CC BY
0
Вестник Пермского университета. Серия Биология. 2024. Вып. 2. С. 212-220. Bulletin of Perm University. Biology. 2024. Iss. 2. P. 212-220.
ГЕНЕТИКА
Научная статья УДК 575.2 RITUFV
doi: 10.17072/1994-9952-2024-2-212-220
Сравнительная оценка профилей экспрессии гена GhCIPK6 при различных концентрациях NaCl в проростках хлопчатника
(Gossypium hirsutum L.)
Шадер Айдын Ализаде
Бакинский Государственный Университет, Баку, Азербайджан, [email protected]
Аннотация. Накопление Са2+ у растений в условиях солевого стресса улучшает передачу сигнала и защищает их от фатальных последствий. Кальцинейрин B-подобные белки (CBL) представляют собой уникальную группу Са2+-сенсоров, которые декодируют Са2+-сигналы путем активации семейства растительно-специфичных протеинкиназ, известных как CBL-интерактивные протеинкиназы (CIPK). Семейство генов CIPK участвует в реакциях на абиотические стрессоры, такие как соль, засуха, высокие и низкие температуры. В работе изучена относительная экспрессия GhCIPK6 в условиях стресса при концентрации №Cl 100 и 200 мМ у 31 географически удаленного сорта хлопчатника, относящегося к виду Gossypium hirsutum L. У сортов наблюдалась различная динамика относительнoй экспрессии, которые отличаются своей солеустойчивостью. Увеличение транскриптов GhCIPK6 наблюдалось как у устойчивых, так и у восприимчивых сортов. При этом снижение уровня экспрессии определялось как в резистентных, так и в чувствительных генотипах. Полученные результаты показали, что GhCIPK6 в разной степени индуцируется солевым стрессом и механизмы, обеспечивающие солеустойчивость у растений, различны.
Ключевые слова: хлопчатник, солевой стресс, Кальцинейрин B-подобный белок (CBL), CBL-взаимодействующая протеинкиназа (CIPK)
Для цитирования Ализаде Ш. А. Сравнительная оценка профилей экспрессии гена GhCIPK6 при различной концентрации №Q в проростках хлопчатника (Gossypium hirsutum L.) // Вестник Пермского университета. Сер. Биология. 2024. Вып. 2. С. 212-220. http://dx.doi.org/10.17072/1994-9952-2024-2-212-220.
GENETICS
Original article
Сomрa^tive evaluation of GhCIPK6 gene expression profiles under different с onс ent^ tions of NаСl in cotton (Gossypium hirsutum L.) seedlings
Sha der A. А liza de
Baku State University, Baku, Azerbaijan, [email protected]
Abstract. Са2+ ассumulаtion in рк^^ under sаlt stress imрroves sig^l transduction аnd рroteсt them from fаtаl consequences. Са^^щт B-like рroteins ^BLs) аге а unique gro^ of Са2+ sensors iMt decode Са2+ sigrnls Ьу ай^ай^ а fаmilу of рlаnt-sрecific рrotein kisses known аs CBLinterаcting рrotein kirnses (CTPKs). The С1РК gene fаmilу is involved in resрonses to аЬiotic stressors such аs sаlt, drought, high аnd low temрerаtures. In this investigation, the relative exрression of GhCIPK6 wаs studied under stress conditions of 100 mM аnd 200 mM concentrаtion of №Q in 31 geogrарhicаllу distаnt cotton cultivаrs belonging to the sрecies Gossypium hirsutum L. Different dуnаmics of relative exрression раtterns were observed in culture thаt differ in their sаlt tolerаnce. An increаse in GhCIPK6 trаnscriрts wаs observed in both resistаnt аnd susceрtiЬle culture. At the sаme time, а decreаse in the exрression level wаs determined in both resistаnt аnd sensitive genotурes. The obtаined results showed thаt the GhCIPK6 is induced to different degrees Ьу sаlt stress аnd the mechаnisms thаt ensure the sаlt tolerаnce in рlаnts аre different.
Keywords: cotton, sаlt stress, Cаlcineurin B-like рrotein (CBL), CBL-interаcting ргс^т kinаse (С1РК)
212
© Ализаде Ш. А., 2024
For citation: Alizade S. A. Comparative evaluation of GhCIPK6 gene expression profiles under different concentrations of NaCl in cotton (Gossypium hirsutum L.) seedlings. Bulletin of the Perm University. Biology. Iss. 2 (2024): pp. 212-220. http://dx.doi.org/10.17072/1994-9952-2024-2-212-220.
Introduction
Soil salinity is one of the serious abiotic stresses caused by high concentration of salt ions in soil that affect plant growth and development, and reduce plant productivity and crop quality. More than 800 million hectares of land and 20% of the arable land throughout the world are affected by salt stress [Lin et al., 2021].
Plants have evolved complex signaling mechanisms to respond to harsh environmental conditions [Alizada et al., 2020]. Calcium signaling is a crucial mechanism that allows plants to respond to environmental stimuli. In plants, have been identified several classes of calcium-sensing proteins. Ca2+-binding proteins include calmodulin (CaM), CaM-like proteins (CMLs), calcineurin B-like proteins (CBLs), and calcium-dependent protein kinases (CDPKs) [Deng et al., 2013]. Calcineurin B-like protein (CBL)-interacting protein kinase complex (CIPK) is a major component of calcium sensors in the perception of various biotic and abiotic stress signals. CBL proteins contain four elongation factor motifs capable of binding four Ca2+ ions [Shu et al., 2020].
CIPKs are plant-specific protein kinases and belong to the SnRK3 subfamily of plant protein kinases. As major regulators of several ion channel proteins this proteins are regulating plant growth and development [Bai et al., 2022].
CIPK consists of two structural domains: an N-terminal and a C-terminal domain. This domain are connected by a junction domain. The N-terminal domain, the site of phosphorylation and comprises three conserved amino acids that are crucial for the proper CIPK functioning and activity. The C-terminal is also the regulatory domain of CIPK and further comprises NAF/FISL and PPI. Each member of this gene family generates unique proteins that helps in plant adaptation to a variety of stressors by interacting with calcium ion signals. In plants, the CIPK-CBL interaction plays several roles reacting to abiotic stress, ion homeostasis, and biotic stress factors [Yang et al., 2022].
Under salt stress, the mechanism of regulation of ion homeostasis and balance of Na+ and K+ ions inside the cell was studied through the CBL-CIPK complex. High Na+ concentration activates the formation of CIPK24/SOS2 and CBL4/SOS3 complex. This complex, in turn, activates SOS1, which allows Na+ to flow out of the cell through plasma membrane anti-porters. The flow of Na+ ions into the vacuole is regulated through the CBL10-CIPK24/SOS2 complex [Yin et al., 2020]. The importance of the Ca2+ complex in regulating the amount of K ions inside the cell through the AKTI channel was noted [Li et al., 2006].
The overexpression of SICIPK24 increased salt tolerance in tomato [Huertas et al., 2012]. In Arabidopsis expression of AtCIPK3 modulate abscisic acid and low temperature signal transduction and increase tolerance to high salt, low temperature and drought stress. [Kim et al., 2003]. In grapevine genome (Vitis vinifera) eight CBL and 20 CIPK genes were identified and diverse expression patterns of VvCBLs and VvCIPKs determined in response to salt stress [Xi et al., 2017].
The expression levels of AlCBL and AlCIPK genes were investigated under 600 mM NaCl stress conditions in a halophyte model Aeluropus littoralis. Among the studied genes one AlCBL gene was not expressed under the tested conditions. After 24 h. of salt treatment three genes were differentially induced: they were upregulated in the leaf, while they were downregulated in the root. Only one AlCIPK gene was downregulated in both root and leaf. Other AlCIPK genes showed different dynamics in different time intervals [Arab et al., 2023].
Chen et al. [2014] studied transgenic Arabidopsis plants under two different concentration of NaCl. Over-expressing ZmCIPK21 markedly increased resistance of transgenic plants to salt than wild-type plants under salt stress. Therefore, the content of H2O2 in wild-type plants was higher than in transgenic plants. These findings showed that over-expression of ZmCIPK21 might improve membrane integrity and keep ROS levels low during salt stress.
The expression patterns of 42 AvCIPKs were investigated in the salt-tolerant ZMH kiwifruit variety at four time points after salt stress and results showed the expression profile of AvCIPK genes had distinct profiles after salt stress [Gu et al., 2023]. Overexpressing of different OsCIPK genes in transgenic rice significantly improved tolerance to different abiotic stress factors including salt stress [Yong et al., 2007]. It is determined that by modulating ion homeostasis, the CBL4-CIPK5 pathway promotes salt tolerance but not chilling or drought tolerance [Huanga et al., 2020]. In transgenic Arabidopsis plant overexpression of NtCIPK11 approximately twice improved seed germination under 100 mM or 150 mM of NaCl treatment. Furthermore, in transgenic plant the proline significantly accumulated compared with WT and transgenic plants grew more vigorously under salt stress conditions [Lu et al., 2021]. Under high-salinity conditions, TaCIPK25 expression in transgenic wheat did not decrease and remained much higher than in wild-type. Furthermore, transmembrane Na+/H+ exchange was hindered in transgenic wheat root cells, implying that TaCIPK25 negatively controlled salt response in wheat [Jin et al., 2016].
Cotton is an important commercial crop and a major source of raw material for a wide range of consumer goods [Mammadova et al., 2021; Akparov et al., 2021]. It accounts for approximately 35% of total fiber production worldwide. This plant is cultivated in more than 80 countries and it is a leading plant in more than 30
countries [Billah et al. 2021; Anroage, 2022]. Cotton is a relatively salt tolerant crop with a salinity threshold of 7.7 dSm-1. In order to create salt-tolerant cotton cultivars researchers have concentrated their efforts on identifying the major molecular components that involved in the response to salt stress [Wei et al., 2017].
The cotton samples stored in the National Genbank of Azerbaijan were evaluated mainly on the basis of morphometric descriptors, and the durability of the samples was not studied at the molecular-genetic level. The main goal of the research work is to evaluate the expression level of the GhCIPK6 gene under salt stress conditions based on a gene-specific marker, and to compare the change in the expression level in salt-resistant and sensitive genotypes.
Materials and Methods
The research was carried out in the Department of Industrial and Forage Crops of the Institute of Genetic Resources of the Ministry of Science and Education of Azerbaijan. 31 cotton varieties belonging to the species Gossypium hirsutum L. were used as research material. The seeds of the cultivars were received from National Genebank. The used varieties and their used and their origin are presented in Table 1.
Table 1
Research material used for analysis
GenbankID Genotype Origin GenbankID Genotype Origin
AzGR-10139 Aghdash-3 Azerbaijan - Select Greece
AzGR-3601 AP-317 Azerbaijan AzGR-3590 Kirqizistan-174 Kyrgyzstan
AzGR-10202 Bayraqdar Azerbaijan AzGR-13638 Beyaz altun-440 Turkiye
AzGR-11836 Barakat Azerbaijan AzGR-13637 Edessa Turkiye
AzGR-5852 Ganja-110 Azerbaijan - CSN-12 Turkiye
AzGR-7733 Ganja-114 Azerbaijan AzGR-13640 Carisma Turkiye
- Ganja-160 Azerbaijan AzGR-13636 Lima Turkiye
AzGR-11468 Ganja-182 Azerbaijan - May-344 Turkiye
AzGR-12215 Ganja-195 Azerbaijan AzGR-13641 PG Turkiye
AzGR-12216 Ganja-200 Azerbaijan - Sezener-76 Turkiye
AzGR-11839 Zafar Azerbaijan AzGR-13639 Flash Turkiye
AzGR-835 Kharabakh-11 Azerbaijan AzGR-3591 Navai-9 Uzbekistan
- Kharabakh-12 Azerbaijan AzGR-5396 Tashkent - 1 Uzbekistan
- Assos Greece - Tashkent - 2 Uzbekistan
- Cristina Greece - Tashkent - 3 Uzbekistan
- Prime Greece
Growth Conditions and Salt Treatments: For the control and salt variants 10 pre-fumigated seeds of each variety were planted in plastic containers. Plants were irrigated of Hoagland's solution [Hoagland, Arnon, 1950] without sodium chloride until the first true leaf stage. From the transition phase to the first true leaf, 100 mM and 200 mM of NaCl were added to the solution until the final concentration reached [Basal, 2010]. 72 h after the application of salt stress the leaf, root and stem samples of control and salt treated variants were collected and stored at -80°C until RNA extraction. The experiments were performed in three biological replications.
Molecular genetic analysis: The extraction of total RNA was carried out using a RNX Plus (Cat. No: EX6101). SinaClon First Strand cDNA Kit (Cat. No. RT5201) was used to perform first strand cDNA according to manufacturer's instructions. The primers designed by using online tool https://primer3.ut.ee/. Beta tubulin encoding gene (GhTUBl) was used as an endogenous stabilizing factor (Table 2). The RT2 SYBR Green qPCR Mastermix (Qiagen, Cat. No: 330502) was used to evaluate the relative expression, in Rotor Gene Q 5plex (Qiagen, Cat. No. / ID: 9001570). The quantitative PCR reaction was carried out in the following steps: activation stage at 950C for 5 min, 35 cycles (at 950C for 15 s, at 580C for 30 s, at 720C for 1 min), melting curve (at 720C for 1 min). The relative expression level of GhCIPK6 gene was calculated using the 2"AACT method [Pfaffl, 2001]. The least significant difference test was performed using SPSS (IBM, SPSS v.25) software.
Table 2
Characteristics of GhTUBl and GhCIPK6 primers
Gene GenBank ID Primer Sequence Tm (oC)
GhTUBl AF487511.1 Forward ATGGATCTGGAACCCGGTAC 59.35
Reverse AATCGCAATTCTCGGCTTCC 57.30
Reverse GCAGCTTCGGGATGGTAATG 59.35
GhCIPK6 HM002633.1 Forward CCAAATACCCGAATCACCAC 58
Reverse CAAACAAC GGT GACAAAT CG 56
Results and Discussion
In previous studies, the salt resistance of studied cultivars was evaluated based on the germination index (which includes various germination parameters), total chlorophyll content, dry and wet parameters of the root and shoot, and sensitive and resistant cultivars were determined [Alizade, 2022; Alizade, Mammadova, 2023a; Alizade et al., 2023b].
Significant differences between group were found in control and both stress variants in stem and root for GhCIPK6 gene expression (Table 3). However, in leaves, significant differences were determined in the control and 200 mM concentration of stress variant.
Table 3
One-way ANOVA analysis of relative expressions of GhCIPK6 gene
Multiple Comparisons
Dependent variable (I) Treatment (J) Treatment Mean difference (I-J) Std. Error. Sig. 95% confidence interval
Lower Bound Upper bound
GhCIPK6 Leaf Control 100 mM -1,83 4,81 ,704 -11,40 7,73
200 mM -9,65* 4,81 ,048 -19,22 -0,09
GhCIPK6 Stem Control 100 mM -27,57* 7,63 ,000 -42,73 -12,42
200 mM -22,93* 7,63 ,003 -38,08 -7,77
GhCIPK6 Root Control 100 mM -19,47* 8,56 ,025 -36,47 -2,47
200 mM -45,26* 8,56 ,000 -62,26 -28,26
Note: * - the mean difference is significant at the 0.05 level.
The studied genotypes showed significant different expression changes under NaCl treatment in leaves (Table 4). Although a change in the expression level was detected in the leaves of all studied cultivars, this situation was not recorded in the root and stem. At the same time, an increase or decrease in the expression profiles of all the three investigated vegetative organs was not determined. GhCIPK6 gene was upregulated in 16 cultivars and downregulated in 15 cultivars under 100 mM and 200 mM of salt concentrations. Expression patterns of this gene were downregulated in only one tolerant sample at 100 mM concentration. At this concentration, the expression level decreased in sensitive varieties.
Table 4
GhCIPK6 gene expression under salt stress in different vegetative organs
Genotype Salt Leaf Stem Root
tolerance 100 mM 200 mM 100 mM 200 mM 100 mM 200 mM
Aghdash-3 moderate uP uP uP down up down
AP-317 tolerant uP uP down up up up
Bayraqdar moderate uP down uP down - up
Barakat moderate down down down up up up
Ganja-110 moderate down down up down up down
Ganja-114 moderate down down up up up down
Ganja-160 moderate down down up down -
Ganja-182 sensitive down uP up up down down
Ganja-195 moderate uP uP down down up up
Ganja-200 moderate down down - down down up
Kharabakh -11 moderate down uP uP uP down down
Kharabakh -12 moderate uP uP uP uP - up
Zafar moderate uP uP down down up
Kirqizistan-174 tolerant uP down uP - up up
Tashkent-1 moderate down down up up up -
Tashkent-2 tolerant uP uP uP down up down
Tashkent-3 tolerant uP down - up down up
Navai-9 tolerant uP uP up up down up
Edessa moderate down down down up down down
Sezener-76 moderate uP down uP down up up
May-344 moderate uP uP uP uP uP -
Beyaz altun-440 tolerant down uP down - uP uP
CSN-12 moderate uP uP up uP down down
PG moderate down down - down up -
End of the table
Genotype Salt Leaf Stem Root
tolerance 100 mM 200 mM 100 mM 200 mM 100 mM 200 mM
Flash moderate down down uP - up up
Lima moderate uP uP down up - up
Carisma sensitive down down up up up up
Cristina moderate down down down down up up
Assos moderate uP uP down - down down
Prime moderate down uP up down up up
Select moderate uP uP down - up up
Moreover, the cotton genotypes showed a wide spectrum of GhCIPK6 gene expression in stem and root. In stem, the expression of GhCIPK6 was upregulated in 18 samples and downregulated in 9 samples, while in 200 mM concentration, it was upregulated in 14 samples, and downregulated in 11 samples. Although the expression level of GhCIPK6 gene increased in sensitive cultivars at both concentrations of salt, a wide diversity was determined in the change of expression patterns in resistant and moderately resistant cultivars.
In root, under 100 mM concentration of NaCl, expression patterns of GhCIPK6 were upregulated in 18 samples and downregulated in 10 samples, while at 200 mM concentration of NaCl, it was upregulated in 18 samples, and downregulated in 9 samples. The expression level decreased in both concentrations in 1 sensitive varity.
The analysis of mean realtive expression values of GhCIPK6 gene showed an increasing at 100 mM salt concentration in all vegetative organs, however under 200 mM salt concentration.increasing were detected in leaf (Fig. 1.) and root (Fig. 3.) and decreasing were detected in stem (Fig. 2.).
—
I
jl w
a
s
OmM 100 mm 200 mM
Treatment
Fig. 1. Mean value of GhCIPK6 in leaf
In maize under 250 mmol/L NaCl treatment ZmCIPK genes expression in leaf and root showed similar or different expression dynamics in salt-tolerant variety. Also there were different expression patterns of ZmCIPKs between cold-sensitive and cold-tolerant genotypes under cold stress [Chen et al., 2011]. Moreover, in Marchantia polymorpha plants under three concentration of NaCl two CIPKs and three CBLs genes showed different expression dynamics [Tansley et al., 2023]. Tripathi et al. [2009] studied CIPK6 for development and salt tolerance in plants. Overexpression of CaCIPK6 promoted salt tolerance in transgenic tobacco, whereas Arabidopsis mutants were more sensitive to salt stress compared to wild-type. Morever, tobacco mutants showed a developed root system and increased basipetal auxin transport. Four CIPK6 genes were upregulated in roots of salt tolerant wild diploid cotton species Gossypium klotzschianum under 300 mM of NaCl treatment [Wei et al., 2017]. GhCIPK6a overexpression lines revealed increased salt tolerance through involvement in MAPK pathways and ROS scavenging [Billah et al., 2021]. In addition, transgenic Upland cotton lines with high expression of GhCIPK6 showed significantly higher seed germination, seedling field emergence percentages, fiber quality under saline conditions than wild type [Su et al., 2020]. Taghizadeh et al. [2018] evaluated GhCIPK6 gene expression level under two different concentration of NaCl. The results showed that relative expression of GhCIPK6 was increased after 14 days under salt concentration than 7 day in leaf stem and root. Moreover relative expression of this gene was higher in tolerant cultivar than sensitive cultivar.
Fig. 2. Mean value of GhCIPK6 in stem
Fig. 3. Mean value of GhCIPK6 in root
Conclusion
In this study, the relative expression level of GhCIPK6 gene was evaluated in 3 different vegetative organs under two different salt conditions in 31 geographically distant cotton genotypes that differing in salt tolerance. The average value of the relative expression level of GhCIPK6 increased in all vegetative organs at low concentration of salt, although, the increase was observed in leaves and roots at 200 mM concentration of salt. In addition, LSD (least significiantdifference) means test results for relative gene expression of GhCIPK6 gene in different vegetative organs showed significant differences between group.
Similar results were obtained in the assessment of the expression level of mitogen-activated protein kinase (GhMAPK) [Anroage, 2023] and antiporter encoding (GhNHX1) [Alizade, Aliyeva, 2024] genes in 31 studied cotton varieties at 100 and 200 mM concentration of NaCl and the differences between the susceptible and resistant groups allow us to talk about the stability samples are controlled by individual dominant genes.
Based on the obtained data, similar and different changes in the levels of transcripts belonging to different geographical groups and differing in salt tolerance indicate that salt tolerance has a complex genetic structure. At the same time, the differences between the susceptible and resistant groups suggest that the resistance of the samples is controlled by individual dominant genes. At the same time, there is a need to study more CIPK genes in cotton to evaluate salt tolerance in cotton.
The obtained results can be useful in the research works conducted in the direction of salt resistance in cotton.
Список источников
1. Ализаде Шадер. Роль миРНК в ответах на солевой стресс хлопчатника // Достижения в области биологии и наук о Земле. 2022. Т. 7, № 1. С. 80-84.
2. Ализаде Ш.А. Оценка уровня экспрессии гена GhMAPK в условиях солевого стресса у сортов хлопчатника // Биотехнология и селекция растений. 2023. Т. 6, № 4. С. 1-8.
3. Akparov Z.I. et al. Competitive evaluation of perspective cotton lines in variety development nursery // Advances in Current Natural Sciences. 2021. Vol. 10. P. 7-12.
4. Alizada S. et al. System Perspective Analysis for Molecular and Genetic Source of Salt Tolerance in Cotton // Khazar Journal of Science and Technology. 2020. Vol. 4, № 1. P. 70-83.
5. Alizada Sh., Aliyeva K. Comparative analysis of expression profiles of antiporter encoding gene (GhNHX1) under different concentrations of NaCl in cotton (Gossypium hirsutum L.) // Advances in Biology & Earth Sciences. 2024. Vol. 9, № 1. P. 168-174.
6. Alizade S. Comparative study of SPAD values in cotton plant under salt stress // Proceedings of Genetic Resources Institute of ANAS. 2022. Vol. 11, № 1. P. 139-146.
7. Alizade S., Mammadova R. Assessment of salt stress resistance of cotton varieties based on different parameters // Advances in Biology & Earth Sciences. 2023a. Vol. 8, № 1. P. 58-66.
8. Alizade S., Mammadova R., Sirajli N., Evaluation of morphometric traits of upland cotton genotypes under different concentration of NaCl // Advances in Biology & Earth Sciences. 2023b. Vol. 8, № 3. P. 301-307.
9. АтаЬ M. et al. Сomрrehensive Аnаlуsis of Са1сшш Sensor Fаmi1ies, СБЬ апё С1РК, in Aeluropus littoralis md Their Exрression РтоАк in Resрonse to Sа1initу // Genes. 2023. Vol. 14. P. 1-14.
10. Bаi X. et al. Сhаrасterizаtion of СБЬ-Шета^^ Рrotein Kisses Gene Fаmi1у md Exрression Раttern Reveа1 Their Imрortаnt Roles in Resрonse to Sа1t Stress in Рoр1аr // Forests. 2022. Vol. 13. P. 1-13.
11. Basal H. Response of cotton (Gossypium hirsutum L.) genotypes to salt stress // Pak. J. Bot. 2010. Vol. 42, № 1. P. 505-511.
12. Bilkh M, Li F., Уа^ Z. Reg^to^ Network of ^tton Genes in Resрonse to Sа1t, Drought аnd Wilt Diseаses (Verticillium аnd Fusarium): Рrogress аnd Рersрeсtive // Front. Р1ай Sci. 2021. Vol. 12. P. 1-19.
13. ^en X. et al. Identifiсаtion аnd сhаrасterizаtion of рЩ^^ С1РК genes in mаize // Jourrnl of Genetics end Genomes. 2011. Vol. 38. P. 77-87.
14. ^en X. et al. ZmCIPK21, А Mаize СБL-Interасting Ki^se, Enhаnсes Sа1t Stress Tolerance in Arabidopsis thaliana // Int. J. Mol. Sci. 2014. Vol. 15. P. 14819-14834.
15. Deng X. et а1. ТаС!РК29, а СBL-Interаcting Ргс^т Kirnse Gene from Wheаt, infers Sа1t Stress Tolerate in Transgenic Totocco // РLoS ONE. 2013. Vol. 8, № 7. P. 1-13.
16. Gu S. et al. Trаnscriрtome-Wide Identificаtion md Functionа1 Сhаrаcterizаtion of СШК Gene Fаmi1у Members in Actinidia valvata under Sа1t Stress // Int. J. Mol. Sci. 2023. Vol. 24, № 1. P. 1-15.
17. Hoagland D.R., Arnon D.I. The water-culture method for growing plants without soil. Circular. California Agricultural Experiment Station, 1950. 347 p.
18. Нш^а S. et al. СBL4-СIРK5 раthwау confers sа1t but not drought аnd chilling tolerance Ьу regu1аting ion homeostаsis // Environmen^l аnd Exрerimentа1 Бotаnу. 2020. Vol. 179. P. 1-30.
19. Huer!^ R. et al. Overexрression of S1SOS2 (S1СIРK24) confers sа1t tolerance to transgenic tomаto // Р1ай Сe11 Environ. 2012. Vol. 35. P. 1467-1482.
20. Jin X. et al. Wheаt СБL-interаcting рrotein kinаse 25 negаtive1у regu1аtes sа1t to1erаnce in trаnsgenic wheаt // Scientific Reрorts. 2016. Vol. 6. P. 1-16.
21. Kim K.N. et al. СТРЮ, а cа1cium sensor-аssociаted рrotein kinаse thаt reguktes аЬscisic аcid аnd cold sigrnl trаnsduction in АrаЬidoрsis // Ркй Сe11. 2003. Vol. 15. P. 411-423.
22. Li L. et al. А Са2+ sigrnling раthwау regu1аtes а K+ chаnne1 for low-K resрonse in АrаЬidoрsis // Ртос. Nаt1. Аcаd. Sci. 2006. Vol. 103. P. 12625-12630.
23. Lin С. et al. Integrated trаnscriрtome md рroteome аnа1уsis reveа1s comр1ex regu1аtorу mechаnism of cotton in resрonse to sа1t stress // Jourml of Сotton Reseаrch. 2021. Vol. 4. P. 1-13.
24. Lu L. et al. CIPK11: а са^^тт B-like рroteininterаcting рrotein kinаse from Nitraria tangutorum, confers tolerance to sа1t аnd drought in Arabidopsis // BMС Р1аnt Бio1ogу. 2021. Vol. 21. P. 1-16.
25. Mammadova R.B. et al. Prospects of the remote hybridization on improvement of the main economical traits of cotton genotypes with naturally colored fibre // East European Scientific Journal. 2021. Vol. 6, № 70. P. 4-7.
26. Pffafl M.W. A new mathematical model for relative quantification in real-time RT-PCR // Nucleic Acids Research. 2001. Vol. 29, № 9. P. 1-6.
27. Shu B. et al. Identifуing citrus CBL md CIPK gene fаmi1ies аnd their exрressions in resрonse to drought md аЛ^с^ат mуcorrhizа1 fungi co1onizаtion // Bio1ogiа Р1аntаrum. 2020. Vol. 64. P. 773-783.
28. Su Y. et al. GhCIPK6a increаses sа1t tolerance in transgenic ^knd cotton Ьу involving in ROS scаvenging аnd MАРK sigmling раthwауs // БMС Р1аnt Бio1ogу. 2020. Vol. 20. P. 1-19.
29. Taghizadeh N. et al. Salt-related Genes Expression Pattern in Salt-Tolerant and Salt Sensitive Cultivars of Cotton (Gossypium sp.) under NaCl Stress // J. Plant Mol. Breed. 2018. Vol. 6, № 1. P. 1-15.
30. Tansley C. et al. CIPK-B is essential for salt stress signalling in Marchantia polymorpha // New Phytologist. 2023. Vol. 237. P. 2210-2223.
31. Tripathi V. et al. CIPK6, a CBL-interacting protein kinase is required for development and salt tolerance in plants // The Plant Journal. 2009. Vol. 58. P. 778-790.
32. Wei Y. et al. Salt stress responsiveness of a wild cotton species (Gossypium klotzschianum) based on transcriptomic analysis // PLoS ONE. 2017. Vol. 12, № 5. P. 1-25.
33. Xi Y. et al. The CBL and CIPK Gene Family in Grapevine (Vitis vinifera): Genome-Wide Analysis and Expression Profiles in Response to Various Abiotic Stresses // Front. Plant Sci. 2017. Vol. 8. P. 1-15.
34. Yang C. et al. Diverse roles of the CIPK gene family in transcription regulation and various biotic and abiotic stresses: A literature review and bibliometric study // Front. Genet. 2022. Vol. 13. P. 1-17.
35. Yin X. et al. The protein kinase complex CBL10-CIPK8-S0S1 functions in Arabidopsis to regulate salt tolerance // J. Exp. Bot. 2020. Vol. 71. P. 1801-1814.
36. Yong X., Yuemin H., Lizhong X. Characterization of Stress-Responsive CIPK Genes in Rice for Stress Tolerance Improvement // Plant Physiology. 2007. Vol. 144. P. 1416-1428.
References
1. Alizade S. [Role of miRNAs in cotton salt stress responses]. Dostizenija v oblasti biologii i nauk o Zemle. V. 7, No.1 (2022): pp. 80-84. (In Russ.).
2. Alizade Sh.A. [Evaluation of the GhMAPK gene expression level under salt stress in cotton cultivars]. Bio-technologija i selekcija rastenij. V. 6, No. 4 (2023): pp. 1-8. (In Russ.).
3. Akparov Z.I., Mamedova R.B., Guseynova L.A., Abdulalieva G.S., Yunusova F.M., Alizade Sh.A. Competitive evaluation of perspective cotton lines in variety development nursery. Advances in Current Natural Sciences. V.10 (2021): pp. 7-12.
4. Alizada S, Guliev R, Mammadova R, Zaefizadeh M. System Perspective Analysis for Molecular and Genetic Source of Salt Tolerance in Cotton. Khazar Journal of Science and Technology. V. 4, No. 1 (2020): pp. 70-83.
5. Alizada Sh., Aliyeva K. Comparative analysis of expression profiles of antiporter encoding gene (GhNHX1) under different concentrations of NaCl in cotton (Gossypium hirsutum L.). Advances in Biology & Earth Sciences. V. 9, No. 1 (2024): pp. 168-174.
6. Alizade S. Comparative study of SPAD values in cotton plant under salt stress. Proceedings of Genetic Resources Institute of ANAS. V. 11, No. 1 (2022): pp. 139-146.
7. Alizade S., Mammadova R. Assessment of salt stress resistance of cotton varieties based on different parameters. Advances in Biology Earth Sciences. V. 8, No. 1 (2023a): pp. 58-66.
8. Alizade S., Mammadova R., Sirajli N. Evaluation of morphometric traits of upland cotton genotypes under different concentration of NaCl. Advances in Biology & Earth Sciences V. 8, No. 3 (2023b): pp. 301-307.
9. Arab M., Najafi Z.H., Nematzadeh G., Heidari P., Hashemipetroudi S.H., Kuhlmann M. Comprehensive Analysis of Calcium Sensor Families, CBL and CIPK, in Aeluropus littoralis and Their Expression Profile in Response to Salinity. Genes. V. 14 (2023): pp. 1-14.
10. Bai X., Ji J., Wang W., Gu C., Yu Q., Jiang J., Yang C., Liu G. Characterization of CBL-Interacting Protein Kinases Gene Family and Expression Pattern Reveal Their Important Roles in Response to Salt Stress in Poplar. Forests. V. 13 (2022): pp. 1-13.
11. Basal H. Response of cotton (Gossypium hirsutum L.) genotypes to salt stress. Pak. J. Bot. V. 42, No. 1 (2010): pp. 505-511.
12. Billah M., Li F., Yang Z. Regulatory Network of Cotton Genes in Response to Salt, Drought and Wilt Diseases (Verticillium and Fusarium): Progress and Perspective. Front. Plant Sci. V. 12 (2021): pp. 1-19.
13. Chen X., Gu Z., Xin D., Hao L., Liu C., Huang J., Ma B., Zhang H. Identification and characterization of putative CIPK genes in maize. Journal of Genetics and Genomics. V. 38 (2011): pp. 77-87.
14. Chen X., Huang Q., Zhang F., Wang B., Jianhua W., Jun Z., ZmCIPK21, A Maize CBL-Interacting Kinase, Enhances Salt Stress Tolerance in Arabidopsis thaliana. Int. J. Mol. Sci. V. 15 (2014): pp. 14819-14834.
15. Deng X., Hu W., Wei S., Zhou S., Zhang F. TaCIPK29, a CBL-Interacting Protein Kinase Gene from Wheat, Confers Salt Stress Tolerance in Transgenic Tobacco. PLoS ONE. V. 8, No. 7 (2013) pp. 1-13.
16. Gu S., Abid M., Bai D., Chen C., Sun L., Qi X., Zhong Y., Fang J. Transcriptome-Wide Identification and Functional Characterization of CIPK Gene Family Members in Actinidia valvata under Salt Stress. Int. J. Mol. Sci. V. 24, No. 1 (2023): pp. 1-15.
17. Hoagland D.R., Arnon D.I. The water-culture method for growing plants without soil. Circular. California Agricultural Experiment Station, 1950. 347 p.
18. Huаngа S., Сhenа M., Zhаoа У., Wenа X., GuoЬ Z., Luа S. СБL4-СIРK5 раthwау confers sа1t Ьut not drought md chilling to1erаnce Ьу regu1аting ion homeostаsis, Environmental and Experimental Botany. V. 179 (2020): pp. 1-30.
19. Hue^^s R., Oliаs R., E1jаkаoui Z., Gа1vez F.J., Li J., De Morales, Р.А., Overexрression of S1SOS2 (S1СIРK24) confers sа1t to1erаnce to trаnsgenic tomаto. Plant Cell Environ. V. 35 (2012): pp. 1467-1482.
20. Jin X., Sun T., Wаng X., Su Р., Mа J., He G., Уаng G. Wheаt СБL-interаcting рrotein kinаse 25 negаtive1у regu1аtes sа1t to1erаnce in trаnsgenic wheаt. Scientific Reports V. 6 (2016): pp. 1-16.
21. Kim K.N., ^eong Y.H., Grant J.J., Раndeу G.K., Lrnn S. СIРK3, а са^кт sensor-аssociаted рrotein kinаse thаt reguktes аЬscisic аcid аnd cold sigrnl trаnsduction in АrаЬidoрsis. Plant Cell. V. 15 (2003): pp. 411-423.
22. Li L., Kim B.G., ^eong Y.H., Раndeу G.K., L^n S. А Са2+ signа1ing раthwау regu1аtes а K+ chаnne1 for low-K resрonse in АrаЬidoрsis. Proc. Natl. Acad. Sci. V. 103 (2006): pp. 12625-12630.
23. Lin С., Heng S., Jie K., Шща^ X., Xiуаn У. Integrated trаnscriрtome аnd рroteome аnа1уsis reveа1s comр1ex regu1аtorу mechаnism of cotton in resрonse to sа1t stress. Journal of Cotton Research. V. 4 (2021): pp. 1-13.
24. Lu L., ^en X., Wаng Р., Lu Y., Zhаng J., Уаng X., Сheng T., Shi J., ^en J. CIPK11: а cа1cineurin Б-like рroteininterаcting рrotein ki^se from Nitraria tangutorum, confers tolerance to sа1t аnd drought in Arabidopsis. BMС Р1аnt Бio1ogу.V. 21 (2021): рр. 1-16.
25. Mammadova R.B., Huseynova L.A., Abdulaliyeva G.S., Yunusova F.M., Alizade Sh.A. Prospects of the remote hybridization on improvement of the main economical traits of cotton genotypes with naturally colored fibre. East European Scientific Journal. V. 6, No. 70 (2021): pp. 4-7.
26. Pffafl M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research. V. 29, No. 9 (2001): pp. 1-6.
27. Shu B., Саi D., Zhаng F., Zhаng D.J., Liu С.У., Wu Q.S., Luo С. Identif7ing citrus CBL md CIPK gene fаmi1ies аnd their exрressions in resрonse to drought аnd аrЬuscu1аr mуcorrhizа1 fungi co1onizаtion. Biologia Plantarum. V. 64 (2020): pp. 773-783.
28. Su Y., Guo А., Huаng Y., Wаng У., Huа J. GhCIPK6a increаses sа1t to1erаnce in transgenic ^knd cotton Ьу involving in ROS scаvenging аnd MАРK sigrnling раthwауs. BMC Plant Biology. V. 20 (2020): рр. 1-19.
29. Tаghizаdeh N., RаnjЬаr G., Nemаtzаdeh G., Rаmаzаni-Moghаddаm M., Sа1t-re1аted Genes Exрression Раttern in Sа1t-To1erаnt аnd Sа1t Sensitive Сu1tivаrs of ^fton (Gossypium sр.) under NаС1 Stress, J. Plant Mol. Breed. V. 6, No.1 (2018): pp. 1-15.
30. Tаns1eу C., Houghton J., Rose АМ^., Witek Б., Рауet R.D., Wu T., Miller B.J., С^-Б is essentiа1 for sа1t stress signа11ing in Marchantiapolymorpha. New Phytologist. V. 237 (2023): pp. 2210-2223.
31. МраШ V., Раrаsurаmаn B., Lаxmi А., Сhаttoраdhуау D. СIРK6, а СБL-interаcting рrotein kinаse is required for develoрment аnd sа1t to1erаnce in р1а^5. The Plant Journal. V. 58 (2009): pp. 778-790.
32. Wei Y., Xu У., Lu Р., Wаng X., Li Z., Саi X., Zhou Z., Wаng Y., Zhаng Z., Lin Z., Liu F., Wаng K. Sа1t stress resрonsiveness of а wild cotton sрecies (Gossypium klotzschianum) Ьаsed on trаnscriрtomic аnа1уsis. PLoS ONE. V. 12, No. 5 (2017): pp. 1-25.
33. Xi Y., Liu J., Dong С., Сheng Z.M. The СBL аnd СIРK Gene Fаmi1у in Grарevine (Vitis vinifera): Genome-Wide Аnа1уsis аnd Exрression Ртой^ in Resрonse to Vаrious АЬюйс Stresses. Front. Plant Sci. V. 8 (2017): рр. 1-15.
34. Yаng С., Yi-feng J., Yushu W., Yаnsong G., Qi W., Xue Y. Diverse roles of the СIРK gene fаmi1у in ^ашспр;^ regu1аtion аnd vаrious Ьюйс аnd аЬiotic stresses: А literature review md ЬiЬ1iometric studу. Front. Genet. V. 13 (2022): pp. 1-17.
35. Yin X., Xiа Y., Xie Q., Саo Y., Wаng Z., Hаo G. The рrotein kinаse comр1ex СБL10-СIРK8-SOS1 functions in Аrаbidoрsis to regu1аte sа1t to1erаnce. J. Exp. Bot. V. 71 (2020): pp. 1801-1814.
36. Yong X, Yuemin H., Lizhong X. Сhаrаcterizаtion of Stress-Resрonsive СIРK Genes in Rice for Stress Tolerance Imрrovement. Plant Physiology. V. 144 (2007): рр. 1416-1428.
Статья поступила в редакцию 26.02.2024; одобрена после рецензирования 26.04.2024; принята к публикации 10.06.2024.
The article was submitted 26.02.2024; approved after reviewing 26.04.2024; accepted for publication 10.06.2024. Информация об авторе
Ш. А. Ализаде - докторант, научный сотрудник. Information about the author
S. A. Alizade - PhD student, researcher.
