CC BY
24Интегративная физиология, 2020, т. 1, № 2 Integrative Physiology, 2020, vol. 1, no. 2 _www.intphysiology.ru
Экспериментальные статьи
UDC 612.018
DOI: 10.33910/2687-1270-2020-1-2-92-100
Stimulation of gastroduodenal HCO3- secretion by lubiprostone mediated by different prostaglandin EP receptor subtypes
K. Takeuchi®1, 2 S. Hayashi1, K. Amagase1, 3
1 Kyoto Pharmaceutical University, 5 Misasaginakauchicho, Yamashina Ward, Kyoto 607-8414, Japan 2 Kyoto Research Center for Gastrointestinal Diseases, 671 Karasuma-Oike, Kyoto 604-8106, Japan 3 Ritsumeikan University, 1-1-1 Noji-higashi, Kusatsu, Shiga 525-8577, Japan
Authors
Koji Takeuchi,
Scopus AuthorlD: 56603096400, e-mail: koii01210121@yahoo.co.ip Shusaku Hayashi, Scopus AuthorlD: 35733933500 e-mail: hayashi@inm.u-toyama.ac.ip
Kikuko Amagase, Scopus AuthorlD: 6603389023 e-mail: amagase@mb.kyoto-phu.ac.ip For citation: Takeuchi, K., Hayashi, S., Amagase, K. (2020) Stimulation of gastroduodenal HCO3- secretion by lubiprostone mediated by different prostaglandin EP receptor subtypes. Integrative Physiology, vol. 1, no. 2, pp. 92-100. DOI: 10.33910/2687-1270-2020-12-92-100
Received 21 November 2019; reviewed 22 December 2019; accepted 24 December 2019. Copyright: © The Authors (2020). Published by Herzen State Pedagogical University of Russia. Open access under CC BY-NC License 4.0.
Abstract. We examined the stimulatory effects of lubiprostone, a bicyclic fatty acid derived from prostaglandin E1 and a chloride channel type-2 opener (ClC-2), on HCO3- secretion in the rat stomach and duodenum, with a focus on the EP receptor subtypes involved in this action. Under urethane anesthesia, an ex-vivo chambered stomach or a duodenal loop was perfused with saline, and HCO3- secretion was measured at pH 7.0 using a pH stat-method. Lubiprostone (0.1-30 |M) was perfused in the chamber or loop for 10 min. Indomethacin, ONO-8711 (an EP1 antagonist), or AE5-599 (an EP3 antagonist) was given s.c. 1 h before the lubiprostone treatment, while AE3-208 (an EP4 antagonist) or CFTRinh-172 (a cystic fibrosis transmembrane conductance regulator (CFTR) inhibitor) was given i.p. 30 min before. Lubiprostone dose-dependently and significantly increased HCO3- secretion in both the stomach (> 10 |M) and duodenum (> 1 |M). The stimulatory effect in the stomach was significantly abrogated by a pretreatment with the EP1 antagonist, but not the EP3/EP4 antagonists or CFTR inhibitor, while that in the duodenum was significantly attenuated by the EP3/EP4 antagonists as well as the CFTR inhibitor. Indomethacin had no effect on the response of either tissue to lubiprostone. These results suggest that lubiprostone stimulated HCO3-secretion in the stomach and duodenum in a manner that was mediated by different EP receptor subtypes; the former was mediated by EP1 receptors, while the latter was mediated by both EP3 and EP4 receptors. CFTR/ClC-2 may be involved in the response observed in the duodenum, but not in the stomach.
Keywords: lubiprostone, HCO3-stomach, duodenum, rat.
secretion, prostaglandin EP receptor subtypes,
Introduction
Lubiprostone, a bicyclic fatty acid derived from prostaglandin (PG) Ej, has been used to treat chronic constipation and irritable bowel syndrome with constipation (Schey, Rao 2011). Its mechanism of action has been attributed to the stimulation of intestinal fluid secretion via the activation of ClC-2 chloride channels, which are located in the apical membranes of epithelial cells as a cystic fibrosis transmembrane regulator (CFTR) bypass channel in Cystic Fibrosis (Schwiebert et al. 1998; Cuppoletti et al. 2004). Previous studies demonstrated that lubiprostone activated PGE receptors (Bassil et al. 2008; Mizumori et al. 2009; Cuthbert 2011).
These receptors have been pharmacologically subdivided into four subtypes, EP:-EP4 (Woodward et al. 2011). Among them, the EP4 receptor appears to be the main target for lubiprostone. Cuthbert demonstrated that EP4 receptors in sheep were the major target for lubiprostone to stimulate the secretion of anions in ovine airways (Cuthbert 2011). In addition, several studies showed that lubiprostone activated ClC-2/CFTR chloride channels via EP4 receptors (Cuppoletti et al. 2004; Bassil et al. 2008; Bao et al. 2008). We previously reported that PGE2 ameliorated indomethacin-induced small intestinal damage via the activation of EP4 receptors (Kunikata et al. 2002; Hatazawa et al. 20064; Takeuchi 2014). In consistence with these findings, we recently
confirmed that lubiprostone also prevented indomethacin-induced enteropathy via an EP4 receptor-dependent mechanism (Hayashi et al. 2014).
The secretion of HCO3- from surface epithelial cells is one of the main processes involved in mu-cosal defense and plays an important role in protecting the gastroduodenal mucosa against acid (Flemstrom, Garner 1982; Flemstrom, Turnberg 1984; Takeuchi et al. 1986). The physiological regulation of HCO3- secretion involves several factors such as PGs, nitric oxide, and neuronal factors (Flemstrom, Garner 1982; Heylings et al. 1984; Takeuchi et al. 1991; Hogan et al. 1993; Sugamoto et al. 2001; Takeuchi et al. 1997). Mizumori et al. (2009) reported that lubiprostone stimulated CFTR-depen-dent duodenal HCO3- secretion in rats, and this action was mediated by the activation of EP4 receptors. PGE2 has been shown to stimulate HCO3- secretion in the stomach and duodenum in a manner that is mediated by different EP receptors; EP1 receptors in the stomach and EP3/EP4 receptors in the duodenum (Takeuchi et al. 1997; Takeuchi et al. 1999; Aoi et al. 2004; Aihara et al. 2007). However, it currently remains unknown whether lubiprostone stimulates HCO3- secretion in the stomach similar to PGE2 and which EP receptors are responsible for its effects in the stomach.
In the present study, we examined the stimulatory effects of lubiprostone on HCO3- secretion in the rat stomach and duodenum, with a focus on the EP receptor subtypes involved in these effects. Since lubiprostone is a ClC-2 chloride channel opener (Schwiebert et al. 1998; Cuppoletti et al. 2004), we also determined the contribution of ClC-2/CFTR channels to its HCO3- stimulatory effects in these tissues.
Materials and methods
1. Animals
Male Sprague-Dawley rats (200-260 g; Nippon Charles River, Shizuoka, Japan) were acclimated to standard laboratory conditions (12:12 h light-dark cycle, temperature of 22 ± 1° C). Animals were kept in individual cages with raised mesh bottoms and deprived of food, but allowed free access to tap water for 18 h before the experiments. Experiments were carried out using four to six rats per group under urethane anesthesia (1.25 g/kg, i.p.). Body temperature was monitored intermittently using a rectal thermometer (Natsume, Tokyo, Japan) and maintained at ~35 °C by placing the animals on a heat pad and exposing them to an external heat lamp (40 W) (Takeuchi et al. 1986; Takeuchi
et al. 1997). All experimental procedures described were approved by the Experimental Animal Research Committee of Kyoto Pharmaceutical University.
2. Determination of HCO3 secretion
The secretion of HCO3- was measured in a chambered stomach or duodenal loop as described previously (Takeuchi et al. 1997; Takeuchi et al. 1990). The abdomen was incised, and the stomach was exposed and mounted on a chamber (exposed area: 3.1 cm2), while a duodenal loop (17 mm) was made between the pyloric ring and area just above the outlet of the common bile duct to exclude the influences of bile and pancreatic juice (fig. 1).
Fig. 1. Schematic illustration of the perfusion system and order of connection of the loop to determine HCO3- secretion in the whole stomach (A) or proximal duodenum (B) of an anesthetized rat. The tissue was continuously perfused at a rate of 0.2 ml/min with saline, which was gassed with 100 % O2, heated at 37 °C, and kept in a reservoir. HCO3-secretion was measured at pH 7.0 using a pH-stat method
The ex-vivo chambered stomach or duodenal loop was perfused at a rate of 0.2 ml/min with saline, which was gassed with 100 % O2 and kept in a reservoir. The secretion of HCO3- was measured at pH 7.0 using a pH-stat method (Hiranuma Comtite-8, Mito, Japan) and by the addition of 2 mM HCl to the reservoir. To unmask HCO3- in the stomach, the secretion of acid was completely inhibited by omeprazole, which was administered i.p. at a dose of 60 mg/kg. Omeprazole at this dose has been shown to have no influence on gastric HCO3-secretion in rats (Flemstrom, Mattsson 1986). After the basal secretion of HCO3- had been stabilized, the chamber or loop was perfused at a rate of 0.2 ml/min for 10 min with lubiprostone (0.1~30 |iM) made isotonic with NaCl. In some cases, HCO3-secretion was stimulated in both the stomach and duodenum by PGE2 (1 mg/kg) given intravenously (i.v.). Indomethacin (a cyclooxygenase inhibitor:
Mнтегративнан (изиоAогин, 2020, m. 1, № 2
93
5 mg/kg), ONO-8711 (an EP1 antagonist: 10 mg/ kg), or AE5-599 (an EP3 antagonist: 10 mg/kg) was given subcutaneously (s.c.) 1 h before the application of lubiprostone or administration of PGE2, while AE3-208 (an EP4 antagonist: 3 mg/kg) or CFTRinh-172 (an inhibitor of CFTR: 1 mg/kg) was given intraperitoneally (i.p.) 30 min before. The doses of these EP and CFTR antagonists were selected in order to induce the respective pharmacological actions according to the findings of previous studies (Hayashi et al. 2014; Takeuchi et al. 2011; Takeuchi et al. 2002; Norimatsu et al. 2012).
3. Determination of gene expression of the ClC-2 chloride channel and EP1-EP4 receptors
The gene expression of the ClC-2 chloride channel and EP1-EP4 receptors was measured in the gastric and duodenal mucosa by a reverse transcriptional polymerase chain reaction (RT-PCR). The stomach or duodenum was removed under deep ether anesthesia, and stored at -80 °C prior to use. Total RNA was extracted from tissue samples using Sepasol RNA I (Nacalai Tesque, Kyoto, Japan). Total RNA was reverse-transcribed with a first strand cDNA synthesis kit (ReverTra Ace alpha, TOYOBO, Osaka, Japan). The sequences of the sense and antisense primers for the rat ClC-2 chloride channel and EP1-EP4 receptors, and each product size, are shown in Table 1. An aliquot
Table 1. Sequences of Sense and Antisense Primers for ClC-2 and EP1-EP4 Receptors
Gene
Primer Sequence 5-3'
PCR Product
CIC-2 Forward Reverse CAAGTTCCTCTCCCTCTTTG GAACTGTCCAAAGCCAGGG 499 bp
EP1 Forward Reverse CCCAGGGTCCCCAATACATCT GGGCAGCTGTGGTTGAAG 778 bp
EP2 Forward Reverse CGCCCTCCACCATGGACAAT AAGCAGCGCATGCTCACAAC 1178 bp
EP3 Forward Reverse TGGCTGGCGCTCACCGACTTG GCATTGCTCTACTGACATCTG 666 bp
EP4 Forward Reverse CCCTGCAGCGCCTCAGTGACTTT CTTGCCTCCGAGGCTGCTTTCAGT 488 bp
GAPDH Forward Reverse GAACGGGAAGCTCACTGGCATGGC TGAGGTCCACCACCCTGTTGCTG 331 bp
of the RT reaction product served as a template in 35 cycles of PCR with 0.5 min of denaturation at 95 °C and 1 min of extension at 68 °C using the Advantage 2 polymerase mixture (CLONTECH, Mountain View, CA) in a thermal cycler (PC-806, ASTEC, Fukuoka, Japan). A portion of the PCR mixture was electrophoresed in 1.5 % agarose gel in Tris-acetic acid-EDTA buffer (40 mM Tris, 20 mM
acetic acid, and 2 mM EDTA; pH 8.1), and the gel was stained with ethidium bromide and photographed (Bio Doc-It Imaging System; UVP, Upland, CA, USA). Images were analyzed with Image J (version 1.39).
4. Preparation of drugs
The drugs used were prostaglandin E2, indo-methacin (Sigma Chemicals, St. Louis, MO), lubiprostone (Abbott Japan Co., Ltd. Tokyo, Japan), ONO-8711 (an EP1 antagonist), AE5-599 (an EP3 antagonist), AE3-208 (an EP4 antagonist) (Ono Pharmaceutical Co., Ltd., Osaka, Japan), CFTR(inh)-172 (a CFTR inhibitor; Wako Pure Chemicals, Osaka, Japan), and urethane (Tokyo Kasei, Tokyo, Japan). Prostanoids, including lubi-prostone, were dissolved in absolute ethanol and diluted with saline to the desired concentrations. Indomethacin was suspended in a 0.5 % hydroxy-propylcellulose solution (Wako Pure Chemicals). Other drugs were dissolved in saline. All drugs were prepared immediately before use, perfused intra-luminally at a rate of 0.2 ml/min, and administered subcutaneously (s.c.) or intraperitoneally (i.p.) in a volume of 0.5 ml/100 g body weight or intravenously (i.v.) in a volume of 0.1 ml/100 g body weight. Control animals received the vehicle alone.
5. Statistical analyses
Data are presented as means ± SE for four to eight rats per group. Statistical analyses were performed using a two-tailed unpaired t-test and Dunnett's multiple comparison test, and values of P < 0.05 were considered significant.
Results
1. Effects of lubiprostone on gastric HCO3
secretion 3
Under urethane anesthesia, the rat chambered stomach spontaneously secreted HCO3- at a steady rate of 0.1~0.2 |iEq/10 min, and secretion remained unaltered after the perfusion of saline for 10 min at a rate of 0.2 ml/min. The perfusion of the chambered stomach with lubiprostone (1-30 |iM) for 10 min increased the secretion of HCO3- in a concentration-dependent manner. The rate of HCO3- secretion was significantly increased by lubiprostone perfusion at 30 ^M compared to saline (fig. 2A), while the net HCO3- output was significantly greater at 10 ^M and 30 ^M than that in the saline-perfused stomach; AHCO3- outputs at 1, 10, and 30 |iM were 1.11 ± 0.42, 2.15 ± 0.36, and 3.53 ± 0.37 |iEq/h, respectively (fig. 2B). The HCO3- response to lubiprostone in the stomach persisted for ap-
Fig. 2. Effects of lubiprostone on gastric HCO3-secretion in anesthetized rats. The chambered stomach was perfused at a rate of 0.2 ml/min for 10 min with lubiprostone (1-30 цМ), and HCO3-secretion was measured before and after the perfusion of lubiprostone. Figure A: Data are presented as the mean ± SE of the values determined every 10 min from 4-6 rats. *Significantly different from the control, at P < 0.05. Figure B shows the net HCO3- output for 1 h after the perfusion of lubiprostone, and the data represent the mean ± SE from 4-6 rats. *Significantly different from the control, at P < 0.05
Fig. 3. Effects of lubiprostone on duodenal HCO3-secretion in anesthetized rats. The duodenal loop was perfused at a rate of 0.2 ml/min for 10 min with lubiprostone (0.1-10 цМ), and HCO3- secretion was measured before and after the perfusion of lubiprostone. Figure A: Data are presented as the mean ± SE of the values determined every 10 min from 5-6 rats. *Significantly different from the control, at P < 0.05. Figure B shows the net HCO3- output for 1 h after the perfusion of lubiprostone, and the data represent the mean ± SE from 4-6 rats. *Significantly different from the control, at P < 0.05
proximately 2 h. Based on these results, lubiprostone was perfused in the chambered stomach at 30 цМ in subsequent experiments.
2. Effects of lubiprostone on duodenal HCO3
secretion
The rat duodenum spontaneously secreted HCO3- at a steady rate of 0.3~0.5 |iEq/10 min under urethane anesthesia, and its secretion remained unaltered after the perfusion of saline for 10 min at a rate of 0.2 ml/min. However, lubiprostone (0.1-10 цМ) perfused luminally in the duodenal loop for 10 min increased the secretion of HCO3-in a concentration-dependent manner, and its secretion was significantly greater at concentrations of 1 цМ and 10 цМ than that in the saline-perfused duodenum; AHCO3- outputs at 0.1, 1, and 10 цМ were 1.62 ± 0.42, 5.35 ± 0.31, and 4.78 ± 0.32 цEq/h, respectively (figs. 3A and 3B). Based on these results, lubiprostone was perfused in the duodenal loop at 1 цМ in subsequent experiments.
3. Effects of EP, EP3, and EP4 antagonists on lubiprostone-stimulated gastric HCO3 secretion
The luminal perfusion of lubiprostone (30 цМ) in the chambered stomach for 10 min potently increased HCO3- secretion, with AHCO3- output at 3.73 ± 0.41 цEq/h, which was significantly higher than that (0.96 ± 0.08 цEq/h) in the control. The stimulatory effects of lubiprostone were sig-
nificantly attenuated by the pretreatment of animals with ONO-8711 (10 mg/kg, s.c.), the EP: antagonist, but not by either AE5-599 (10 mg/kg), the EP3 antagonist, or AE3-208 (3 mg/kg), the EP4 antagonist, with the degrees of inhibition being 70.3 %, 16.2 %, and -16.1 %, respectively (fig. 4).
4. Effects of EP, EP3, and EP antagonists on lubiprostone-stimulated duodenal HCO3 secretion
The luminal perfusion of lubiprostone (1 |iM) in the duodenal loop for 10 min significantly elevated HCO3- secretion over that in the control group treated with saline; AHCO3- output was 5.38 ± 0.41 |iEq/h. The HCO3- stimulatory effect of lubiprostone was significantly attenuated by the pretreatment of animals with AE5-599 (10 mg/kg, s.c.) and AE3-208 (3 mg/kg, i.p.), but not with ONO-8711 (10 mg/kg, s.c.), and the degrees of inhibition were 48.2 %, 75.9 % and 5.5 %, respectively (fig. 5).
5. Effects of indomethacin and CFTR(inh)-172 on HCO3- responses induced by lubiprostone in the stomach and duodenum
Since the HCO3- response to lubiprostone was significantly attenuated by EP antagonists, this effect may be mediated by endogenous PGs. Lubiprostone has also been shown to activate ClC-2 chloride channels (De Lisle et al. 2010; Schiffhauer
Fig. 4. Effects of various subtype-selective EP antagonists on lubiprostone-stimulated gastric HCO3-secretion in anesthetized rats. Lubiprostone (30 цМ) was perfused in the chambered stomach at a rate of 0.2 ml/min for 10 min. ONO-8711 (an EP1 antagonist: 10 mg/kg) or AE5-599 (an EP3 antagonist: 10 mg/kg) was given s.c. 1 h before the perfusion of lubiprostone, while AE3-208 (an EP4 antagonist: 3 mg/kg) was given i.p. 30 min before. Data are presented as the mean ± SE for 4-7 rats. Significant difference at P < 0.05; *from the control; # from the vehicle
Fig. 5. Effects of various subtype-selective EP antagonists on lubiprostone-stimulated duodenal HCO3- secretion in anesthetized rats. Lubiprostone (1 цМ) was perfused in the duodenal loop at a rate of 0.2 ml/min for 10 min. ONO-8711 (an EP1 antagonist: 10 mg/kg) or AE5-599 (an EP3 antagonist: 10 mg/kg) was given s.c. 1 h before the perfusion of lubiprostone, while AE3-208 (an EP4 antagonist: 3 mg/kg) was given i.p. 30 min before. Data are presented as the mean ± SE for 4-7 rats. Significant difference at P < 0.05; *from the control; # from the vehicle
et al. 2013). In order to investigate the possible involvement of endogenous PGs and ClC-2 chloride channels in the HCO3- stimulatory action of lubiprostone, we examined the effects of indomethacin and CFTR(inh)-172 on HCO3- responses to lubi-prostone in the stomach and duodenum.
When lubiprostone was perfused for 10 min into the chambered stomach or duodenal loop at 30 цМ or 1 цМ, respectively, the secretion of HCO3- was significantly increased; AHCO3- output was 3.68 ± 0.46 |iEq/h in the stomach or 5.530 ± 0.32 ^q/h in the duodenum, respectively. As shown in Fig. 6A, HCO3- responses in the stomach and duodenum were not significantly affected by the pretreatment of animals with indomethacin (5 mg/kg, s.c.); the responses observed were similar to those in control tissues. On the other hand, CFT(inh)-172 (1 mg/kg, i.p.), the inhibitor of CFTR, significantly attenuated the HCO3- response to lubiprostone (1 цМ) in the duodenum, but not in the stomach, with inhibition at 41.6 % in the former and 23.6 % in the latter (fig. 6B).
6. Effects of EP1, EP3, and EP4 antagonists on PGE2-induced gastric and duodenal HCO3 secretion
To confirm the involvement of specific EP receptor subtypes in the HCO3- response to PGE2
in the stomach and duodenum, we examined the effects of various EP antagonists on PGE2-induced HCO3- secretion in these tissues. The intravenous administration of PGE2 (1 mg/kg) significantly increased the secretion of HCO3- in the stomach and duodenum; AHCO3- output was at 3.48 ± 0.96 |iEq/h
Fig. 6. Effects of indomethacin and CFTRinh-172 on lubiprostone-stimulated HCO3- secretion in the stomach (A) and duodenum (B) of anesthetized rats. The chambered stomach or duodenal loop was perfused at a rate of 0.2 ml/min for 10 min with
lubiprostone at 30 |m or 1 цМ, respectively. Indomethacin (5 mg/kg) was given s.c. 1 h before the perfusion of lubiprostone while CFTRinh-172 (1 mg/kg), the CFTR inhibitor, was given i.p. 30 min before. Data are presented as the mean ± SE for 4-7 rats. Data are presented as the mean ± SE for 5-6 rats. Significant difference at P < 0.05; *from the control; # from the vehicle
Fig. 7. Effects of various subtype-selective EP antagonists on PGE2-stimulated HCO3- secretion in the stomach (A) and duodenum (B) of anesthetized
rats. PGE2 was administered i.v. at 1 mg/kg. ONO-8711 (an EP1 antagonist: 10 mg/kg) or AE5-599 (an EP3 antagonist: 10 mg/kg) was given s.c. 1 h before the administration of PGE2, while AE3-208 (an EP4 antagonist: 3 mg/kg) was given i.p. 30 min before. Data are presented as the mean ± SE for 4-7 rats. Significant difference at P < 0.05; *from the control; # from the vehicle
and 5.43 ± 0.62 ^Eq/h, respectively (fig. 7). The response in the stomach was significantly inhibited by ONO-8711 (10 mg/kg, s.c.), but not by AE5-599 (10 mg/kg, s.c.) or AE3-208 (5 mg/kg, i.p.), while the response in the duodenum was significantly attenuated by both AE5-599 and AE3-208, but not by ONO-8711.
7. Gene expression of the ClC-2 chloride channels and EP1-EP4 receptors in rat gastric and duodenal mucosa
Since EP1 and EP3/EP4 receptors were found to be involved in the HCO3- stimulatory action of lubiprostone in the stomach and duodenum, respectively, we examined the gene expression of various EP receptor subtypes (EP:-EP4) in addition to the ClC-2 chloride channel. As shown in fig. 8A, EP:-EP4 receptors were expressed in both the gastric and duodenal mucosa, although differences were observed in the intensity of their expression. The gene expression of the ClC-2 chloride channel was also clearly detected in both tissues (fig. 8B).
Discussion
Lubiprostone has been used to treat chronic constipation (Schey, Rao 2011), and its mechanism of action has been attributed to the stimulation of intestinal fluid secretion via the activation of ClC-2 chloride channels (Schwiebert et al. 1998; Cuppoletti et al. 2004). This drug is a bicyclic fatty acid derived from PGE, and has been shown
Fig. 8. Gene expression of EP receptor subtypes (EPrEP4) (A) and ClC-2 (B) in the rat stomach and duodenum
to activate PGE receptors (Bassil et al. 2008; Mizumori et al. 2009; Cuthbert 2011). We recently reported that lubiprostone prevented indomethacin-induced small intestinal damage via the activation of EP4 receptors, similar to PGE2 (Hayashi et al. 2014; Flemstrom, Garner 1982), suggesting the prophylactic use of this drug against NSAID-induced enteropathy. In the present study, we demonstrated for the first time that lubiprostone stimulated HCO3- secretion in both the stomach and duodenum via different EP receptor subtypes; its effect in the stomach was mediated by EP1 receptors, while that in the duodenum was mediated by both EP3 and EP4 receptors.
The secretion of HCO3- from the surface epithelium is one of the mucosal defensive mechanisms and plays an important role in protecting the gastroduodenal mucosa. Various analogues of PGs or agents that enhance the biosynthesis of endogenous PGs stimulate HCO3- secretion, while nonsteroidal anti-inflammatory agents decrease the secretion of HCO3- by inhibiting PG generation (Flemstrom, Garner 1982; Flemström, Turnberg 1984; Takeuchi 1986; Takeuchi et al. 2011). We previously reported that PGE2 affected HCO3-secretion via distinctive mechanisms in the stomach and duodenum concerning the EP receptor subtypes involved in this process; its effect in the stomach was mediated by EP1 receptors coupled with elevations in intracellular Ca2+, while that in the duodenum was associated with the intracellular accumulation of both Ca2+ and 3',5'-cyclic adenosine monophosphate (cAMP) caused by the activation of EP3/EP4 receptors (Takeuchi et al. 1997; Takeuchi et al. 13999; Aoi et al. 2004; Aihara et al. 2007; Takeuchi et al. 2011).
Since lubiprostone is derived from PGE1 and induces its pharmacological effects through EP receptors (Schwiebert et al. 1998; Cuppoletti et al. 2004),
this drug may increase the secretion of HCO3- in the stomach and duodenum via EP receptors. Mizumori et al. (2009) was the first to report that lubiprostone stimulated duodenal HCO3- secretion via the activation of EP4 receptors in rats, and suggested the possibility of its protection of the duodenum from acid-induced injury. We confirmed the HCO3- stimulatory effect of lubiprostone in the duodenum via EP4 receptors and further showed that this effect was mediated by the activation of not only EP4 receptors, but also EP3 receptors. As expected, we also found that this drug increased the secretion of HCO3- in the stomach, and this effect was significantly attenuated by the pretreatment with ONO-8711, the EP: antagonist, but not by the EP3 or EP4 antagonist, suggesting that its action in the stomach was mediated by the activation of EP: receptors. Lubiprostone is unlikely to have stimulated HCO3- secretion by increasing endogenous PG levels, because this effect was observed even under PG-deficient conditions caused by indomethacin. This was also supported by previous findings in which lubiprostone prevented the intestinal ulcerogenic response caused by indomethacin via EP4 receptors (Takeuchi 2014; Hayashi et al. 2014). In a preliminary study, we also observed the effects of lubiprostone in an isolated mouse stomach in vitro, which suggested its direct action on epithelial cells without involving intrinsic and extrinsic nerves (Takeuchi 2014).
Several studies demonstrated that lubiprostone activated ClC-2/CFTR chloride channels via EP4 receptors (Bassil et al. 2008; Mizumori et al. 2009; Cuthbert 2011). Lubiprostone has been shown to stimulate CFTR-dependent duodenal HCO3-secretion without changing net Cl- secretion, which suggested that lubiprostone acts as a dual activator of CFTR-independent Cl- secretion and as a PG receptor agonist (Mizumori et al. 2009). In the present study, we confirmed the gene expression of ClC-2 chloride channels as well as EP1-EP4 receptors in both rat stomach and duodenum, with some differences in the intensity of their expression. Although the cell types that express each EP receptor subtype and ClC-2 chloride channels have not yet been identified, we assumed that ClC-2/CFTR channels are expressed in epithelial cells, even in the stomach. However, we noted that the prior administration of CFTR(inh)-172, an inhibitor of CFTR, significantly attenuated the HCO3-stimulatory effect of lubiprostone in the duodenum, but not in the stomach. Since the activation of EP
4
receptors increases intracellular camp (Regan 2003), and elevations in cAMP, in turn, activate CFTR
(Li, Naren 2005), CFTR-dependent HCO3- secretion by lubiprostone appeared to be consistent with the activation of EP4 receptors by lubiprostone. Norimatsu et al. (2012) also confirmed that CFTR was activated by lubiprostone via the EP4 receptor in oocytes, even though the drug had no direct effect on either ClC-2 or CFTR channels expressed in oocytes. It has not yet been determined why the effect of lubiprostone in the stomach was unaffected by the CFTR inhibitor; however, these results suggest that the direct activation of CFTR/ ClC-2 chloride channels does not contribute to the HCO3- stimulatory action of lubiprostone in the stomach.
Another interesting finding was that the effective dose of lubiprostone markedly differed between the stomach and duodenum; the stimulation of HCO3- secretion was observed at > 10 ^M in the stomach and at > 1 |iM in the duodenum. Consistent with our previous findings (Takeuchi et al. 1997; Takeuchi et al. 1999; Aoi et al. 2004; Aihara et al. 2007; Takeuchi et al. 2011), PGE2 stimulated HCO3- secretion in both the stomach and duodenum at the same dose level (1 mg/kg, i.v.); however, these effects were mediated via different EP receptors in these tissues, similar to those of lubiprostone. Although this difference remains unexplained, it may have been due to different affinities to the EP receptor subtypes and/or ClC-2/CFTR-dependency; higher affinity to both EP3/EP4 receptors than EP1 receptors and ClC-2/CFTR- dependency in the duodenum, but not in the stomach.
The present results suggest that lubiprostone, a bicyclic fatty acid derived from PGE1, stimulated HCO3- secretion in the stomach and duodenum, similar to PGE2, and these effects were mediated by different EP receptor subtypes in these tissues; the effect observed in the stomach was mediated by EP1 receptors, while that in the duodenum was mediated by both EP3 and EP4 receptors. In addition, CFTR was involved in modulating HCO3- secretion in the duodenum, but not in the stomach. Considering the findings in the present study, it is assumed that beyond treatment of constipation, irritable bowel syndrome and enteropathy, lubiprostone may have potential to be used more for protection against gastritis and peptic ulcer diseases, since it does stimulate the secretion of HCO3- in both the stomach and duodenum. Furthermore, because duodenal HCO3- secretion was shown to be impaired in patients with Helicobacter pylori (Tuo et al. 2004; Tuo et al. 2009), it is also possible that lubiprostone may be useful for treatment of Helicobater pylori-related diseases.
Conclusion Conflict of interest statement
Lubiprostone stimulated gastroduodenal HCO3- No potential conflict of interest relevant to this
secretion, and these stimulatory effects differed article was reported. in the two tissues examined; the effect observed
in the stomach was mediated by EP1 receptors and Acknowledgments independent of CFTR channels, while that
in the duodenum was mediated by both EP3 and The authors are greatly indebted to the gradate
EP4 receptors and dependent on CFTR channels. and undergraduate slutos at Drnston °f Pathological
Lubiprostone appeared to protect the stomach and Sc^nœs, Department of Pharmacology and
duodenum against acid injury by stimulating Experimental Therapeutics, Kyoto Pharmaceutical
the secretion of HCO -. University for their technical collaboration.
References
Aihara, E., Nomura, Y., Sasaki, Y. et al. (2007) Involvement of prostaglandin E receptor EP3 subtype in duodenal bicarbonate secretion in rats. Life Sciences, vol. 80, no. 26, pp. 2446-2453. PMID: 17512019. DOI: 10.1016/j. lfs.2007.04.012 (In English)
Aoi, M., Aihara, E., Nakashima, M. et al. (2004) Participation of prostaglandin receptor EP4 subtype in duodenal bicarbonate secretion in rats. American Journal of Physiology: Gastrointestinal and Liver Physiology, vol. 287, no. 1, pp. G96-G103. PMID: 15194560. DOI: 10.1152/ajpgi.00038.2004 (In English) Bao, H. F., Liu, L., Self, J. et al. (2008) A synthetic prostone activates apical chloride channels in A6 epithelial cells. American Journal of Physiology: Gastrointestinal and Liver Physiology, vol. 295, no. 2, pp. G234-G251. PMID: 18511742. DOI: 10.1152/ajpgi.00366.2007 (In English) Bassil, A. K., Borman, R. A., Jarvie, E. M. et al. (2008) Activation of prostaglandin EP receptors by lubiprostone in rat and human stomach and colon. British Journal of Pharmacology, vol. 154, no. 1, pp. 126-135. PMID: 18332851. DOI: 10.1038/bjp.2008.84 (In English) Cuppoletti, J., Malinowska, D. H., Tewari, K. P. et al. (2004) SPI-0211 activates T84 cell chloride transport and recombinant human ClC-2 chloride currents. American Journal of Physiology: Cell Psychology, vol. 287, no. 5, pp. C1173-C1183. PMID: 1521305. DOI: 10.1152/ajpcell.00528.2003 (In English) Cuthbert, A. W. (2011) Lubiprostone targets prostanoid EP4 receptors in ovine airways. British Journal of Pharmacology,
vol. 162, no. 2, pp. 508-520. PMID: 20883477. DOI: 10.1111/j.1476-5381.2010.01058.x (In English) De Lisle, R. C., Mueller, R., Roach, E. (2010) Lubiprostone ameliorates the cystic fibrosis mouse intestinal phenotype.
BMC Gastroenterology, vol. 10, article 107. PMID: 20843337. DOI: 10.1186/1471-230X-10-107 (In English) Flemstrôm, G., Garner, A. (1982) Gastroduodenal transport: Characteristics and proposed role in acidity regulation and mucosal protection. American Journal of Physiology: Gastrointestinal and Liver Physiology, vol. 242, no. 3, pp. G183-G193. PMID: 7039351. DOI: 10.1152/ajpgi.1982.242.3.G183 (In English) Flemstrôm, G., Mattsson, H. (1986) Effects of omeprazole on gastric and duodenal bicarbonate secretion. Scandinavian
Journal of Gastroenterology, vol. 21, suppl. 118, pp. 65-67. DOI: 10.3109/00365528609090894 (In English) Flemstrôm, G., Turnberg, L. A. (1984) Gastroduodenal defense mechanisms. Journal of Clinical Gastroenterology,
vol. 13, no. 2, pp. 327-354. PMID: 6378442 (In English) Hatazawa, R., Ohno, R., Tanigami, M. et al. (2006) Roles of endogenous prostaglandins and cyclooxygenase isozymes in healing of indomethacin-induced small intestinal lesions in rats. Journal of Pharmacology and Experimental Therapeutics, vol. 318, no. 2, pp. 691-699. DOI: 10.1124/jpet.106.103994 (In English) Hayashi, S., Kurata, N., Yamaguchi, A. et al. (2014) Lubiprostone prevents nonsteroidal anti-inflammatory drug-induced small intestinal damage by suppressing the expression of inflammatory mediators via EP4 receptors. Journal of Pharmacology and Experimental Therapeutics, vol. 349, no. 3, pp. 470-479. DOI: 10.1124/jpet.114.213991 (In English)
Heylings, J. R., Garner, A., Flemstrôm, G. (1984) Regulation of gastroduodenal transport by luminal acid in the frog in vitro. American Journal of Physiology: Gastrointestinal and Liver Physiology, vol. 246, no. 3, pp. G235-G242. DOI: 10.1152/ajpgi.1984.246.3.G235 (In English) Hogan, D. L., Yao, B., Steinbach, J. H., Isenberg, J. I. (1993) The enteric nervous system modulates mammalian duodenal mucosal bicarbonate secretion. Gastroenterology, vol. 105, no. 2, pp. 410-417. PMID: 8335196. DOI: 10.1016/0016-5085(93)90714-n (In English) Koyama, M., Hayashi, S., Takahashi, K., Takeuchi, K. (2010) Lubiprostone stimulates HCO3- secretion in isolated mouse stomachs in vitro through activation of prostaglandin EP1 receptors. Gastroenterology, vol. 138, no. 5, suppl. 1, p. S-59. DOI: 10.1016/S0016-5085(10)60269-7 (In English) Kunikata, T., Tanaka, A., Miyazawa, T. et al. (2002) 16,16-Dimethyl prostaglandin E2 inhibits indomethacin-induced small intestinal lesions through EP3 and EP4 receptors. Digestive Diseases and Sciences, vol. 47, no. 4, pp. 894904. PMID: 11991626. DOI: 10.1023/a:1014725024519 (In English)
Li, C., Naren, A. P. (2005) Macromolecular complexes of cystic fibrosis transmembrane conductance regulator and its interacting partners. Pharmacology & Therapeutics, vol. 108, no. 2, pp. 208-223. PMID: 15936089. DOI: 10.1016/j.pharmthera.2005.04.004 (In English) Mizumori, M., Akiba, Y., Kaunitz, J. D. (2009) Lubiprostone stimulates duodenal bicarbonate secretion in rats. Digestive Diseases and Sciences, vol. 54, no. 10, pp. 2063-2069. PMID: 19657734. DOI: 10.1007/s10620-009-0907-0 (In English)
Norimatsu, Y., Moran, A. R., MacDonald, K. D. (2012) Lubiprostone activates CFTR, but not ClC-2, via the prostaglandin receptor (EP4). Biochemical and Biophysical Research Communications, vol. 426, no. 3, pp. 374-379. PMID: 22960173. DOI: 10.1016/j.bbrc.2012.08.097 (In English) Regan, J. W. (2003) EP2 and EP4 prostanoid receptor signaling. Life Sciences, vol. 74, no. 2-3, pp. 143-153.
PMID: 14607241. DOI: 10.1016/j.lfs.2003.09.031 (In English) Schey, R., Rao, S. S. (2011) Lubiprostone for the treatment of adults with constipation and irritable bowel syndrome. Digestive Diseases and Sciences, vol. 56, no. 6, pp. 1619-1625. PMID: 21523369. DOI: 10.1007/s10620-011-1702-2 (In English)
Schiffhauer, E. S., Vij, N., Kovbasnjuk, O. et al. (2013) Dual activation of CFTR and CLCN2 by lubiprostone in murine nasal epithelia. American Journal of Physiology: Lung Cellular and Molecular Physiology, vol. 304, no. 5, pp. L324-331. PMID: 23316067. DOI: 10.1152/ajplung.00277.2012 (In English) Schwiebert, E. M., Cid-Soto, L. P., Stafford, D. et al. (1998) Analysis of ClC-2 channels as an alternative pathway for chloride conduction in cystic fibrosis airway cells. Proceedings of the National Academy of Sciences of the United States of America, vol. 95, no. 7, pp. 3879-3884. DOI: 10.1073/pnas.95.7.3879 (In English) Sugamoto, S., Kawauchi, S., Furukawa, O. et al. (2001) Role of endogenous nitric oxide and prostaglandin in duodenal bicarbonate response induced by mucosal acidification in rats. Digestive Diseases and Sciences, vol. 46, no. 6, pp. 1208-1216. PMID: 11414296. DOI: 10.1023/a:1010603026913 (In English) Takeuchi, K. (2014) Prophylactic effects of prostaglandin E2 on NSAID-induced enteropathy — role of EP4 receptors in its protective and healing-promoting effects. Current Opinion in Pharmacology, vol. 19, pp. 38-45. PMID: 25063918. DOI: 10.1016/j.coph.2014.07.005 (In English) Takeuchi, K., Furukawa, O., Okada, M. et al. (1990) Influence of stress on gastric alkaline secretion in rats. Journal of Pharmacology and Experimental Therapeutics, vol. 252, no. 3, pp. 1228-1233. PMID: 2319469. (In English) Takeuchi, K., Furukawa, O., Tanaka, H., Okabe, S. (1986) A new model of duodenal ulcers induced in rats by indomethacin plus histamine. Gastroenterology, vol. 90, no. 3, pp. 636-645. PMID: 3943695. DOI: 10.1016/0016-5085(86)91118-2 (In English) Takeuchi, K., Kita, K., Hayashi, S. Aihara, E. (2011) Regulatory mechanism of duodenal bicarbonate secretion: Roles of endogenous prostaglandins and nitric oxide. Pharmacology & Therapeutics, vol. 130, no. 1, pp. 59-70. PMID: 21185865. DOI: 10.1016/j.pharmthera.2010.12.006 (In English) Takeuchi, K., Matsumoto, J., Ueshima, K., Okabe, S. (1991) Role of capsaicin-sensitive afferent neurons in alkaline secretory response to luminal acid in the rat duodenum. Gastroenterology, vol. 101, no. 4, pp. 954-961. PMID: 1889720. DOI: 10.1016/0016-5085(91)90721-v (In English) Takeuchi, K., Ogawa, Y., Kagawa, S., Ukawa, H. (2002) Gastric ulcerogenic responses following barrier disruption in knockout mice lacking prostaglandin EP1 receptors. Alimentary Pharmacology & Therapeutics, vol. 16, suppl. 2, pp. 74-82. PMID: 11966527. DOI: 10.1046/j.1365-2036.16.s2.21.x (In English) Takeuchi, K., Ukawa, H., Furukawa, O. et al. (1999) Prostaglandin E receptor subtypes involved in gastroduodenal bicarbonate secretion in rats and mice. Journal of Physiology and Pharmacology, vol. 50, no. 2, pp. 155-167. PMID: 10424714. (In English) Takeuchi, K., Yagi, K., Kato, S., Ukawa, H. (1997) Roles of prostaglandin E-receptor subtypes in gastric and duodenal bicarbonate secretion in rats. Gastroenterology, vol. 113, no. 5, pp. 1553-1559. PMID: 9352857. DOI: 10.1053/gast.1997.v113.pm9352857 (In English) Tuo, B.-G., Sellers, Z.M., Smith, A.J. et al. (2004) A role for CagA/VacA in Helicobacter pylori inhibition of murine duodenal mucosal bicarbonate secretion. Digestive Diseases and Sciences, vol. 49, no. 11-12, pp. 1845-1852. DOI: 10.1007/s10620-004-9582-3 (In English) Tuo, B., Song, P., Wen, G. et al. (2009) Helicobacter pylori vacuolating cytotoxin inhibits duodenal bicarbonate secretion by a histamine-dependent mechanism in mice. The Journal of Infectious Diseases, vol. 199, no. 4, pp. 505-512. PMID: 19099486. DOI: 10.1086/596318 (In English) Woodward, D.F., Jones, R.L., Narumiya, S. (2011) International union of basic and clinical pharmacology. LXXXIII: Classification of prostanoid receptors, updating 15 years of progress. Pharmacological Reviews, vol. 63, no. 3, pp. 471-538. PMID: 21752876. DOI: 10.1124/pr.110.003517 (In English)
