Научная статья на тему 'Прогностическая значимость аллелей pla1/a2 гена гликопротеида GPIIIa при гиперпластических процессах эндометрия'

Прогностическая значимость аллелей pla1/a2 гена гликопротеида GPIIIa при гиперпластических процессах эндометрия Текст научной статьи по специальности «Фундаментальная медицина»

CC BY
401
68
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
интегрин / гликопротеид GPIIIa / аллель / гиперплазия эндометрия / полип эндометрия / integrins / glycoprotein / gene GPIIIa / allele / endometrial hyperplasia / endometrial polyps

Аннотация научной статьи по фундаментальной медицине, автор научной работы — П.Е. Серегина, Г.Ф. Тотчиев, Е.А. Панова

Определен PLA генотип гена GPIIIa у 86 пациенток перии постменопаузального возраста с гиперпластическими процессами эндометрия: 48 пациенток с полипами эндометрия и 38 с гиперплазией эндометрия без атипии. Статистически значимое увеличение частоты встречаемости генотипа PLA1A2 по сравнению с популяцией было обнаружено в группе пациенток с гиперплазией эндометрия без атипии (р<0,001), у пациенток с рецидивом гиперплазии эндометрия без атипии (р<0,001), пациенток с рецидивирующими полипами эндометрия (р<0,05), пациенток с железисто-фиброзными полипами эндометрия (р<0,05) и у пациенток с полипами эндометрия, потребовавшими резектоскопического вмешательства (р<0,001).

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по фундаментальной медицине , автор научной работы — П.Е. Серегина, Г.Ф. Тотчиев, Е.А. Панова

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

PROGNOSTIC SIGNIFICANCE OF PLA POLYMORPHYSM OF GLICOPROTEIN IIIA GENE (GPIIIA) IN ENDOMETRIAL HYPERPLASIA

The PLA genotype of GPIIIa gene was determined in 86 patients with endometrial hyperplasia in periand postmenopausal age. 48 patients presented with polypoid features and 38 – with hyperplasia of endometrium. Comparing to population significant increase in incidence of PLA1A2 genotype was observed in patients with hyperplasia of endometrium without atypia (р < 0.001), in patients with recurrent endometrial hyperplasia without atypia (р<0.001), in patients with recurrent endometrial polyps (р <0.05), in patients with glandular-fibrotic endometrial polyps (р <0.05) and also in patients with endometrial polyps requiring hysteroscopic resection.

Текст научной работы на тему «Прогностическая значимость аллелей pla1/a2 гена гликопротеида GPIIIa при гиперпластических процессах эндометрия»

ПРОГНОСТИЧЕСКАЯ ЗНАЧИМОСТЬ АЛЛЕЛЕЙ PLA1/A2 ГЕНА ГЛИКОПРОТЕИДА GPШA ПРИ ГИПЕРПЛАСТИЧЕСКИХ ПРОЦЕССАХ ЭНДОМЕТРИЯ

П.Е. Серегина, Г.Ф. Тотчиев, Е.А. Панова

Кафедра акушерства и гинекологии с курсом перинатологии Российский университет дружбы народов Ул. Миклухо-Маклая, 8, Медицинский факультет, 117198, Москва, Россия

Определен РЬА генотип гена GPШa у 86 пациенток пери- и постменопаузального возраста с гиперпластическими процессами эндометрия: 48 пациенток с полипами эндометрия и 38 - с гиперплазией эндометрия без атипии. Статистически значимое увеличение частоты встречаемости генотипа РЬА1А2 по сравнению с популяцией было обнаружено в группе пациенток с гиперплазией эндометрия без атипии (р<0,001), у пациенток с рецидивом гиперплазии эндометрия без атипии (р<0,001), пациенток с рецидивирующими полипами эндометрия (р<0,05), пациенток с железисто-фиброзными полипами эндометрия (р<0,05) и у пациенток с полипами эндометрия, потребовавшими резектоскопического вмешательства (р<0,001).

Ключевые слова: интегрин, гликопротеид GPШa, аллель, гиперплазия эндометрия, полип эндометрия.

Гиперпластические процессы эндометрия (ГПЭ) - часто встречаемая гинекологическая патология, основными клиническими проявлениями которой являются аномальные маточные кровотечения. Частота встречаемости ГПЭ возрастает в период пери- и постменопаузы [9,10]. ГПЭ встречаются у 15-40% гинекологических больных разных возрастных групп [4]. Проблема ГПЭ заслуживает пристального внимания в связи с возможностью их злокачественной трансформации [2, 7].

Рак тела матки у женщин занимает 4-е место в структуре онкологической заболеваемости [5]. По данным различных авторов рак эндометрия выявляют у 15-80% пациенток в постменопаузе с кровянистыми выделениями из половых путей [11].

Гиперпластические процессы эндометрия характеризуются высокой частотой рецидивирования. Особого внимания заслуживают часто рецидивирующие ГПЭ, которые переходят в инвазивный рак матки в 20-30% наблюдений [2]. ГЭ рецидивирует в 39,3% случаев, несмотря на применение гормональной терапии и в 9,5% случаев после аблации эндометрия [3]. По данным Пестриковой Т.Ю. ГПЭ рецидивируют у 71,78% пациенток, не получавших лечения [10].

По отношению к полипам эндометрия термин «рецидивирующий» может быть использован только в том случае, если удаление первичного полипа производилось под контролем гистероскопии [9]. Полипы эндометрия рецидивируют в 25-78% случаев [8]. При проведении кюретажа почти во всех случаях удаляются железистые полипы эндометрия. Полипы, имеющие фиброзный или мышечный компоненты, полностью удаляются при кюретаже только в 12% случаев, с применением гистероскопической эндохирургии в 32%,

в остальных 56% случаях в матке остается большая или меньшая часть полипа или его основания, что в дальнейшем требует резектоскопического удаления [12].

До настоящего времени основными механизмами возникновения гиперпластических процессов эндометрия считались гормональные нарушения, нарушения гормональной рецепции и хронические воспалительные процессы органов малого таза. В последнее десятилетие перспективным направлением в современной медицине является изучение роли молекулярно-клеточных нарушений в патогенезе различных заболеваний, в том числе и в патогенезе гиперпластических процессов эндометрия. Несомненна роль интегринов -молекул клеточной адгезии в формировании гиперпластических процессов эндометрия [1,6].

Интегрины являются трансмембранными гликопротеинами клеточной поверхности, осуществляющими рецепторную функцию. Интегрины выполняют также функцию проведения внутриклеточных сигналов, которые опосредуют влияние матрикса на экспрессию генов, движение, пролиферацию, дифференцировку, апоптоз и другие функции клетки. Ген ОРШа кодирует Ь3 субъединицу интегринового рецептора и локализован в длинном плече 17 хромосомы, имеет 14 экзонов, разделенных интронами, всего около 40 тыс. пар нуклеотидов. В гене ОРШа идентифицировано около 10 генных точечных мутаций, 5 различного рода перестроек и целый ряд делеций. В целом, ген ОРШа представлен двумя аллельными формами, РЬ-А1 и РЬ-А2. Аллель РЬ-А2 представляет результат транзиции тиминового нуклеотида на цитозиновый в позиции 196 третьего экзона гена ОРШа. Присутствие в генотипе указанного аллеля приводит к замене лейцина на пролин в позиции 33 Р3 субъединицы интегрина. Частота встречаемости аллеля РЬ-А2 составляет 22%.

Целью настоящего исследования является изучение роли интегринов, в частности аллельного распределения гена ОРШа в развитии гиперпластических процессов эндометрия и их рецидивирующих форм. В нашей работе мы применили новый патентованный (патент от 20 июля 2006 года, регистрационный номер 2280079) упрощенный способ выделения и исследования гена интегрина ОРШа.

Материалы и методы исследрвания. Нами было проспективно обследовано 86 пациенток пери- и постменопаузального возраста с гиперпластическими процессами эндометрия: 48 пациенток с полипами эндометрия и 38 с гиперплазией эндометрия без атипии. Средний возраст обследованных пациенток составил 53,6±8,7лет. Диагноз был установлен на основании гистологического исследования соскобов эндометрия. Всем пациенткам выполнялись УЗИ органов малого таза и гистероскопия. В группе пациенток с ПЭ (п=48) у 26 (54,2%) пациенток ПЭ были впервые выявленными, а у 22 (45,8%) пациенток ПЭ были рецидивом. В группе пациенток с ГЭ (п=38) у 18 пациенток (47,3%) ГЭ была диагностирована впервые, а у 20(52,6%) ГЭ была рецидивирующей. Среди пациенток с полипами эндометрия у 30 (60%) пациенток полипы были железисто-фиброзными, у 18 (40%) были выявлены железистые полипы. У 29 (60,4%) пациенток полипы были удалены полностью,

19 (39,6%) пациенткам потребовалась повторная госпитализация для резекции оставшейся части полипа.

Методика обследования. В предлагаемом способе выделения и исследования гена GPIIIa в качестве ДНК-матрицы используется сухая капля крови на бумажном носителе, в качестве носителя используется бумага Ватман 3ММ (Ватман, Англия).

Предложены оригинальные олигонуклеотидные праймеры для полимеразной цепной реакции, 5'gctccaatgtacggggtaaa и 5'ctcctcagacctccaccttg, которые позволяют синтезировать специфический ДНК-продукт длиной 384 нуклеотидных пар. Этот продукт при расщеплении рестриктазой MspI образует фрагменты ДНК длиной 290 и 80 нуклеотидных пар в случае аллеля PL-A1 и фрагменты длиной 170, 120 и 80 нуклеотидных пар в случае аллеля PL-A2.

Статистический анализ пациенток с ГПЭ проводился по сравнению с популяционными частотами. Частота аллеля PLA1 (33 Leu) в популяции вставляет примерно 85% и PLA2 (33Pro) 15%; частоты генотипов: 76% для PLA1A1, 22% - для PLA1A1 и 2% - для гомозигот по аллели PLA2 - PLA2A2 [13].

Для сравнения наблюдаемых и ожидаемых частот мы использовали критерий ч1.

Результаты. Среди пациенток с гиперплазией эндометрия (n=38) выявлено 9 носителей аллелей PLA1A2 (50%) и 19 носителей аллелей PLA1A1 (50%). Носителей генотипа PLA2A2 в группе пациенток с гиперплазией эндометрия без атипии не было выявлено. Частота PLA1A1 генотипа в данной группе была одинакова с частотой PLA1A2 генотипа (p=1.0). Генотип PLA1A2 в группе пациенток с ГЭ встречался статистически значимо чаще, а генотип PLA1A1 реже, чем в популяции (р<0,001).

80 70 60 50 40 30 20 10 0

□ первичная ГЭ □ рецидив ГЭ □ популяция

Рис. 1. Частота встречаемости генотипов гена GPШa при первичной гиперплазии эндометрия без атипии, рецидивирующей гиперплазии эндометрия без атипии и в популяции.

76

66,7

35 33,3

22

PlA1A1 PlA1A2

У 12 пациенток (66.7%) с впервые выявленной ГЭ (п=18) был определен генотип РЬА1А1; генотип РЬА1А2 - у 6 пациенток (33,3%). Внутри группы частота встречаемости генотипов РЬА1А1 и РЬА1А2 статистически не отличалась от частоты в популяции (р=0,26). Частота генотипа РЬА1А1 была достоверно выше частоты генотипа РЬА1А2 (р<0,05).

Среди пациенток с рецидивом ГЭ (п=20) у 7 пациенток (35%) был выявлен генотип РЬА1А1, у 13 (65%) - генотип РЬА1А2. Внутри группы частоты встречаемости генотипов РЬА1А1 и РЬА1А2 статистически не отличались друг от друга (р=0.23). Частота встречаемости генотипа РЬА1А2 у пациенток с рецидивом ГЭ была статистически значимо выше, чем в популяции (р<0,001), а генотипа Р1А1А1 реже, чем в популяции.

В группе пациенток с полипами эндометрия (п=48) выявлено 14 носителей генотипа РЬА1А2 (29,2%), 32 носителя генотипа РЬА1А1 (66,6%) и 2 носителя генотипа РЬА2А2 (4,2%). Частота РЬА1А1 генотипа в данной группе была достоверно выше частоты РЬА1А2 (р=0,01). При этом распределение генотипов ОРШа статистически не отличалось от популяционного (р=0,32).

80 70 60 50 40 30 20 10 0

Рис. 2. Частота встречаемости генотипов гена GPШa при впервые выявленных полипах эндометрия по сравнению с рецидивирующими полипами эндометрия и популяцией.

У 19 пациенток с впервые выявленными ПЭ (п=26), что составило 73,1% был выявлен генотип РЬА1А1, генотип РЬА1А2 - у 5 пациенток (19,2%) и генотип РЬА2А2 - у 2 больных (7,7%). Внутри группы частота встречаемости генотипов РЬА1А1 и РЬА1А2 статистически не отличалась от частоты в

73,1 76

59,1

40,9

19,2 22 7,7

0 2

Р1А1А1 Р1А1А2 Р1А2А2

первичные ПЭ П рецидив ПЭ П популяция

популяции (р=0,91). Частота генотипа РЬА1А1 была достоверно выше частоты генотипа РЬА1А2 (р<0,05).

Среди пациенток с рецидивом ПЭ (п=22) у 13 пациенток (59,1%) был выявлен генотип РЬА1А1, у 9 (40,9%) - генотип РЬА1А2. Генотипа РЬА2А2 у пациенток с рецидивом ПЭ обнаружено не было. Внутри группы частоты встречаемости генотипов РЬА1А1 и РЬА1А2 статистически не отличались друг от друга (р=0,46). Частота встречаемости генотипа РЬА1А2 у пациенток с рецидивом ПЭ была статистически значимо выше, чем в популяции (р<0,05), а генотипа РЬА1А1 реже, чем в популяции.

80 70 60 50 40 30 20 10 0

□ железисто-фиброзные □ железистые □ популяция

Рис. 3. Частота встречаемости генотипов гена GPШa при полипах эндометрия в зависимости от их гистологической характеристики и в популяции.

У 14 пациенток (77,8%) с железистыми ПЭ (п=18) был выявлен генотип РЬА1А1; генотип РЬА1А2 - у 4 пациенток (22,2 %). Генотип РЬА2А2 у пациенток с железистыми ПЭ не был выявлен. Внутри группы частота встречаемости генотипов РЬА1А1 и РЬА1А2 статистически не отличалась от частоты в популяции (р=0,91). Частота генотипа РЬА1А1 была достоверно выше частоты генотипа РЬА1А2 (р<0,05).

Среди пациенток с железисто-фиброзными ПЭ (п=30) у 17 пациенток (56,7%) был выявлен генотип РЬА1А1, у 11 (36,7%) - генотип РЬА1А2, у 2 пациенток 6.6% - генотип РЬА2А2. Внутри группы частоты встречаемости генотипов РЬА1А1 и РЬА1А2 статистически не отличались друг от друга (р=0,34). Частота встречаемости генотипа РЬА1А2 у пациенток с железисто-фиброзными полипами ПЭ была статистически значимо выше, чем в популяции (р<0,05), а генотипа Р1А1А1 реже, чем в популяции.

76

70

56,7

36,7

29,2

22

-6Х

Р1А1А1

Р1А1А2

Р1А2А2

2

0

Среди 24 пациенток (82,8%), у которых полипы были удалены полностью (п=29), был выявлен генотип РЬА1А1; генотип РЬА1А2 - у 4 пациенток (13,8%) и генотип РЬА2А2 - у 1 больной (3,4%). Внутри группы частота встречаемости генотипов РЬА1А1 и РЬА1А2 статистически не отличалась от частоты в популяции (р=0,1). Частота генотипа РЬА1А1 была достоверно выше частоты генотипа РЬА1А2 (р<0,001).

У пациенток с ПЭ, которым в дальнейшем потребовалась резекция оставшейся части полипа (п=19), 8 пациенток (42,1%) оказались носительницами генотипа РЬА1А1, 10 пациенток (52,6%) - носительницами генотипа РЬА1А2, 1 пациентка (5.3%) была носительницей генотипа РЬА2А2. Внутри группы частоты встречаемости генотипов РЬА1А1 и РЬА1А2 статистически не отличались друг от друга (р=0.5). Частота встречаемости генотипа РЬА1А2 у пациенток с ПЭ, которым потребовалась резекция оставшейся части полипа, была статистически значимо выше, чем в популяции (р<0.001), а генотипа Р1А1А1 реже, чем в популяции.

90 80 70 60 50 40 30 20 10 0

□ ПЭ, удаленные при ГС+РДВ □ ПЭ, полностью не удаленные при ГС+РДВ □ популяция

Рис. 4. Частота встречаемости PLA генотипов гена GPШa при полипах эндометрия, в зависимости от необходимости повторного электрохирургического вмешательства.

Обсуждение. Интегрины - большая группа интегральных мембранных рецепторов, обеспечивающая межклеточные взаимодействия, сродство клетки с межклеточным матриксом, а также передающая сигналы от матрикса к внутриклеточным структурам. При рассмотрении патогенеза гиперпластических процессов эндометрия нам кажется наиболее интересной роль интегринов в регуляции апоптоза. Для многих клеточных типов была продемонстрирована четкая зависимость между апоптозом и опосредуемой интегринами связью клетки с субстратом. Такой тип апоптоза, когда условием гибели клетки является разрыв ее связи с субстратом, получил название «аноиксис» (от греческого слова «бездомность»).

82,8

_76_

42,1

-52Б"

Т38

22

3,4

-5,3-

Р1А1А1

Р1А1А2

Р1А2А2

2

Мы предположили, что одним из существенных звеньев в патогенезе ГПЭ является нарушение регуляции апоптоза, в том числе связанное с нарушением межклеточных взаимодействий. Тогда у женщин, в генотипе которых присутствует мутантный аллель гена GPIIIa - PLA2, следует ожидать изменения характера межклеточных взаимодействий, выражающегося в избыточном сродстве клеток друг к другу, а это, в свою очередь, приводит к нарушению процесса апоптоза и формированию гиперпластического процесса эндометрия.

Статистически значимые различия по сравнению с популяцией в носительстве аллелей гена GPII^ были нами обнаружены в группе пациенток с гиперплазией эндометрия без атипии (р<0,001), у пациенток с рецидивом гиперплазии эндометрия без атипии (р<0,001), пациенток с рецидивирующими полипами эндометрия (р<0,05), пациенток с железисто-фиброзными полипами эндометрия (р<0,05), пациенток с полипами эндометрия, потребовавшими резектоскопического вмешательства (р<0,001).

Заключение. Таким образом, по нашим данным, наличие в генотипе аллеля А2 гена GPIIIa является предрасполагающим фактором к развитию рецидивирующих форм полипов и гиперплазии эндометрия, а также к возникновению полипов эндометрия, для удаления которых недостаточным будет выскабливание полости матки под контролем гистероскопии. Используя вышеописанную методику исследования аллельного распределения гена GPIIIa, мы заранее можем прогнозировать развитие рецидива у пациенток с гиперпластическими процессами эндометрия, являющихся носительницами генотипа PLA1A2 гена GPIIIa. Все внутриматочные манипуляции у таких пациенток должны осуществляться только под контролем гистероскопии. Пациенток с гиперпластическими процессами эндометрия, являющихся носительницами генотипа PLA1A2 гена GPIIIa, необходимо госпитализировать в клиники, оснащенные гистерорезектоскопической аппаратурой, позволяющей выполнить радикальную деструкцию патологически измененной ткани эндометрия.

ЛИТЕРАТУРА

[1] Акмурадова Г.Р. Роль иммунологических и генетических детерминант в возникновении гиперпластических заболеваний репродуктивной системы женщин. Автореф. дисс. канд. мед. наук, - М., 2005.

[2] Адамян Л.В., Ткаченко Э.Р., Киселев С.И. и др. Современные методы диагностики и альтернативные методы лечения гиперпластических процессов и опухолей матки. Практическая гинекология. / Под редакцией акад. РАМН Кулакова В.И. и проф. Прилепской В.Н. , - М. МЕДпресс - информ, 2001.- - С. 89-115.

[3] Бахвалова А.А. Эффективность аблации эндометрия при рецидивирующих гиперпластических процессах слизистой оболочки тела матки. Автореф.дисс. канд.мед.наук.- М.,1998.

[4] Безрукова Н.И. Дифференцированный подход к ведению больных с гиперпластическими процессами эндометрия. Автореф. дис. канд. мед. наук, Иркутск, - 2001.

[5] Бохман Я.В. Руководство по онкогинекологии. - С-Пб.: Фолиант.2002.-542 с.

[6] Войташевскй К.В. Генетические аспекты гиперпластических процессов эндометрия у женщин в постменопаузе. Автореф. дисс. канд. мед. наук, - М., 2005.

[7] Кузнецова И.В. Гиперпластические процессы эндометрия.// Вопросы гинекологии, акушерства и перинаталогии. - 2007.- №5. 6.-С.2-10.

[8] Рудакова Е.Б., Кононов А.В., Акулинина И.Н. Клинико-морфологические параллели между рецепторным статусом полипов эндометрия и частотой возникновения рецидивов после применения гормонального лечения.// Гинекология. - 2001.-№3.6. -С. 20-22.

[9] Савельева Г.М. Справочник по акушерству, гинекологии и перинатологии. -М.МИА, 2006.- 720с.

[10] Пестрикова Т.Ю., Даниленко И. А., Ковалева Т.Д. и др. Применение левоноргестрелсодержащей внутриматочной системы «Мирена» в лечении гиперпластических процессов эндометрия у женщин в перименопаузальном периоде.// Consilium medicum. - 2007.- №9.6.- с.32-35.

[11] Подзолкова Н.М., Глазкова О.Л. Симптом. Синдром. Диагноз. Дифференциальная диагностика в гинекологии. - М.: Гэотар-медиа.2005.- 520с.

[12] Хужокова И. Н. Диагностическая и лечебная тактика при полипах эндометрия в постменопаузе. Дисс. канд. мед. наук. М.,. 2001. - 98с.

[13] Newman P.J.; Derbes R.S.; Aster R.H. The human platelet alloantigens, PlA1 and PlA2, are associated with a leucine33/proline33 amino acid polymorphism in membrane glycoprotein Ilia, and are distinguishable by DNA typing. // J. Clin. Invest. М 1989. - 83, - p.1778 - 81.

PROGNOSTIC SIGNIFICANCE OF PLA POLYMORPHYSM OF GLICOPROTEIN IIIA GENE (GPIIIA) IN ENDOMETRIAL

HYPERPLASIA

P.E. Seregina, G.F. Totchiev, E.A. Panova

Department of Obstetrics and Gynecology with the course of Perinathology of Peoples' Friendship University of Russia

Mikluho-Maklaya st., 8, Medical Faculty, 117198, Moscow, Russia

The PLA genotype of GPIIIa gene was determined in 86 patients with endometrial hyperplasia in peri- and postmenopausal age. 48 patients presented with polypoid features and 38 - with hyperplasia of endometrium. Comparing to population significant increase in incidence of PLA1A2 genotype was observed in patients with hyperplasia of endometrium without atypia (p < 0.001), in patients with recurrent endometrial hyperplasia without atypia (p<0.001), in patients with recurrent endometrial polyps (p <0.05), in patients with glandular-fibrotic endometrial polyps (p <0.05) and also in patients with endometrial polyps requiring hysteroscopic resection.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Key words: integrins, glycoprotein , gene GPIIIa, allele, endometrial hyperplasia, endometrial polyps.

i Надоели баннеры? Вы всегда можете отключить рекламу.