CC BY
0Journal of World's Poultry Research
JWPR
J. World's Poult. Res. 3(4): 93-98, 2013
© 2013, Scienceline Publication
©ntgjBimll AirSMl®
Prevalence of Salmonella Serovars Isolated from Turkey Carcasses
and Giblets in Meknes-Morocco
A. El Allaoui1*, F. Rhazi Filali2, A. Derouich3, B. Karraoua4, N. Ameur5 and B. Bouchrif6
12Equipe Microbiologie et Santé, Département de Biologie, Laboratoire de Chimie Biologie Appliquées à l'Environnement, UniversitéMoulay Ismail Faculté des Sciences, B.P.11201 ZitouneMeknès, Maroc
3Inspection vétérinaire de Tiflet, Maroc 4'6Institut Pasteur du Maroc, Laboratoire de Microbiologie et de l'hygiène des aliments et des eaux 5 Département de Microbiologie eaux aliments, Institut National d'Hygiène Rabat
The present study was conducted to determine the prevalence and the serotypes involved the virulence gene (InvA and SpvC) of Salmonella isolates recovered from the raw meat and giblets (liver and gizzard) of the turkey in various outlets in the Moroccan market. From November 2011 to November 2012 a total of 192 samples of turkey meat (included 48 breasts, 48 legs, 48 gizzards and 48 livers) were collected every ten days from retail outlets in Meknes. Of these, 48 were from popular market, 48 from artisanal slaughterhouses, 48 from poulterers'shops and 48 from a supermarket at Meknes, Morocco. Of the total of 192 samples examined, 24.5% (47/192) were contaminated with Salmonella. Out of the total 48 samples analysed from popular market, 19 (40.42%) proved to be Salmonella positive whereas from 48 samples obtained from traditional slaughterhouses and 48 from poulterers'shops 14 (29.87%) and 8 (17%) contained Salmonella, respectively. Compared to other outlets, a low level of Salmonella contamination was found in samples obtained from Supermarket 6 (12.7%). Among the 47 Salmonella isolates, 6 different serotypes were identified of which S. Saintpaul (46.8%) was the most frequent, followed by S. Agona (17%) and S. Kentucky (17%), S. Typhimurium (8.5%), S. Mantis (6.3%) and S. Bredeney (4.2%).The high level of contamination, especially in popular market and artisanal slaughterhouses of turkey meat and giblets with Salmonella observed in this paper indicates the need for an improvement in the microbiological quality of retail turkey. Examination of Salmonella for invA gene was detected in all the strains (n=47), only three isolates were positive for the gene SpvC: S. Agona, S. Kentucky and S. Infantis.
Key words: Salmonella, Turkey, Retail outlets, Meknes, InvA, SpvC, Morocco
Corresponding author's email: alaouixsaraa@hotmail.com
ABSTRACT
INTRODUCTION
Salmonella infections occur worldwide in both developed and developing countries and are a major contributor to morbidity and economic costs (Antoine et al., 2008). According to the World Health Organization (WHO), there are about 17 million cases of acute gastroenteritis or diarrhea annually due to non-typhoidal salmonellosis with 3 million deaths (Rabsch et al., 2001). In some industrialized countries like the United States and Great Britain country, turkey meat is responsible for twice as cases of salmonellosis in humans that products made of chicken (Bryan et al., 1988). In several countries, a high level of Salmonella contamination in chicken carcasses and giblets from processing plants or retail markets has been reported (Arumugaswamy et al., 1995; Carraminana et al., 1997;
Dominguez et al., 2002). Previous works undertaken in Country of Morocco indicated the presence and distribution of Salmonella in poultry farms (Chaiba, 2010), Turkey meat and meat products (Cohen et al., 2007; karraouan et al., 2010), selected food items (Bouchrif et al., 2009) and human (Ammari et al., 2009). In Morocco, Salmonella, Staphylococcus Aureus, and Clostridium Perfringens are reported to cause 42.8, 37 and 1.7% of food poisoning, respectively (Department of Epidemiology, 2009). Although the declaration and recording of 12 % Salmonella cases remain underreported, Salmonella is the major cause of food poisoning in Morocco (Rouahi et al., 1998), In France is responsible for collective food poisoning with approximately 65% (Haeghebaert et al., 2009) of cases
To cite this paper: El Allaoui A., Rhazi Filali F., Derouich A., Bouchrif B., Carcasses and Giblets in Meknes-Morocco. J. World's Poult. Res. 3(4): 93-98. Journal homepage: http://jwpr.science-line.com/
Karraoua B. and Ameur N. 2013. Prevalence of Salmonella Serovars Isolated from Turkey
and of 95% in the United States of America (Mead et al., 1999). Four kinds of meat turkey outlets are used in Morocco: popular market, artisanal slaughterhouses, poulterers' shops and supermarkets. They differ from each other by the level of hygiene, diet, cold which are subject carcasses (ambient temperatures, refrigeration, freezing). At popular market and artisanal slaughterhouses the conditions of slaughter and sale of the product are faulty (Amara et al., 1994). This kind of poultry is often sold in parts and the selling can take time, during which the carcasses are displayed at ambient temperatures during the day and put in the refrigerator for the night (Amara et al., 1994; Aymar et al., 1998). On the contrary, poulterers' shops and supermarkets ensure the slaughter, storage and sale of poultry meat under good hygienic conditions (Direction d'élevage, 2007).
Currently, there is limited information regarding the prevalence of Salmonella in poultry, especially turkey, in Morocco. Therefore, the present study was conducted to determine the Salmonella prevalence and the serotypes involved, the virulence gene (InvA and SpvC) of Salmonella isolates recovered from the raw meat of the turkey in various outlets in Meknes.
MATERIALS AND METHODS
Samples
Between October 2011 and October 2012, a total of 192 samples of turkey meat (included 48breast, 48 legs, 48 gizzards and 48 livers) were collected every ten days from retail outlets in Meknès. Of these, 48 were from popular market, 48 from artisanal slaughterhouses, 48 from poulterers' shops and 48from a supermarket at Meknes, Morocco. Each sample (approximately 50 g) was placed in a separate sterile plastic bag. Samples were transported to the laboratory immediately after collection in an ice chest and microbiological analysis was carried out immediately.
Isolation and identification of Salmonella
Bacteriological analysis is conducted according to the AFNOR standard (NF U 47-100). Suspected colonies for salmonella were inoculated in Hanja Kligler (Biokar Diagnostic, France) at 37°C for 18 to 24 hours, in Urea Indol (bio MérieuxR SA, France) at 37°C for 2 to 4 hours and testing with oxydas disc (In vitro Diagnostic, USA), in citrate (Oxoid, England), in mannitol (Biokar Diagnostic, France), in lysine (SCHARLAB, Barcelona), and with an ONPG disc (Oxoid Limtedt, England) for biochemical testing and presumptive identification. All isolates were biochemically identified by using the API 20E system (bio Mérieux R SA, France) and then serotyped by slide agglutination test using specific sera against antigens O and H of Salmonella (Bio-Rad) (Diagnostic Pasteur, Paris, France).
Detection of virulence genes
The Salmonella isolates were analyzed by PCR to detect the presence of virulence genes invA and spvC. PCR amplification was performed by using primer pairs described by Bhatta et al. (2007) (F-
5'tatcgccacgttcgggcaa3' and R-
5'tcgcaccgtcaaaggaacc3' and F-5'cggaaataccatcaaata3' and R-5'cccaaacccatacttactctg3' respectively).
The amplicon sizes of invA, spvC were 275 bp and 669 bp respectively. Amplification was performed in a 25 ^l final volume, with reaction mixture containing 1 ^l bacterial DNA; 5 ^l green GO Taq buffer (5x); 100 ^M each deoxynucleoside triphosphates (dNTPs), 0.125 ^M each primers, and 0.5 U GO Taq DNA polymerase (Bio-Rad). Amplification was conducted in the thermocycler (Verity , Bio-Rad). The PCR cycling program of the virulence gene invA/spvC consisted of denaturation at 94 °C for 4 min, followed by 40 cycles of 94 °C for 30 s, 52°C for 30 s, 72 °C for 45 s, and a final extension period at 72 °C for 7 min. PCR products (4 ^l) were resolved by electrophoresis in 1.5-2% (w/v) agarose gels and visualized under ultraviolet transillumination after ethidium bromide staining. A wide-range molecular-weight DNA marker (100-bp DNA ladder, Pro mega) was used on each gel as a standard. Salmonella Typhimurium ATCC 14028 was used as control for all PCR detection.
RESULTS
Of the total of 192 samples examined, 24.5% (47/192) were contaminated with Salmonella (Table 1). Out of the total 48 samples analysed from popular market, 19(40.42%) proved to be Salmonella positive whereas from 48 samples obtained from traditional slaughterhouses and 48 from poulterers' shops 14 (29.87%) and 8 (17%) contained Salmonella, respectively. Compared to other outlets, a low level of Salmonella contamination was found in samples obtained from Supermarket 6 (12.7%) (Figure 1).
Table 1. Salmonella isolated Values from retail outlets
Number of
Sample from samples Examined Positive %
Popular Market Artisanal 4 4 4 OO OO 8 19 14 8 40,42 29,87 17
slaughterhouses Poulterers'shpos
Supermarket 48 6 12,7
Slaughter houses 29.78%
Supermarkets 12.7%
Poulterers' shops 17%
? ? î i f
^iliiliiitr
; ,
XV . X"\/ >V' j
Popular market 42.42%
Figure 1. Percentage of contamination with salmonella as four retail outlets
Among the 47 Salmonella isolates, 6 different serotypes were identified of which S. Saintpaul (46.8%) was the most frequent, followed by S. Agona (17%) and S. Kentucky (17%), S. Typhimurium (8.5%), S. Infantis (6.3 %) and S. Bredeney (4.2%). As shown in Table 2, a high level of Salmonella contamination was found in turkey breast (44.6%) and gizzard (23.4 %), followed by livers (17%) and legs (12.7%). Contamination of
Serotype
S. Saintpaul 10 2
S. Agona 4 1
S. Kentucky 4 2
S. Typhimurium 1 1
S. Bredeney - -
S. Infantis 2 1
Total 21 7
Figure 2. Agarose gel electrophoresis of amplicons generated by simple PCR using primers specific for Salmonella virulence genes. Line 1: 275-bp invA amplicon; Line 2: 669-bp SpvC amplicon, C+ and T+: Positive control (S. Typhimurium penta-resistant ACTeStSul kind) C-, T-: negative control, M: 100-bp DNA ladder.
DISCUSSION
The contamination rate of turkey carcasses and giblets observed in this study (24.94%) was in agreement with those reported by Karraouan et al. (2010) (20.3% in raw turkey minced meat) and Chaiba and al. (2011) (20.83% in chicken carcasses, chicken parts and giblets) in Morocco, by Cook et al. (2009) in Ontario Beli et al (2001) reported a low prevalence of Salmonella in turkey meat in Albania (8.2%), Jordan et al. (2006) in Ireland (3.1%), in USA 2, 6 %, and Zhao et al. (2001) in the UK (5.6%). nevertheless, Bentley (1984) reported a higher prevalence of Salmonella in turkey meat in Canada (68.8%).
turkey carcasses (28.6%) was higher than those of rates of turkey giblets (20%). Invasion gene operon, invA was detected in all Salmonella spp. isolates in our study, however SpvC was detected only in three strains (Figure 2) (24% in turkey pieces), by Arslan and Eyi (2010) in Turkey (29.3% poultry from delicatessens). However, however SpvC was detected only in three strains (Figure 2).
Total 192
4 6 22
1 2 8
1 1 8
1 1 4
1 1 2
- - 3
8 11 47
As shown in Table 1, the contamination rate in poulterers' shops carcasses (17%) was higher than in supermarket (12.7%), possibly due to the greater use of "use by" dates by the supermarkets and also of packaging that would prevent further cross contamination between samples. The results coincide from those obtained by Plummer et al (1995), who detected a lower number of salmonella contaminated carcasses from supermarkets (18.6%), than poulterers' shops (24.5%). This comparison should be made with caution because several factors must be taken into account when making such comparisons, including differences in country and origin, type of meat samples, sampling seasons, slaughterhouse sanitation and isolation methods.
The high prevalence rates reported here might be due to a combination of the low quality of turkey carcasses used, especially in popular market and artisanal slaughterhouses, indeed cross-contamination of Salmonella from giblets to carcass could occur during handling, processing, packing and distribution. The packing of giblets with the carcass observed in this study could have also contributed to increase Salmonella cross-contamination. In addition to these, scalding water can become contaminated with Salmonella from faeces, plucking equipment, cages and floors. Workers can spread the contamination during retailing (Arumugaswamy et al., 1995; Uyttendaele et al., 1998). Rupture of the intestine could also occur during evisceration and pooling giblets might lead to cross-contamination of carcasses and other turkey parts. The process of conventional defeathering has been showed to play an important role in contamination of a high number of turkey carcasses (Clouser et al., 1995). Two out of the sex serotypes detected in the present study (S. Infantis and S. Typhimurium) are in the top 5 most frequent serotypes associated with human salmonellosis in the European Union in the last years (EFSA, 2011). Whereas S. Kentucky was the most common serovar found in Ontario during a sampling period from 2005 to 2006 (CIPARS, 2007) . During the period 2002-2005, we reported 17 cases of salmonellosis in French travelers returning from
Table 2. Distribution of Salmonella serotypes in turkey meat and giblets (n=192)
_Number of positive Samples_
Breast (n=48)_Legs (n=48)_Liver (n=48) Gizzard (n=48)
northeast and eastern Africa, whom S. enterica serotype Kentucky isolates resistance to ciprofloxacin were recovered (Weill et al., 2006). This serovar (S. Kentucky) was detected in Morocco, between 20052008, in raw turkey minced meat to 20.5% (Karraouan et al., 2010). S. Saintpaul, the most frequently isolated in this study, has been associated with foodborne outbreaks including one due to contaminated paprika (Guinee et al., 1961).
According to Enter-Net reports (data on Salmonella human isolates identified by European national reference centers), for the last quarter of the year 2006 (Janine et al., 2010), S. Saintpaul was detected in fattening turkeys in 12 countries, reflecting the wide spread of this serovar (Janine et al., 2010). Salmonella enterica serovar Agona was first identified in Ghana (Guinee et al., 1961). Since them, this serovar has been reported in many countries worldwide in both humans and animals (Clark et al., 1973).
Invasion gene operon, invA was detected in all Salmonella spp. isolates in our study. This gene is essential for full virulence in Salmonella and is thought to trigger the internalization required for invasion of deeper tissue (Khan et al., 1999). There are studies reporting the detection of this gene in all Salmonella spp. isolates (Zahraei et al., 2009; Nashwa et al., 2009; Karraouan et al., 2010). Another study on finding the SpvC gene in different serovars isolated from bovine Salmonella and human pathological products by PCR revealed a frequency of 28% (21/75) and none of the isolates of Salmonella serotypes (Heidelberg ; n = 17), (Infantis ; n = 10), (Schwarzengrund ; n = 11) isolated from broilers were positive for the gene SpvC (Abouzeed et al.,2000).
CONCLUSION
The high level of contamination of turkey meat and giblets with Salmonella observed in this paper indicates the need for an improvement in the microbiological quality of retail turkey. There is also a need for a comprehensive epidemiological study and control of Salmonella contamination at various levels of turkey production and retail outlets in Morocco.
REFERENCES
Abouzeed YM, Hariharana H, Poppeb C and Kibengea FSB (2000). Characterization of Salmonella isolates from beef cattle, broiler chickens and human sources on Prince Edward Island. Comparative Immunology, Microbiology and Infectious Disease, 23: 253-266.. Amara A, Badoum M, Faid M and Bouzoubaa K (1994). Microbial contamination of poultry slaughtered in traditional shops in Morocco. Microbiologie, aliments, nutrition, 12 : 323-327. Aymar J (1998). Appréciation de la qualité bactériologique des carcasses de la volaille préparées dans un abattoir avicole industriel à Rabat, Thèse de Doctorat Vétérinaire, Institut Agronomique et Vétérinaire Hassan II, Rabat . Ammari S, Laglaoui A , En-nanei L, Bertrand S, Wildemauwe C, Barrijal S and Abid M (2009).
Isolation, drug resistance and molecular characterization of Salmonella isolates in northern Morocco. Journal of Infection in Developing Countries, 3(1): 41-49.
Anonymous (2008). Fisa Documentations & statistiques.
Antoine ST, Annaelle K and Anne B (2008). Epidemiological analysis of Salmonella enterica from beef sampled in the slaughterhouse and retailers in Dakar (Senegal) using pulsed-field gel electrophoresis and antibiotic susceptibility testing. Journal of Food Microbiology, 123: 191197.
Antunes P, Reu C, Sousa JC, Peixe L and Pestana N (2003). Incidence of Salmonella from poultry ucprodts and their susceptibility to antimicrobial agents. International Journal of Food Microbiology, 82: 97-103
Arslan S and Eyi A (2010). Occurrence and antimicrobial resistance profiles of Salmonella species in retail meat products. Journal of Food Protection, 73: 1613-1617.
Arumugaswamy RK, Rusul G, Abdul Hamid SN and Cheah CT (1995). Prevalence of Salmonella in raw and cooked foods in Malaysia. Food Microbiology, 12: 3-8.
Beli E, Telo A and Duraku E (2001). Salmonella serotypes isolated from turkey meat in Albania. International Journal of Food Microbiology, 63: 165-167.
Bentley AH (1984). The Salmonella situation in Canada. In: Proc. International. Symposium. on Salmonella, American Association Avian Pathologists., Snoeyenbos GH (Ed.) , 54-63.
Bhatta DR, Bangtrakulnonth A, Tishyadhigama P, Saroj SD, Bandekar JR and Hendriksen RS (2007). Serotyping, PCR, phage-typing and antibiotic sensitivity testing of Salmonella serovars isolated from urban drinking water supply systems of Nepal. Letters in Applied Microbiology, 44:588-594.
Bouchrif B, Paglietti B, Murgia M, Piana A, Cohen N, Ennaji MM, Rubino S and Timinouni M (2009). Prevalence and antibiotic-resistance of Salmonella isolated from food in Morocco. Journal of Infection in Developing Countries, 3(1):35-40.
Bryan FL, Michanie SC, Alvarez P and Paniagua A (1988). Critical control points of street-vended foods in Dominican Republic. Journal of Food Protection, 51: 373-383.
Capita R, Alonso-Calleja C, Prieto M (2007). Prevalence of Salmonella enterica serovars and genovars from chicken carcasses from slaughterhouses in Spain. Journal of Applied Microbiology, 103: 1366-1375.
Carraminana JJ, Yanguela J, Blanco D, Rota C, Agustin AI, Arino A and Herrera A (1997). Salmonella incidence and distribution of serotypes throughout processing in a Spanish poultry slaughterhouse. Journal of Food Protection, 60: 1312-1317.
Chaiba A (2011). Impact des pratiques de production de poulet de chair à Meknès sur la qualité bactériologique, l'antibiorésistances et les résidus d'antibiotiques dans les produits aviaires finis, Thèse de Doctorat National, Université Moulay Ismail, Faculté des Sciences de Meknès, Maroc.
CIPARS (2007). Canadian Integrated Program for Antimicrobial Resistance Surveillance Annual Report. Public Health Agency of Canada, Guelph, Ontario, Canada.
Clark, G., Kaufmann, A., Gangarosa, E (1973). Epidemiology of an international outbreak of Salmonella agona. Lancet, 2: 490-3.
Clouser CS, Doores S, Mast MG and Knabel SJ (1995). The role of defeathering in the contamination of turkey skin by Salmonella species and Listeria monocytogenes. Poultry Science, 74:723-731.
Cohen N, Ennaji H, Bouchrif B, Hassar M and Karib H (2007). Comparative Study of Microbiological Quality of Raw Poultry Meat at Various Seasons and for Different Slhtering Processes in Casablanca (Morocco). Poultry Science Association, Journal of Applied Poultry Research, 16: 502-508.
Cook A, Reid-Smith R, Irwin R, McEwen SA, Valdivieso-García A and Ribble C (2009). Antimicrobial resistance in Campylobacter, Salmonella, and Escherichia Coli isolated from retail turkey meat from Southern Ontario, Canadá. Journal of Food Protection, 72: 473481.
Department of Epidemiology (2005). Foodborne Disease Outbreak Reports, Searchable Data 2000-2005. Ministry of Public Health, Rabat, Morocco.
Direction de l'élevage (2007).. Situation du secteur avicole à la veille de l'application de la loi 49/99. 2007. Rabat, Maroc.
Dominguez C, Gomenz I and Zumalacarregui J (2002) Prevalence of Salmonella and Campylobacter in retail chicken meat in Spain. International Journal of Food Microbiology, 72:165-168.
EFSA (2009). The European Union summary report on trends and sources of zoonoses, zoonotic agents and foodborne outbreaks in 2009.
EFSA (2011). The European Union summary report on trends and sources of zoonoses, zoonotic agents and foodborne outbreaks in 2009. EFSA Journal 9 (3): 2090-2477
Janine B, Irene R, Andreas S, Annemarie Ka's, Reiner H and Beatriz G (2010). A Predominant Multidrug-Resistant Salmonella enterica Serovar Saintpaul Clonal Line in German Turkey and Related Food Products. Applied and Environmental Microbiology, 3657-3667.
Jerngklinchan J, Koowatananukul C, Daengprom K and Saitanu K (1994). Occurrence of salmonella in raw broilers and their products in Thailand. Food Protection, 57: 808-810.
Jordan E, Egan J, Dullea C, Ward J, Mc Gillicudy K, Murray G, Murphy A, Bradshaw B, Leonard N,
Rafter P, Mc Dowell S (2006). Salmonella surveillance in raw and cooked meat and meat products in the Republic of Ireland from 2002 to 2004. International Journal of Food Microbiology, 112: 66-70.
Haeghebaert S, Sulem P, Deroudille L, Vanneroy-Adenot E, Bagnis O, Bouvet P, Grimont F, Brisabois A, Le Querrec F, Hervy C, Espie E, de Valk H and Vailant V (2001).Two outbreaks of Salmonella Enteritidis phage type 8 linked to the consumption of Canal cheese made with raw milk, France, Eurosurveillance, 8: 151-156.
ICMSF (1998). International Commission on Microbiological Specifications for Foods. Poultry and poultry products. In: Microorganisms in Foods. 6. Microbiol Ecology of Food Commodities. Blackie Academic & Professionals, London.
Guinee P, Kampelmacher E and Willems H (1961). Six new Salmonella types, isolated in Ghana (S. volta, S. agona, S. wa, S. techimani, S. mampong and S. tafo). Antonie Van Leeuwenhoek, 27:46972.
Karraouan B, Fassouane A, EL Ossmani H, Cohen N, Charafeddine O et Bouchrif B (2010). Prévalence et gènes de virulence des Salmonella isolées des viandes hachées crues de dinde à Casablanca (Maroc). Revue de Médecine Vétérinaire, 161(3): 127-132.
Khan AA, Nawaz MS, Khan S and Sernigelia CE (1999). Detection of Multidrug Resistant Salmonella Typhimurium DT104 by Multiplex polymerase chain reaction. FEEMS Microliology. Letters, 182: 355-360.
Lehmacher A, Bockemuhl J and Aleksic S (1995). Nationwide outbreak of human salmonellosis in Germany due to contaminated paprika and paprika-powdered potato chips. Epidemiology and Infection ,115: 501-511.
Mead PS, Slutsker L, Diets V, McCaig LF, Bresee JS, Shapiro C, Griffin PM and Tauxe RV (1999). Food related illness and death in United States. Emerging Infectious Diseases, 5:607-625.
Nashwa HM, Mahmoud AH, Sami and Adawy S (2009). Application of Multiplex Polymerase Chain Reaction (M-PCR) for Identification a Characterization Salmonella enteritidis and Salmonella Typhimurium, Journal of Applied Sciences Research, 5(12): 2343-2348.
Plummer RAS, Blissett ST and Dodd CER (1995). Salmonella contamination of retail chicken products sold in the UK. Journal of Food Microbiology, 58:843-846.
Rabsch W, Tschape, H and Baumler, AJ (2001). Non-typhoidal Salmonellosis: Emerging problems. Microbes and Infection, 3: 237-247.
Rouahi N, Zouhdi M, Benabderrazek F, Boudhan A, Hamid K, Driss L, Zidouh A, Benkadour K. Mahjour J, Elyachoui M et Alaoui MA (1998). Analyse des données des trois dernières années sur les salmonelloses au Maroc (1995-1997). Biologie infection Tome, IV: 3-10.
Uyttendaele, M.R., J.M. Debevere, R.M. Lips and K.D. Neyts KD (1998). Prevalence of Salmonella in poultry carcass and their products in Belgium.
International Journal of Food Microbiology, 40: 1-8.
Weill FX, Bertrand S, Guesnier F, Baucheron S, Grimont PAD and Cloeckaert A (2006). Ciprofloxacin-resistant Salmonella Kentucky in travelers. Emerging Infectious Diseases, 12: 1611-2.
Yashoda KP, Sachindra NM , Sakhare PZ and Rao DN (2001). Microbiological quality of broiler chicken carcasses processed hygienically in a small scale poultry processing unit. Journal of Food Quality, 24: 249-259.
Zahraei T, Mahzoonae MR, and Ashrafi A (2009). Ampllification of invA gene of Salmonella by polymerase chain reaction (PCR) as a specific method for detection of Salmonella. J. Faculty. Veterinaria. Medicine. Univ. Tehran, 61(2): 195199.
Zhao C, Ge B,Villena JD, Sulder R , Yeh E, Zhao S, White DG, Wagner D and Meng J (2001). Prevalence of Campylobacter spp. , Escherichia Coli, and Salmonella serovars in retail chicken , turkey, pork and beef from Grater Washington, D.C, Area. Applied and Environmental Microbiology, 67:5431-5436.
