Научная статья на тему 'Скрининг мутаций генаонкосупрессора р53 методом темпоральнотемпературного градиентного гельэлекрофореза (TTGE)'

Скрининг мутаций генаонкосупрессора р53 методом темпоральнотемпературного градиентного гельэлекрофореза (TTGE) Текст научной статьи по специальности «Биотехнологии в медицине»

CC BY
518
62
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
детекция мутаций / mutation detection

Аннотация научной статьи по биотехнологиям в медицине, автор научной работы — Величко А. К., Недорубов А. А., Генгин М. Т., Безлепкин В. Г.

Представлена методика детекции мутаций в генеонкосупрессоре р53 с помощью метода темпоральнотемпературного градиентного гельэлектрофореза (TTGE). TTGE метод скрининга мутаций, позволяющий разделить фрагменты ДНК, отличающиеся только одной парой оснований, в соответствии с их температурами плавления в денатурирующих условиях. Метод основан на постоянной концентрации денатуранта и температурном градиенте на протяжении всего процесса электрофоретического разделения. Это обеспечивает преимущество TTGE перед другими методами, делая его более точным и надёжным.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по биотехнологиям в медицине , автор научной работы — Величко А. К., Недорубов А. А., Генгин М. Т., Безлепкин В. Г.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

A protocol for detection of mutation in the p53 gene using temporal temperature gradient gel electrophoresis (TTGE) is described. TTGE is a mutation detection technique that separates DNA fragments differing by single base pairs according to their melting properties in a denaturing gel. It is based on constant denaturing conditions in the gel combined with a temperature gradient during the electrophoretic run. The results is a rapid and sensitive screening that is easily set up in smaller laboratory environments.

Текст научной работы на тему «Скрининг мутаций генаонкосупрессора р53 методом темпоральнотемпературного градиентного гельэлекрофореза (TTGE)»

ИЗВЕСТИЯ

ПЕНЗЕНСКОГО ГОСУДАРСТВЕННОГО ПЕДАГОГИЧЕСКОГО УНИВЕРСИТЕТА имени В. Г. БЕЛИНСКОГО ЕСТЕСТВЕННЫЕ НАУКИ № 14 (18)2009

IZ VESTIA

PENZENSKOGO GOSUDARSTVENNOGO PEDAGOGICHESKOGO UNIVERSITETA imeni V. G. BELINSKOGO NATURAL SCIENCES № 14 (18)2009

УДК 577.3

скрининг МУТАЦИЙ ГЕНА-ОНКОСУПРЕССОРА Р53 МЕТОДОМ ТЕМПОРАЛЬНО-ТЕМПЕРАТУРНОГО ГРАДИЕНТНОГО ГЕЛЬ-ЭЛЕКРОФОРЕЗА (TTGE)

© А. К. ВЕЛИЧКО*, А. А. НЕДОРУБОВ*, М. Т. ГЕНГИН*, В. Г. БЕЗЛЕПКИН** *Пензенский государственный педагогический университет им. В.Г.Белинского,

кафедра биохимии **Институт теоретической и экспериментальной биофизики РАН е-mail: VelichkoAK@gmail.com

Величко А.К., Недорубов А.А., Генгин М.Т., Безлепкин В.Г. - Скрининг мутаций гена-онкосупрессора методом темпорально-температурного градиентного гель-электрофореза // Известия ПГПУ им. В.Г. Белинского.

2009. № 14 (18). С. 49-52. - Представлена методика детекции мутаций в гене-онкосупрессорер53 с помощью метода темпорально-температурного градиентного гель-электрофореза (TTGE). TTGE - метод скрининга мутаций, позволяющий разделить фрагменты ДНК, отличающиеся только одной парой оснований, в соответствии с их температурами плавления в денатурирующих условиях. Метод основан на постоянной концентрации денатуранта и температурном градиенте на протяжении всего процесса электрофоретического разделения. Это обеспечивает преимущество TTGE перед другими методами, делая его более точным и надёжным. Ключевые слова: детекция мутаций

Velichko A.K., Nedorubov A.A., Gengin M.T., Bezlepkin B.G. - Mutation screening of the p53 gene-oncosup-pressor by temporal temperature gradient gel electrophoresis (TTGE) method// Inz. Penz. gos. pedagog. univ. im.i V.G. Belinskogo. 2009. № 14 (18). С. 49-52. - A protocol for detection of mutation in the p53 gene using temporal temperature gradient gel electrophoresis (TTGE) is described. TTGE is a mutation detection technique that separates DNA fragments differing by single base pairs according to their melting properties in a denaturing gel. It is based on constant denaturing conditions in the gel combined with a temperature gradient during the electrophoretic run. The results is a rapid and sensitive screening that is easily set up in smaller laboratory environments. Keywords: mutation detection

Недавние исследования показали, что мутации в гене-онкосупрессоре р53 могут быть общим генетическим маркером для большинства онкологических заболеваний человека [13, 18] и вовлечены во многие формы неопластической трансформации клеток [13, 24, 8]. Мутации гена р53 могут происходить на всём его протяжении [17]. Однако существуют так называемые «горячие точки», в которых уровень изменчивости повышен [21, 23].

Для р53 установлено множество полиморфизмов, при этом полиморфизмы 3, 6 интронов и 4 экзо-на считаются вовлеченными в канцерогенез [30, 2, 32]. наиболее широко изучен полиморфизм в кодирующем участке гена р53 (4 экзон, А^72Рго полиморфизм). Есть сведения о его ассоциации со злокачественными новообразованиями различных локализаций [25, 3].

В большинстве случаев неоплазии дисфункция р53 связана с мутациями в ДНК-связывающем домене гена [27].

данные о полном спектре возможных мутаций р53 могут дать понимание различных эндо и экзогенных процессов вызывающие эти дефекты [19]. Эта информация необходима для оценки степени агрессивности опухоли или терапевтического ответа [1, 6, 10, 28, 29].

В дополнение к последующему сиквенсу, используются различные методы детекции мутаций в р53: SSCP (метод анализа конформационного полиморфизма однонитевой ДНК) [15, 20], DDGE (метод денатурирующего градиентного гель-электрофореза) [9], CDGE (метод постоянно денатурирующего гель-электрофореза) [5, 14], CDCE (метод постоянно денатурирующего капиллярного гель-электрофореза) [4, 16], а также ТTGE (метод темпорально-температурного градиентного гель-элекрофореза).

Метод TTGE основан на различии характеристик плавления нормальных и мутантных копий фрагментов ДНК в форме их гомо- и гетеродуплексов, и соответственно на изменении их электрофоретической подвиж-

ности в геле при повышении температуры в определённом диапазоне. Он сочетает в себе максимальное разделение ПЦР-продукта, которое достигается расчётом константы денатурации, используемым в CDCE, в сочетании с временным температурным градиентом [11, 22]. В ходе электрофореза за счёт создания денатурирующих условий фрагменты ДНК плавятся в соответствии со специфичной нуклеотидной последовательностью, что проявляется в снижении их подвижности. В TTGE разделение фрагментов, различающихся, по меньшей мере, 1 парой оснований, улучшается за счёт добавления к одному типу денатуранта дополнительных денатурирующих условий, а именно температурного градиента. В течение электрофореза температура равномерно

ПЦР осуществляли в амплификаторе MiniCycler PTC-150 (MJ Research, Inc., Великобритания) и «Тер-цик» (НПФ «ДНК-Технология», Россия) (Techne, Duxford, Cambridge, UK). 40 циклов ПЦР включали расплавление при 940С в течение 30 секунд, отжиг для 4 экзона - 60°С, 5экзона - 64°С, 8 экзона - 60°С течение 30 секунд и элонгацию при 720С в течение 60 секунд.

Амплифицированные фрагменты гена р53 подвергали процедуре денатурации-отжига, для образования (в случае мутации) гетеродуплексов. Программа денатурация-отжига заключалась в снижение температуры от 95°С до 50°С с шагом 1°/мин. Образец ДНК (10 pl) наносится с загрузочным буфером -2х Gel Loading Dye, содержащим 2% бромфенол синий, 2% ксиленцианол, 1% глицерин.

TTGE для амплифицированных фрагментов гена р53 проводили в соответствии с следующими условиями:

Для 4 экзона - 8% акриламидный гель, 7М мочевина, диапазон температуры 62-68°С, шаг изменения 0,5°/час, напряжение 100В. 5 экзон - 12% акри-ламидный гель, 7М мочевина, диапазон температуры 62-70°С, шаг изменения 1,5°/час, напряжение - 110В. 8 экзон - 9% акриламидный гель, 7М мочевина, диапазон температуры 57-66°С, шаг изменения 1°/час, напряжение - 110В. После завершения электрофореза гель окрашивали в течение 15 мин в растворе бромистого этидия (100 мкл 1%Stock на 200 мл 1,75х ТАЕ буфера). Гели визуализировались на УФ-трансиллю-минаторе и фиксировались с помощью гельдокумен-тирующей системы Doc Print (Vilber Lourmat Systems Inc., Франция).

увеличивается, представляя собой линейную функцию зависимости от времени [7, 31, 26].

Целью нашей работы было разработать методику скрининга мутаций в гене-онкосупрессоре р53 используя TTGE.

материал и методика

ПЦР-смесь имела следующий состав: 1x ПЦР-буфер: 10 мМ Трис-HCl (pH 9.0), 50мМ KCl, 1 мл/л Triton X-100 или 15мМ Трис-HCl (pH 8.8), 67мМ (NH4)2S04, 0,01% Tween-20; MgCl2 - варьируется, 0,2 мМ каждого из dATP, dGTP, dTTP и dCTP, 10 пмоль каждого праймера, 1 U Taq-ДНК-полимера-зы и 20 нг геномной ДНК.

результаты и обсуждение

Для скрининга генетической изменчивости по конкретным локусам необходима их амплификация с помощью ПЦР. Ампликоны, подвергающиеся дальнейшему анализу не должны содержать неспецифических продуктов, для чего необходим начальный подбор оптимальных условий проведения реакции.

Одной из целей работы была оптимизация проведения ПЦР четвёртого, пятого и восьмого экзонов гена р53 с использованием сухого набора реагентов GenePak®PCR Core (kits) и систем амплификации основанных на фирменных препаратах (Fermentas) включающих TAQ-полимеразу (5 U/мкл), MgCl2 (25mM), KCl и (NH4)2S04 буферы. В качестве ДНК матрицы были использованы препараты ДНК, выделенные из периферической крови здоровых доноров методом Gupta R.S [12].

Методика оптимизации проведения PCR включает в себя несколько этапов:

1. определение температуры отжига праймеров

2. Проведение PCR используя условия рекомендованные производителем набора

3. Подбор оптимальной температуры отжига

4. Подбор оптимальной концентрации MgCl2

На рис. 1 приводится электрофореграмма продуктов ПЦР для 4, 5 и 8 экзонов гена р53 при оптимальных условиях, т.е. при получении гомогенного ПЦР-продукта. Для 4 экзона это 60°С температура отжига праймеров, 1,5 мМ Mg2+, Taq-KCl буфер. Для 5 экзона это 64°С температура отжига праймеров (прямой праймер с GC-клэмпом), 1,0 мМ Mg2+, Taq-NH4 буфер. Для 8 экзона это 60°С температура отжига праймеров, 2,0 мМ Mg2+, Taq-KCl буфер.

последовательности праймеров для PCR

Таблица 1.

район прямой праймер обратный праймер размер ампликона

P53(4) 5'TGCTCTTTTCACCCATCTAC3' 5'ATACGGCCAGGCATTGAAGT3' 353

P53(5) 5'GC . - TTCCACACCCCCGCCCG3' clamp 5'GCCCTGTCGTCTCTCCA3' 181

P53(8) 5'TTCCTTACTGCCTCTTGCTT3' 5'CGCTTCTTGTCCTGCTTGCT3' 201

Последовательность GC , - 5'CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCG3'

^ clamp

БИОХИМИЯ ►►►►►

довательности. С помощью полученного графика можно определить температуры начала и конца плавления, а также установить скорость нагрева и время проведения TTGE-анализа индивидуально для каждого исследуемого фрагмента ДНК.

Рис.1. Амплификация 4, 5 и 8 экзонов гена р53. Электрофорез в 7% РДДв геле. Гель окрашен бромистым этидием.

Область температур плавление амплифициро-ванных фрагментов гена р53 определяли с помощью программного обеспечения WinMelt (Bio-Rad Laboratories). Программа строит график зависимости температуры плавления фрагмента от нуклеотидной после-

Рис.2. ТТвЕ-анализ продуктов амплификации 4, 5 и 8 экзонов гена р53 у людей контрольной и онкологической групп. Регистрируемая мутация (+), отсутствие мутации (-).

В табл. 2 приведены условия TTGE-анализа подобранные для 4, 5 и 8 экзонов.

таблица 2.

условия проведения TTGE-анализа

район диапазон Температур, °с скорость нагрева °с/Ь мочевина, м Акриламид, %

Р53(4) 62-68 0,5 7 8

Р53(5) 62-70 1,5 7 12

Р53(8) 57-66 1 7 9

Для проверки работоспособности метода PCR-TTGE по выявлению мутаций в гене р53, подобный анализ был проведён на нескольких донорах. Образцы крови были взяты у пациентов с раком молочной железы в период до и после радио и химиотерапии, а также у здоровых доноров.

На рис. 2 представлена TTGE-электрофореграм-ма продуктов амплификации 4, 5 и 8 экзонов гена р53. Видно, что методом PCR-TTGE можно детектировать мутации в исследуемых локусах геномной ДНК, которые в подавляющем большинстве присутствуют в образцах онкологических больных, как до, так и после химио- и радиотерапии. В группе здоровых доноров мутации также выявляются, но с меньшей частотой.

Таким образом, подобранные условия ПЦР-TTGE позволяют осуществлять этим методом эффективный скрининг мутаций ядерной ДНК и конкретно генов, дефекты которых приводят к злокачественному перерождению клеток.

список литературы

1. Aas T., Borresen A,-L., Geisler S. et al. Specific p53 mutations are associated with de novo resistance to doxorubicin in breast, cancer patients // Nat. Med. 1996. №2. P. 811-814.

2. Avigad S., Barel D., Blau О., Malka A., Zoldan M., Mor C., Fogel M., Cohen I.J., Stark B., Goshen Y., SteinJ., Zaizov R. A novel germ line p53 mutation in intron 6 in diverse childhood malignancies // Oncogene. 1997. №14(13). P. 1541-1545.

3. Biros M.H., Adams J.G. AEM-state of the journal, 2001. Academic emergency medicine // Acad. Emerg. Med. 2001. V. 8. P. 904-906.

4. Bjorheim J., Gaudernack G., Ekstron P. o. Mutation analysis of TP53 exons 5-8 by automated constant denaturant capillary electrophoresis // Tumour Biol. 2001. № 22. P. 323-327.

5. Borresen A.-L., Hovig E., Smith-Sorensen B. et al. Constant denaturant gel electrophoresis as a rapid screening

technique for p53 mutations // Proc. Natl. Acad. Sci. USA. 1991. № 88. P. 8405-8409.

6. Borresen-Dale A.-L., Lothe R. A., Meling, G. L., Hainaut, P., Rognum, T. O., Skovlund et al. TP53 and long-term prognosis in colorectal cancer: mutations in the L3 zinc-binding domain predict poor survival // Clin. Cancer Res. 1998. №4. P. 203-210.

7. Borresen-Dale A.-L., Lystad S., Langeroed A. Temporal temperature gradient electrophoresis on the DCode system // Biorad Bull. 1997. P. 2133.

8. Brash D.E., Rudolph A.R., Simon J.A., Lin A. et al. A role for sunlight in skin cancer: UV-induced p53 mutations in squamous cell carcinoma //Proc. Natl. Acad. Sci. 1991. №88. P. 10124-10128.

9. Fischer S. G., Lerman L. S. DNA fragments differing by single base-pair substitutions are separated in denaturing gradient gels: correspondence with melting theory // Proc. Natl. Acad. Sci. USA. 1983. № 80. P. 1579-1583.

10. Geisler S., Lining P. E., Aas T. et al. Influence of TP53 gene alterations and c-erbB2 expression on the response to treatment with doxorubicin in locally advanced breast cancer // Cancer Res. 2001. № 61. P. 2505-2512.

11. Gelfi C., Cremonesi L., Ferrari M., Righetti P. G. Temperature-programmed capillary electrophoresis for detection of DNA point mutations // BioTechniques. 1996. № 21. P. 926-932.

12. Gupta R.S. Griseofulvin resistance mutation of Chinese hamster ovary cells that affects the apparent molecular weight of a congruent to 200,000-dalton protein // Mol Cell Biol. 1984. № 4(9). P. 1761-1768.

13. Hollstein M., Sidransky D., Vogelstein B., Harris C.C.. p53 mutations in human cancers // Science. 1991. № 253. P. 49-53.

14. Hovig E., Smith-Sorensen B., Brogger A., Borresen, A.-L. Constant denaturant gel electrophoresis, a modification of denaturing gradient gel electrophoresis in mutation detection // Mutat. Res. 1991. № 262. P. 63-71.

15. Karim S., Ali A. // WorldJ Gastroenterol. 2009. № 15(11). P. 1381-1387

16. Khrapko K., Hanekamp J. S., Thilly, W, G., Belenkii A., Foret F., Karger B. L. Constant denaturant capillary electrophoresis (CDCE): a high resolution approach to mutational analysis // Nucleic Acids Res. 1994. № 22. P. 364-369.

17. Krypuy M., Ashour A.A., Etemadmoghadam D. // BMC Cancer. 2007. № 7. P.168

18. Levine A.J., Momand J., Finlay C.A.. The p53 tumour suppressor gene // Nature. 1991. №351. P. 453-456.

19. Martin A., Facchiano A.M., Cuff A.L. et al. Integrating mutation data and structural analysis of the TP53 tumor-suppressor protein // Hum. Mutat. 2002. P. 149-164.

20. Orita M., Suzuki Y., Sekiya T., Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction // Genomics. 1989. № 5. P. 874-879.

21. Petitjean A., Mathe E., Kato S., Ishioka C., Tavtigian S.V., Hainaut P., Olivier M. Impact of mutant p53 functional properties on TP53 mutation patterns and tumor pheno-type: lessons from recent developments in the IARC TP53 database //Hum Mutat. 2007. № 28(6). P. 622-629.

22. Riesner D., Steger G., Zimmat E. et al. Temperature-gradient gel electrophoresis of nucleic acids: analysis of con-formational transitions, sequence variations, and protein-nucleic acid interactions // Electrophoresis. 1989. № 10. P. 377-389.

23. Royds J.A., Iacopetta B. p53 and disease: when the guardian angel fails // Cell Death Differ. 2006. №13(6). P. 1017-1026.

24. Sidransky D., Eschenbach A.V., Tai Y.C. et al. Identification of p53 mutations in bladder cancer and urine samples // Science. 1991. № 252. P. 706-709.

25. Själander A., Birgander R., Hallmans G. et al. p53 polymorphisms and haplotypes in breast cancer // Carcino-genesis. 1996. Vol. 17. P. 1313-1316.

26. Sorlie T., Johnsen H., Vu P. et al. Mutation screening of the TP53 gene be temporal temperature gradient gel electrophoresis // Methods Mol. Biol. 2005. V. 291. P. 207-216

27. Vogelstein B., Lane D., Levine A.J. Surfing the p53 network // Nature. 2000. № 408(6810). P. 307-310.

28. Wallace-Brodeur R. R., Lowe S. W. Clinical implications of p53 mutations // Cell. Mai Life Sci. 1999. № 55. P. 64-75.

29. Wattel E., Preudhomme C., Hecquet B. et al. p53 mutations are associated with resistance to chemotherapy and short survival in hematologic malignancies // Blood. 1994. № 84. P. 3148-3157.

30. Wu M.H., Yung B.Y. UV stimulation of nucleophos-min/B23 expression is an immediate-early gene response induced by damaged DNA // J. Biol. Chem. 2002. № 277(50). P. 48234-48240.

31. Zoller P., Redila-Flores T., Chu D., Patel A. Temporal temperature gradient electrophoresis-a powerful mutation screening technique // Biomed. Prod. 1998. №9.

32. Гервас П. A. // Автореф. дисс. ... к.м.н. Томск, 2007.

i Надоели баннеры? Вы всегда можете отключить рекламу.