1, Leninskie Gory Str., Moscow, Russian Federation 119992; Phone: +7(495)9391000; e-mail: fxb@genebee.msu.su
Tatiana M. Novikova, researcher, Belozersky Institute of physical chemical biology Lomonosov Moscow State University; Address: 1, Leninskie Gory Str., Moscow, Russian Federation 119992; Phone: +7(495)9391000; e-mail: fxb@genebee.msu.su
Vera A. Spiridonova, Dr.Biol.Sci., Belozersky Institute of physical chemical biology Lomonosov Moscow State University; Address: 1, Leninskie Gory Str., Moscow, Russian Federation 119992; Phone: +7(495)9391000; e-mail: spiridon@belozersky.msu.ru
Received 17 June 2022 Revision Received 20 August2022 Accepted 30 August 2022
