Научная статья на тему 'Совершенствование методов экстренной лабораторной диагностики трансмиссивных клещевых инфекций в условиях сочетанных природных очагов Прибайкалья'

Совершенствование методов экстренной лабораторной диагностики трансмиссивных клещевых инфекций в условиях сочетанных природных очагов Прибайкалья Текст научной статьи по специальности «Прочие медицинские науки»

CC BY
271
53
i Надоели баннеры? Вы всегда можете отключить рекламу.
Журнал
Acta Biomedica Scientifica
ВАК
Ключевые слова
ЭКСПРЕСС-ДИАГНОСТИКА / ТРАНСМИССИВНЫЕ КЛЕЩЕВЫЕ ИНФЕКЦИИ / EXPRESS DIAGNOSTICSTICS / TRANSMISSIBLE TICK INFECTIONS

Аннотация научной статьи по прочим медицинским наукам, автор научной работы — Лисак О. В., Козлова И. В., Верхозина М. М., Дорощенко Е. К., Сунцова О. В.

В статье представлены результаты анализа многолетних данных экспресс-диагностики КЭ и ИКБ, осуществляемой в Центре диагностики и профилактики трансмиссивных клещевых инфекций в г. Иркутск. Доказывается возможность успешного применения ИФА для индикации антигена вируса КЭ в клещах и крови людей и прямой микроскопии для обнаружения в переносчиках боррелий. Отмечаются некоторые недостатки, присущие используемым методам и намечены возможные пути их устранения. Показано, что перспективным методом экспресс-диагностики всего комплекса инфекций, передаваемых через укус клещей (вирус КЭ, боррелии, риккетсии, эрлихии, анаплазмы) является ПЦР. Составлен алгоритм проведения комплексных лабораторных экспресс-исследований переносчиков в условиях существования сочетанных очагов трансмиссивных клещевых инфекций.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по прочим медицинским наукам , автор научной работы — Лисак О. В., Козлова И. В., Верхозина М. М., Дорощенко Е. К., Сунцова О. В.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

The improvent of the methods of the express laboratory diagnostics of transmissible tick infections in combined natural foci in Pribaikalye

The article presents the data of long period researches of express diagnostics of TBE and ITBB in the Centre of diagnostics and prophylactics of transmissible tick infections in Irkutsk. The possibilities of usage of ELISA for indication TBE virus antigen in ticks and human blood and direct microscopy for discovering in borrelia carriers. The drawbacks of certain methods are indicated and the ways of their improvement are suggested. The perspective method of quick diagnostics of infection complexes made by tick bites is PCR. The algorithm of complex quick researches of carriers in mixed natural foci is presented.

Текст научной работы на тему «Совершенствование методов экстренной лабораторной диагностики трансмиссивных клещевых инфекций в условиях сочетанных природных очагов Прибайкалья»

УДК 616025.-002.954.2;576.807.7

О.В. Лисак, И.В. Козлова, И.М. Верхозина, Е.К. Дорощенко, О.В. Сунцова, Л.Б. Бадуева,

И.О. Горина, Т.В. Демина, И.А. Хаснатинов, С.С. Шулунов, С.Э.Дигас, 'В.И. Злобин

СОВЕРШЕНСТВОВАНИЕ МЕТОДОВ ЭКСТРЕННОЙ ЛАБОРАТОРНОЙ ДИАГНОСТИКИ ТРАНСМИССИВНЫХ КЛЕЩЕВЫХ ИНФЕКЦИЙ В УСЛОВИЯХ СОЧЕТАННЫХ ПРИРОДНЫХ ОЧАГОВ ПРИБАЙКАЛЬЯ

Институт эпидемиологии и микробиологии НЦ МЭ ВСНЦ СО РАМН (Иркутск) 1ГУ НИИ вирусологии им. Д.И. Ивановского (Москва)

В статье представлены результаты анализа многолетних данных экспресс-диагностики КЭ и ИКБ, осуществляемой в Центре диагностики и профилактики трансмиссивных клещевых инфекций в г. Иркутск. Доказывается, возможность успешного применения ИФА для. индикации антигена вируса КЭ в клещах и. крови, людей и. прямой микроскопии для. обнаружения, в переносчиках боррелий. Отмечаются некоторые недостатки, присущие используемым, методам, и. намечены возможные пути их устранения. Показано, что перспективным, методом, экспресс-диагностики, всего комплекса инфекций, передаваемых через укус клещей (вирус КЭ, боррелии, риккетсии, эрлихии, анаплазмы) является. ПЦР. Составлен алгоритм, проведения, комплексных лабораторных экспресс-исследований переносчиков в условиях существования, сочетанных очагов трансмиссивных клещевых инфекций.

Ключевые слова: экспресс-диагностика, трансмиссивные клещевые инфекции

THE IMPROVENT OF THE METHODS OF THE EXPRESS LABORATORY DIAGNOSTICS OF TRANSMISSIBLE TICK INFECTIONS IN COMBINED NATURAL FOCI IN PRIBAIKALYE

O.V. Lisak, I.V. Kozlova, M.M. Verkhozina, E.K. Doroschenko, O.V. Suntsova, L.B. Badueva, M.O. Gorina, T.V. Demina, M.A. Khasnatinov, S.S. Shulunov, S.E. Digas, *V.I. Zlobin

Institute of Epidemiology and Microbiology SC ME, ESSC SB RAMS, Irkutsk 1D.I. Ivanovsky Institute of Virology RAMS, Moscow

The article presents the data of long period, researches of express diagnostics of TBE and ITBB in the Centre of diagnostics and prophylactics of transmissible tick infections in Irkutsk. The possibilities of usage of ELISA for indication. TBE virus antigen in ticks and. human blood and. direct microscopy for discovering in borrelia carriers. The drawbacks of certain methods are indicated and. the ways of their improvement are suggested. The perspective method, of quick diagnostics of infection complexes made by tick bites is PCR. The algorithm of complex quick researches of carriers in mixed, natural foci is presented.

Key words: express diagnosticstics, transmissible tick infections

В литературе последних лет особое внимание уделяется фактам возможного одновременного инфицирования лиц, отмечавших присасывание клеща, возбудителями сразу нескольких трансмиссивных заболеваний. Появились сообщения о случаях сочетанного инфицирования вирусом клещевого энцефалита и боррелиями на различных территориях России [1—4, 6 — 8, 10]. Э.И. Ко-ренберг считает, что широкое распространение природно-очаговых микстинфекций, передающихся клещами, — это нормальное, закономерное явление, которое встречается значительно чаще, чем моноинфекция [8]. В настоящее время диагностированы смешанные инфекции борре-лиозно-эрлихиозной природы [2], энцефалитно-бабезиозные [13], риккетсиозно-энцефалитные [4] и др.

Поскольку на территории Прибайкалья большинство очагов трансмиссивных клещевых инфекций является совмещенными, каждое инфицирование, которое может возникнуть в результате укуса клеща, необходимо рассматривать как потенциальную микстинфекцию. В

связи с этим, остро встает вопрос о необходимости оценки возможностей существующих методов выявления возбудителей клещевых инфекций и разработки предложений по совершенствованию лабораторной диагностики всего комплекса патогенов, передаваемых через укус клеща. Если экстренная лабораторная диагностика таких инфекций как клещевой энцефалит (КЭ) и иксодовые клещевые боррелиозы (ИКБ) разработана и применяется во многих регионах РФ, то лабораторная дифференциация таких инфекций как клещевой риккетсиоз (КР), моноцитарный эрлихиоз человека (МЭЧ) и гранулоцитарный анаплазмоз человека (ГАЧ) на сегодняшний день на большинстве территорий отсутствует.

Цель работы — совершенствование экстренной дифференциальной лабораторной диагностики трансмиссивных клещевых инфекций в условиях сочетанных природных очагов Прибайкалья за счет внедрения современных молекулярно-генетических тестов и расширения спектра определяемых патогенов.

МАТЕРИАЛЫ И МЕТОДЫ

Для оценки эффективности ИФА для обнаружения в клеще антигена вируса КЭ исследовано 41 404 экземпляра клещей и 11 564 сыворотки крови от пострадавших людей. На наличие боррелий проанализировано 30 469 переносчиков.

Для экспресс-индикации антигена вируса КЭ в клещах и крови людей использовали ИФА. Исследование проводили согласно инструкции производителя тест-системы (ФГУП НПО «Микроген», Томск). Результаты ИФА учитывали на спектрофотометре EL4800 (BIO-TEK Instruments, USA) при длине волны 450 нм, «бланк» осуществляли по воздуху. Также детекцию РНК вируса КЭ в клещах осуществляли с помощью коммерческой ПЦР-тест-системы «ВектоВКЭ-РНК-ампли-100» согласно инструкции производителя («Вектор-Бест», Новосибирская область).

Для обнаружения боррелий в клещах применяли метод светлопольной микроскопии фиксированных препаратов содержимого кишечника клеща. Полученные препараты окрашивали по Романовс-кому-Гимза и докрашивали кристаллическим фиолетовым. Просмотр мазков осуществляли посредством прямой микроскопии с использованием микроскопа МИКМЕД-2 и иммерсионных масляных объективов х100 и окуляров х10; х15.

Для выявления специфической ДНК боррелий использовали следующие праймеры: 1323 (5'-TGGCAGTGCGTCTTAAGCATG - 3') и 1499 (5' -ATCGAATTAAACCACATGCTCCAC - 3') фланкирующие фрагмент гена 16S рРНК боррелий длиной 922 н.о.; 1284 (TCTGATGATGCTGCTGGTATGGG) и 1285 (GCACCTAAATTTGCTCTTTGATC), позволяющие амплифицировать фрагмент гена флагел-лина длиной 683-689 н.п. Структуры для синтеза данных праймеров отобраны М.А. Хаснатиновым. Для постановки ПЦР использовали амплификато-ры «Терцик» (ЗАО «ДНК-технология», Москва) или «GeneAmp 2700» (USA). В качестве положительного контроля использовали ДНК типового штамма B. afzelii Ip21 (НИИЭМ им. Гамалеи, Москва), в качестве отрицательного — ДНК E. coli (штамм Jm109).

Размер и чистоту амплифицированного фрагмента оценивали при помощи электрофореза в 4% полиакриламидном геле. Продукты ПЦР окрашивали аммиакатом серебра по J.G. Guillemette с незначительными модификациями [17]. Также для детекции ДНК боррелий использовали коммерческие ПЦР-тест-системы производства «Хеликс» (Санкт-Петербург) и «ВектоЛайм-ДНК-ампли-100» («Вектор-Бест», Новосибирская область) согласно инструкции производителей.

Для обнаружения риккетсий группы КПЛ использовали однораундовую ПЦР с праймерами RICK33 (5‘-GCAATACAACAAGGTCTTAAAGCCGC-3‘) и RICK532 (5‘-TGCAGCATTCGCTCCCCCTAAAG -3‘), амплифицирующими фрагмент гена rOmpA длиной 500 п.о. Структуры для синтеза данных праймеров отобраны С.Э. Дигас. Также детекцию ДНК риккетсий осуществляли с помощью коммерческой ПЦР-

тест-системы «GenePak» («Biokom», Санкт-Петербург) (Rri, Риккетсия Rickettsiarickettsii).

Кроме того, для обнаружения ДНК риккетсий и их типирования использовали метод двухраундовой ПЦР с праймерами, соответствующими фрагментам генов цитратсинтазы (gltA) и поверхностного белка rümpA [12]. На первом этапе применяли родоспецифичные праймеры (из области гена gltA). Во втором раунде видовую принадлежность и генетические варианты выявленных риккетсий определяли с помощью праймеров, специфичных участкам гена rOmpA R. sibirica и R. slovaca.

ДНК эрлихий и анаплазм в образцах клещей выявляли с помощью двухраундовой ПЦР. На первом этапе использовали родоспецифичные праймеры (из области гена 16S рРНК). Во втором раунде определяли видовую принадлежность и генетические варианты выявленных возбудителей.

Кроме того, для обнаружения ДНК эрлихий и анаплазм использовали однораундовую ПЦР с коммерческой тест-системой «GenePak» («Biokom», Россия) (Ehr, Эрлихия общ. Ehrlichia spp.).

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

На территории Иркутской области кроме сочетанных очагов КЭ и ИКБ установлено существование очагов КР, МЭЧ, и ГАЧ, что резко повышает риск одновременного инфицирования лиц, пострадавших от присасывания клеща, сразу несколькими возбудителями и развития у них микстинфекций. Для проведения адекватных профилактических мероприятий необходим скрининг снятых с людей переносчиков, который должен предусматривать комплекс исследований, проводимых с целью одновременного обнаружения всех возбудителей, передаваемых через укус клеща.

Наиболее приемлемым методом для оперативного решения вопроса о наличии вируса КЭ в присосавшемся клеще является иммуноферментный анализ (ИФА). Реакция высоко чувствительна, специфична, экономична и проста в исполнении, экспресс-исследование занимает всего несколько часов. ИФА позволяет не только провести индикацию антигена вируса КЭ в клеще, но и оценить количественно его содержание в исходном материале [5]. Высокая эффективность ИФА для прямого обнаружения антигена вируса КЭ в клеще показана многими исследователями [11, 16]. Вместе с тем, диагностические возможности и надежность использования ИФА для оценки риска заражения людей по результатам обнаружения антигена вируса КЭ в клещах оставались малоизученными. После разработки в 1989 г. коллективом авторов под руководством Л.Е. Подоп-лекиной тест-системы для выявления антигена вируса КЭ и апробации ИФА для индикации вируса КЭ в отдельных экземплярах клещей в г. Перми (1986 — 1990 гг.) стало возможным более широкое использование данного метода экспресс-диагностики [15]. Именно ИФА, начиная с 1992 г., применяется в работе Центра диагностики и профилактики клещевых инфекций для индикации антигена вируса КЭ в переносчиках. За период с 1992 по 2006 гг. исследова-

но 47 352 экземпляра клещей. Анализ случаев заболевания у людей с отрицательными результатами ИФА на наличие антигена вируса КЭ показал, что в дальнейшем ложноотрицательными признаны только 18 (0,04 %) из них. У заболевших КЭ людей отмечались только не очаговые формы заболевания (у 13

— лихорадочная, у 5 — менингеальная). Ложноотрицательные результаты исследования в 35,7 % случаев были связаны с плохой сохранностью клеща (сухой, раздавленный, фрагментированный т.д.) или определением антигена в крови в поздние сроки (14,3 %). В двух случаях (11,1 %) у пациентов наблюдались множественные укусы клещей, поэтому выбор сроков забора крови для обнаружения антигена вируса КЭ и проведения профилактики представлял трудности.

Только около двух третей клещей, поступающих на исследование в Центр диагностики и профилактики клещевых инфекций, пригодны для анализа в ИФА. Поэтому, начиная с 1995 г., в случае непригодности клеща для исследования по физическим кондициям или его отсутствия анализу на наличие антигена вируса КЭ подвергали кровь пациента. Принципиально важным моментом было установление оптимальных сроков забора материала. В литературе отмечается, что первичная вирусемия у пациентов наблюдается в сроки от нескольких часов до 1 недели с момента инфицирования. Максимум анти-генемии приходится на первые четверо суток [9, 14]. Исследование крови в ИФА спустя 96 часов после укуса клеща показывает высокую результативность обнаружения антигена вируса КЭ, но практически не оставляет времени для проведения серопрофилактики в рекомендуемые для нее сроки. Исходя из этого, оптимальными сроками для выявления вируса КЭ в крови инфицированных людей являются 24 — 72 часа с момента укуса.

Для экспресс-выявления в клещах боррелий наиболее подходящей оказалась прямая микроскопия фиксированных мазков содержимого кишечника членистоногих. Метод был апробирован рядом исследователей и рекомендован для широкого практического использования. С 1995 г. он внедрен в работу Центра диагностики и профилактики трансмиссивных клещевых инфекций. За двенадцатилетний период наблюдения из 26 980 отрицательных результатов только 16 оказались ложноотрицательными (0,06 %). В 40,0 % случаев гиподиагностика была связана с исследованием клещей, продолжительность питания которых на человеке составляла более 2 — 3 суток. В этих случаях, из-за густого мазка и наличия в нем крови, обнаружение спирохеты было затруднено, что снижало эффективность проводимой диагностики. Одним из важных аспектов нашей работы явилась разработка алгоритма исследований, позволяющего проводить надежное выявление в клещах обоих патогенов. Учитывая разную преимущественную локализацию вируса КЭ (слюнные железы) и боррелий (кишечник) в переносчике, мы посчитали возможным объединение метода ИФА с прямой микроскопией и использование их одновременно, но в виде последовательных стадий.

При этом стадия детекции боррелий в кишечнике клеща должна предшествовать стадии определения антигена вируса КЭ с помощью ИФА. Десятилетний опыт работы «Центра» доказал успешность применения данного алгоритма лабораторной диагностики для обнаружения возбудителей КЭ и ИКБ.

Несмотря на достаточно высокую эффективность экспресс-диагностики КЭ и ИКБ, в процессе многолетней работы нами были выявлены и некоторые недостатки используемых методов, которые требуют устранения. Например, прямая микроскопия содержимого кишечника клеща не всегда позволяет обнаруживать спирохеты в напитавшемся клеще, что приводит к выдаче пациенту ложноотрицательного результата. Около трети представленных на исследование клещей не пригодны для анализа на наличие боррелий, вследствие их плохой сохранности (сухие, фрагментированные, раздавленные и т.д.). Кроме того, с помощью микроскопии нельзя получить информацию о патогенности обнаруженных боррелий. А по данным А.Н. Алексеева, только 85 — 90 % боррелий, обнаруживаемых в клещах, являются патогенными для человека [2]. Следовательно, от 10 до 15 % пациентов, пострадавших от укусов клещей, могут получать в этом случае антибиотикопрофилактику необоснованно. Возможно, что все эти недостатки лабораторной диагностики смогло бы устранить использование молекулярно-генетических методов с проведением ге-нотипирования возбудителей.

С этой целью поиск более эффективных диагностических тестов для обнаружения патогенов, передаваемых через укус клеща, был нами продолжен. В 2003 г. для обнаружения ДНК боррелий в различных видах материала, полученного от пострадавших от укуса клещей людей, нами была применена полимеразная цепная реакция (ПЦР). ПЦР-анализ проводили с коммерческим набором «Хе-ликс» и собственными наборами реактивов на основе праймеров к генам 16S рРНК и флагеллина, Исследовали различные образцы биологического материала: кровь, мочу, напитавшихся имаго I, рє^иісаіш, нимф, суспензии клещей, оставшиеся после постановки ИФА (табл. 1).

Было установлено, что эффективность ПЦР с праймерами для амплификации участка гена 163 рРНК была заметно выше, чем ПЦР с праймерами на основе участка гена белка флагеллина. Более высокой чувствительностью обладали собственные тест-системы на основе праймеров к фрагменту гена 16S рРНК и коммерческая тест-система фирмы «Хеликс». ДНК боррелий обнаружена в 8,9 % клещей I, рє^иісаіш. При изучении 22 проб напитавшихся имаго клещей, ДНК возбудителя ИКБ была обнаружена в восьми из них. Зараженность напитавшихся клещей по данным ПЦР составила 36,4 %. А ведь именно клещи с продолжительностью питания от 24 часов и больше являются наиболее опасными для человека в плане передачи ему боррелиозной инфекции. Таким образом, в результате проведенного исследования была показана возможность использова-

Таблица 1

Результаты исследования материала на наличие ДНК боррелий с помощью ПЦР

Вид материала Количество исследованных проб Количество позитивных проб в ПЦР

Суспензии клещей I. ре^икаи 135 12

Напитавшиеся имаго клещей I. регвикаив, снятые с людей 22 8

Нимфы I. ре^икаи 1 1

Сыворотки крови от больных ИКБ людей 9 1

Моча от больных ИКБ людей 9 2

ния ПЦР для детекции боррелий в напитавшихся, сухих клещах и фрагментах клещей, что не удается при использовании прямой микроскопии. В ходе работы также было сделано заключение о том, что для повышения достоверности ПЦР необходимо исследовать сразу несколько клинических образцов материала от одного и того же больного (кровь и моча, СМЖ и кровь, синовиальная жидкость и кровь и т.д.).

При исследовании в ПЦР 299 клещей из Иркутской области и Республики Бурятия зараженность клещей риккетсиями группы КПЛ составила: I. ре™и1с&№ — 38,3 %, Б. silvarum — 68,0 %, Б. пиМаШ — 92,8 %. В результате исследования было обнаружено 20 (6,7 %) микстинфицирован-ных клещей. В 8-ми (2,7 %) из них обнаружена ДНК риккетсий и антиген вируса КЭ, в 4-х (1,3%)

— риккетсии и боррелии, в 1-ом (0,33%) — все три вида возбудителей одновременно. Из 57 образцов клещей, типированных с помощью двух-раундовой ПЦР или путем секвенирования, только в 8-ми (14,0 %) случаях обнаружена ДНК Я. sibirica, все эти образцы были выделены из клещей Б. si1varum. В остальных случаях обнаружено присутствие риккетсий новых генотипов с неустановленной патогенностью для человека (Я. зр. БпБ14, Я. зр. ВпБ28, Я. зр. RpA4, Candidatus Я. tarasevichae).

Использование ПЦР также позволило нам получить доказательства существования на территории Иркутской области очагов МЭЧ и ГАЧ. Так, с помощью двухраундовой ПЦР, позволяющей гено-типировать возбудителей, было показано, что зараженность клещей I. ре^и^иЕ. тиш (предполагаемый возбудитель МЭЧ) составляет 14,3 %,

А. phagocytophi1um (возбудитель ГАЧ) — 4,1 %, одновременно оба патогена обнаружены в 1,0 % исследованных переносчиков.

Для одномоментного обнаружения в клещах возбудителей КЭ, ИКБ, КР, МЭЧ и ГАЧ нами использован комплекс диагностических методов (ПЦР, ИФА, микроскопия содержимого кишечника клеща). Было исследовано 40 клещей

I. persu1catus, доставленных на исследование пациентами, пострадавшими от укусов клещей. С помощью ИФА антиген вируса КЭ обнаружен в 11 пробах клещей (27,5 %), применение же ПЦР показало наличие РНК вируса КЭ только в 4-х образцах (10,0 %). Возможно, что часть результатов

исследования клещей в ИФА, особенно имеющих длительное время присасывания к человеку, может быть признана ложноположительными. Наличие же ложноотрицательных результатов, полученных с помощью ИФА (7,5 %), свидетельствует о более высокой чувствительности ПЦР и необходимости безотлагательного внедрения данного метода детекции вируса КЭ в практическую работу. При использовании прямой микроскопии боррелии в содержимом среднего отдела кишечника клеща обнаружены в 3-х случаях (7,7 %), а при применении ПЦР — все пробы оказались отрицательными. В данном случае не исключена возможность ложноположительных результатов, полученных с помощью световой микроскопии. Так, иногда в процессе фиксации и окрашивания препарата боррелии теряют четкость морфологической структуры, что приводит к сложностям их дифференциации с артефактами и непатогенными боррелиями и выдаче ложноположительного результата анализа. Ни одна из 40 проб не содержала ДНК эрли-хий. Из 8 суспензий, исследованных на наличие риккетсий, в 2-х пробах (25,0 %) обнаружена ДНК данных возбудителей.

Нами составлен алгоритм проведения комплексных лабораторных экспресс-исследований переносчиков в условиях существования сочетанных очагов трансмиссивных клещевых инфекций в Иркутской области (рис. 1).

ЗАКЛЮЧЕНИЕ

Таким образом, в результате анализа многолетних данных экспресс-диагностики КЭ и ИКБ, нами была доказана возможность успешного применения ИФА для индикации антигена вируса КЭ в клещах и крови лиц, не представивших клещей для исследования, и прямой микроскопии для обнаружения в переносчиках боррелий. В процессе работы выявлены некоторые недостатки, которые присущи используемым методам и намечены возможные пути их устранения. Показано, что перспективным методом экспресс-диагностики является ПЦР, которая дает возможность исследовать напитавшихся, сухих клещей и их фрагменты, позволяет ге-нотипировать возбудителей, проводить диагностику микстинфекций. Кроме того, этот метод может широко использоваться для обнаружения всего комплекса инфекций, передаваемых через укус

ИССЛЕДОВАНИЕ ПЕРЕНОСЧИКА

г 1 і У г

Прямая микроскопия, и двухраундовая ПЦР для определения инфицированности клеща патогенными видами боррелий ИФА, ОТ-ПЦР для определения инфицированности клеща вирусом клещевого энцефалита Двухраундовая ПЦР для обнаружения патогенных видов риккетсий (R. sibirica, R. slovaca) Двухраундовая ПЦР для обнаружения эрлихий и анаплазм

Рис. 1. Алгоритм проведения комплексных лабораторных экспресс-исследований клещей в условиях существования сочетанных очагов трансмиссивных клещевых инфекций.

клещей (вирус КЭ, боррелии, риккетсии, эрлихии, анаплазмы).

ЛИТЕРАТУРА

1. Алексеев А.Н. Возможные варианты заболеваний клещевыми инфекциями и прогностическая роль анамнеза в их диагностике (паразитологические аспекты проблемы) / А.Н. Алексеев, Н.В. Рудаков, Е.В. Дубинина // Мед. паразитология. - 2004. - № 4. - С. 31-35.

2. Алексеев А.Н. Смешанные инфекции в клещах-переносчиках рода Ixodes (Acariña: Ixodidae)

- правило, а не исключение / А.Н. Алексеев, И.В. Дубинина, А.В. Семенов // Клинические перспективы в инфектологии: Материалы «Круглого стола» в рамках Всерос. науч. конф. - СПб., 2001.

- С. 9-16.

3. Боррелии как вероятные антагонисты вируса клещевого энцефалита: паразитологический и клинический аспекты проблемы / А.Н. Алексеев, Е.В. Дубинина, М.А. Вашукова, Л.И. Волкова // Мед. паразитология и паразитарные болезни. -2001. - №3. - С. 3-11.

Диагностика клещевых микстинфекций в Приморском крае / Г.Н. Леонова, С.С. Якушева, В.А. Иванис и др. // Эпидемиология и инфекц. болезни. - 2005. - № 4. - С. 25-31.

5. Индикация вируса клещевого энцефалита иммуноферментным методом / О.В. Наволокин, Н.А. Лаврова, Л.Н. Тарасевич, Л.С. Субботина // Тезисы докладов XI Всесоюзной конференции по природной очаговости болезней, 18-20 сентября 1984 г. - Тюмень, 1984. - С. 114-115.

6. Инфекционные болезни: диагностика, лечение, профилактика / Ю.В. Лобзин, А.Н. Усков, Л.П. Антыковаи др. - СПб., 2000. - С. 145-146.

7. Клинические проявления клещевого энцефалита при его сочетании с Лайм-боррелиозом в остром периоде / М.Л. Амосов, О.М. Лесняк, М.В. Надеждина, Т.Г. Бардина // Актуальные проблемы природно-очаговых инфекций: Сб. материалов II республ. науч.-практ. конф. - Ижевск, 1998.

- С. 214-215.

8. Коренберг Э.И. Изучение и профилактика микст инфекций, передающихся иксодовыми клещами / Э.И. Коренберг // Вестник РАМН. - 2001.

- № 11. - С. 41-45.

9. Леонова Г.Н. Антигенемия у людей, инфицированных вирусом клещевого энцефалита / Г.Н. Леонова, О.С. Майстровская, В.Б. Борисевич // Вопр. вирусол. — 1996. — №6. — С. 260 — 263.

10. Наумов Р.Л. Микстинфекции у клещей: правило или исключение / Р.Л. Наумов, И.С. Васильева // Мед. паразитол. и паразитар. болезни.

- 2002. - №4. - С. 27-33.

11. Опыт применения иммуноферментного метода для индикации вируса клещевого энцефалита в различных очагах / Н.Г. Бочкова, В.Н. Башкирцева, Л.С. Левин др. // Вопросы вирусологии.

- 1990. - №2. - С. 165-167.

12. Разнообразие паразитарных систем с участием мелких млекопитающих и Ixodes persulcatus Shculze на Северном Урале / Н.Н. Ливанова, В.А. Рар, С.Г. Ливанов, Я.П. Иголкина // Сиб. экол. журн. - 2005. - Т. 10, №5. - С. 1079-1084.

13. Семенов В.А. К вопросу об этиологии клещевого энцефалита с двухволновым течением /

В.А. Семенов, А.В. Субботин // Эпидемиол. обстановка и стратегия борьбы с клещевым энцефалитом на современном этапе Материалы расширенного пленума проблемной комиссии «Клещевой и другие вирусные энцеф литы» РАМН, 9-10 декабря 2003 г. - М., 2003. - С. 20-21.

14. Стронин О.В. Комплексное применение иммунодиагностических методов при клещевом энцефалите: Автореф. дис. ...канд. мед. наук. -Томск, 1998. - 28 с.

15. Эффективность иммуноферментного анализа в диагностике клещевого энцефалита / Л.Е. Подоплекина, Л.М. Лаптакова, А.В. Морякин и др. // Современные проблемы эпидемиологии, диагностики и профилактики клещевого энцефалита: Тезисы докладов Всесоюзного симпозиума, 18-21 сентября 1990 г. - Иркутск, 1990. - С. 106-107.

16. Эффективность твердофазной иммуно-ферментной системы для диагностики клещевого энцефалита / А.С. Караванов, Г.П. Пиванова, Г.Г. Баннова и др. // Вопросы вирусологии. - 1990.

- №5. - С. 429-431.

17. Guillemette J.G. Detection of subnanogram quantities of DNA and RNA on native and denaturing polyacrylamide and agarose gels by silver staining / J.G. Guillemette, P.N. Lewis. - Electrophoresis. -1983. - № 4. - P. 92-94.

i Надоели баннеры? Вы всегда можете отключить рекламу.