Phylogenetic Analysis and Detection of Drug Resistance Gene in Theileria annulata Isolated from Buffaloes Текст научной статьи по специальности «Биологические науки»

2023, Scienceline Publication

Worlds Veterinary Journal

World Vet J, 13(2): 318-323, June 25, 2023

DOI: https://dx.doi.org/10.54203/scil.2023.wvj34

Phylogenetic Analysis and Detection of Drug Resistance Gene in Theileria annulata Isolated from Buffaloes

Shehala Rasool Fadel , Howaida Hamel Abed , and Amer Rasool Alhaboubi *©

Department of Parasitology, College of Veterinary Medicine, University of Baghdad, Baghdad, Iraq Corresponding author's Email: arussul@covm.uobaghdad.edu.iq

ABSTRACT

Bovine theileriosis, caused by Theileria annulate, is disease affecting cattle and buffaloes worldwide. The current study aimed to screen the blood samples of 30 naturally suspected local buffaloes infected with Theileria species. The blood samples were initially examined by light microscopic and then the positive samples were subjected to PCR reactions. All 30 animals indicated clinical symptoms, such as high fever, loss of appetite, the presence of the hard tick, and enlargement of lymph nodes. The amplified products of 18S rRNA were analyzed, along with molecular detection of the drug-binding site alterations and interrelated changes in the cytochrome b (cyto b) gene. Blood smears revealed the presence of infected erythrocytes with Theileria spp. The PCR results confirmed infection in samples when DNA amplified with partial 18S rRNA and cyto b genes. The sequencing data were obtained from GeneBank using the accession numbers 0M937770.1, 0N207523.1, 0N207525.1, 0N207524.1, 0N207526.1, and 0N207527.1 Following BLAST analysis (Basic Local Alignment Search Tool), genetic differences were observed between the Iraqi isolate 0M937770.1 and strains from India, Iran, and Turkey. The data obtained from the current study may reveal the genetic alteration of the local strain in the drug-target codons, which are found in one isolate and are different from the GenBank isolates. The results suggest that the failure of buparvaquone therapy might be due to the resistance to cyto b gene.

Keywords: Buffalo, Buparvaquone, Gene, Theileria annulata INTRODUCTION

Bovine theileriosis is a worldwide prevalent disease in cattle and buffalo, caused by the tick-borne hemoprotozoan parasite known as Theileria annulate (Bilgic et al., 2010; Abdullah and Ali, 2021; Ullah et al., 2021). Several genera of hard ticks (Ixodidae) can transmit the disease and the clinical manifestations include fever, swollen lymphoid tissue, jaundice, and high mortality (Ali et al., 2013; Abdel Rahman and Ismaiel, 2018). Theileriosis negatively affect dairy and livestock animals productivity, leading to significant losses in the industry due to decreased milk output and weight loss (Gharbi et al., 2006). Compared to other vector-borne diseases, theileriosis prevalence is higher than Anaplasma spp. (11%) but lower than babesiosis (29%) across the world (Paramanandham et al., 2019; Jacob et al., 2020; Abid et al., 2021). In buffaloes, the infection rates of babesiosis, theileriosis, and anaplasmosis were 51.44%, 15.74%, and 13.99 %, respectively (Anwar, 2018). This discrepancy may be attributed to the fact that most studies have focused on diagnosing theileriosis in cattle rather than buffalos, with cattle traditionally considered the primary host for theileriosis (AL-Judi, 2001; Sallemi et al., 2018; Kawan, 2019).

Apart from the difficulty of species identification, the blood smear technique is not suitable for detecting infections with low parasite levels (Nayel et al., 2012; Rafiullah et al.,2019; Arwa and Kawan, 2022). Serological approaches for detecting Theileria species are insensitive due to cross-reactions and the loss of antibodies in long-term carriers (Passos et al., 1998). Therefore, the present study aimed to evaluate the prevalence of Theileria annulata (T. annulata) among buffaloes in Iraq and identify drug-binding site alterations in codons in the resistant isolates.

MATERIALS AND METHODS Ethical approval

The project received approval and funding from the local committee of animal care at the College of Veterinary Medicine, University of Baghdad, Iraq, under reference number 706, dated 23/3/2022.

ISSN 2322-4568

> R i.

a a d :

2 O 2

2 O

3 2

8 9

Aa 2

h O

0

1 —

G

HH

N A L

A R

T

HH

C L

E

318

Sample collection

The study included blood samples of 30 Bubalus bubalis buffalos (28 female and 2 male) aged 1-3 years old, presenting symptoms, such as fever and enlargement of lymph nodes. During the examination of the animals' bodies, the presence of the hard tick species Haylomma anatolicum was observed. Subsequently, the animals were treated with buparvaquone (Buparvon, ALKE, Istanbul®), an approved anti-parasitic drug, at a single dose of 2.5 mg/(Saruhan and Pa§a, 2008). The treatment was administered in a licensed private veterinary clinic located in southeast Iraq during the early summer of 2021. After the treatment, 5 ml of blood was collected from the jugular vein of each animal using an EDTA-coated glass tube. The blood samples were then transferred to the laboratory of the Zoonotic Diseases Research Unit, University of Al-Qadissyia College of Veterinary Medicine, Iraq, with an icebox.

Microscopic examination

Thin blood films were prepared immediately from the collected blood samples, and subsequently dried, and fixed by 100% Ethanol (BDH, England). Samples were transferred to the laboratory in a slide box for Giemsa staining and examination under a light microscope (Olympus CX21, Philippines) based on the technique described by Soulsby (1982). The slides were stained with Giemsa solution (England), for at least 20 minutes. Finally, the slides were examined using a microscope with an oil immersion lens at a magnification of X100.

Genomic materials extraction

The DNA extraction process was performed on the 30 collected blood samples. For this purpose, 200 ^l of whole blood was utilized, and the extraction was conducted using the G-spin genomic kit (iNt RON Biotech. Seongnam, Si, S. Korea) following the manufacturer's instructions. The DNA was successfully isolated from the samples, resulting in concentrations ranging 150-350 ng/^l. Due to issues related to purity and DNA concentration, only 13 samples were used in the subsequent analyses. The concentration and purity of genomic DNA were assessed using a NanoDrop (Thermo/USA), with acceptable 260/230 ratios used for PCR amplification.

Polymerase chain reaction

The primers used in the study were designed according to a corresponding reference sequence, available in the GenBank database of T. annulata, 18S rRNA (570bp) gene (OQ411265 and MN432518 (partial) Unpublished data). The forward primer sequence used was F: CAGGCTTTCG CCTTGAATAG, while the reverse primer sequence was R: ACCACCACCCAAAGAATCAA. For the cytochrome b (cyto b) gene (891 bp), the forward primer employed was F: CGGTTGGTTTGTTCGTCTTT and reverse primer was R: CGAACTCTTGCAGAGTCCAAT (supplied from Bioneer [Korea] in conjunction with the AddStart Taq Master [2x Conc.] 1.0 ml kit/ ADDBIO, INC). The PCR reaction mixture was prepared with a total volume of 20 ^l. Each primer (1.5 ^l) was added, along with 10 ^l of the master mix. A volume of 2 ^l of DNA was included, and the remaining volume was filled with deionized PCR water to reach the total volume. The thermocycler reaction protocol included desaturation (at 95°C for 30 seconds), annealing (at 58°C for 30 seconds), extension (at 72°C 1 minute, and final extension at 72°C 5 minutes) for 33 cycles. The amplified products were electrophoresed with 1.5% agarose gel at 80 volts, stained in the ethidium bromide, and visualized with a UV transilluminator reader.

DNA sequencing method

All PCR products were subjected to Sanger dideoxy sequencing technology, following the method described by Hsiao (2019). The amplification of 18S rRNA gene, and cyto b gene was performed, and sequencing was done using the Sanger sequencing system (forward and reverse reaction for each products, Bioneer Company, Korea). The resulting sequence was aligned together for phylogenetic tree analysis using Unweighted Pair Group Method Arithmetic. (UPGM; Wheeler and Kececioglu, 2007). For the tree-building procedure, NCBI-BLAST alignment and Neighbor Distances in MEGA software were used. All data obtained in the current research were submitted to GenBank ON207523.1, ON207524.1, ON207525.1, ON207526.1ON207527.1, and OM937770.1.

RESULTS

The microscopic characterization of the stained blood film indicated erythrocytes infected with the Theileria species in only 6 positive samples out of 13 running reactions (Figure 1). These positive samples were obtained from animals exhibiting clinical symptoms, such as high fever, loss of appetite, enlargement of lymph nodes, and pale mucus membranes.

319

PCR, sequencing and phylogenetic tree construction

Due to certain limitations, only six out of thirteen PCR-amplified reactions for both the rRNA gene, and cyto b gen were selected for Sanger dideoxy sequencing technology (Hsiao, 2019, Figure 2). The obtained partial 18S rDNA sequences were aligned with the corresponding sequences from the GenBank® database (Figure 3). However, only six readable and clean reaction data were obtained from the sequencing process.

The study involved aligning the obtained sequences with corresponding data available in the GenBank database. The alignment was performed for the deduced cyto b amino acid sequences, using the Clustal W default setting of MEGA v6.0 (Figure 4). Evolutiocnary distances were calculated using the Unweighted Pair Group MethodArithmetic (UPGMA) method. The phylogenetic tree constructed based on the cyto b gene showed distinct distances between local between T. annulata isolates and Indian, Iranian, and Turkish strains.

Figure 1. Microscopic examination of stained blood sample by Giemsa staining indicating Theileria species (arrows) is in the erythrocytes of a buffalo in Iraq (100 X magnification)

18SrRNA

1 2 3 4 5 6

570bP

cyt b gene

1 2

Figure 2. The electrophoresed 1.5% agarose gel using the Theileria annulata 18S rRNA and cyto b genes PCR products from buffalo DNA. a: Lanes 1-6 represent positive samples at 570bp for 18S (rRNA) gene. b: Lanes 1-6 represent positive samples at 891 bp for cyt b gene in buffalo.

320

I C1N207523 1 Theilena annulata isolate TA-1 small subunit nbosomal RNAgene partial sequence I ON2D7525 1 Theilena annulata isolate TA-3 small subunit nbosomal RNAgene partial sequence -MT341858.1 Theilena annulata small subunit nbosomal RNAgene partial sequence

■q

ON207524 1 Theilena annulata isolate TA-2 small subunit nbosomal RNAgene partial sequence ON207526.1 Theilena annulata isolate TA-4 small subunit nbosomal RNAgene partial sequence

-AY508464 1 Theilena annulata isolate Turkey 4 small subunit nbosomal RNAgene partial sequence

-■ ON207527-1 Theilena annulata isolate TA-5 small subunit nbosomal RNAgene partial sequence.

-MK849884.1 Theileria sp. isolate Bihar2 small subunit nbosomal RNAgene partial sequence

0.5

Figure 3. Constricted genetic tree shows Iraqi Theileria isolates based on the 18S ribosomal (r.) RNA gene (Green Square). Evolutionary distances were calculated using the (UPGMA) Unweighted Pair Group Method Arithmetic, Wheeler and Kececioglu 2007) method in MEGA v6 in buffalo.

MK693133 1 Theilena annulata isolate Germencik-<I3 clone CI-10 cytochrome b (cytb) gene complete cds mtochondnal

MK693130 1 Theilena annulata isolate Mazilli-03 clone CM cytochrome b (cytb) gene complete cds mtochondnal

MG787981 1 Theilena annulata isolate Hapur cytochrome b (cytb) gene compete cds mtochondnal

MH778940 1 Theilena annulata isolate 1 cytochrome b gene complete cds rmtochondnal

MT812969 1 Theilena annulata cytochrome b (cytb) gene comftete cds rmtochondnal

MG787985 1 Theilena annulata isolate Mhow cytochrome b (cylb) gene complete cds mtochondnal

MK693135 1 Theilena annulaSa isolate Akacaova-IB done CI-10 cytochrome b (cytb) gene complete cds mrtochondnal

MK69313! 1 Theilena annulata isolate Akacaova-16 done CI-9 cytxhrome b (cylb) gene complete cds mtochondnal

MK693124 1 Theilena annulata isolate Akacaova-10 done CI-9 cytochrome b (cytb) gene complete cds mtochondnal

A QM937770 1 Theilena annulata isolate Iraq cytochrome b (cytb) gene complete cds mrtochondnal

Figure 4. Phylogenetic tree analysis of local Theileria annulata isolates based on the (cyto b) gene (green label). The evolutionary distances were calculated using the UPGMA method in MEGA v6.0 (Kumar et al., 2016) in buffalo.

DISCUSSION

Since PCR is a more sensitive method, the results from this investigation were consistent with previous studies (Hasso and Al-Nashy, 2002; Gharbi et al., 2006; Alhaboubi et al., 2017). False-negative diagnoses of theileriosis through blood smear examination often occur due to the various structural configurations of piroplasms (Edith et al., 2018; Farooq et al., 2019; Al-Amery and Al-Amery, 2022). PCR-based molecular diagnosis may be used to circumvent the drawbacks of blood smear testing and investigate the parasite's prevalence throughout a large herd of cattle (Hasso and Al-Nashy, 2002; Faraj 2019; Al-Abedi and Al-Amery, 2021). The tree analysis was conducted using a neighbor-joint algorithm. All the Iraqi obtained sequences of the 18S rDNA aligned together with 100% identity. The isolates 0N207523.1 0N207525.1 were close to each other with 100% identity for Indian buffalo isolates with variation with 0N207524.1 and 0N207526.1 which were close to each other in 100% identity. On the other hand, 0N207527.1 was closely attached to Turkish cattle isolates and Indian Buffalo isolates. This result ensures the stability of the 18S rRNA gene of T. annulata in different hosts and the cross-relation of transmission factors and similarity of the buffaloes' origin in Iraq.

Previous studies have indicated that buparvaquone, like other hydroxynaphthoquinones, could well act by binding to the cyto b location and preventing the parasite's electron transport pathway (Goodman et al., 2017). The T. annulata may become quite drug-resistant, especially in endemic areas, such as Iran, Turkey, and Tunisia, which might make it very difficult for bovine livestock to thrive in these areas (Mhadhbi et al., 2015). The identified drug is a Qo inhibitor that specifically targets the coenzyme Q binding pocket in the cyto b gene, leading to effective inhibition of mitochondrial respiration. However, it commonly fails to treat patients with single or double mutations in the Qo binding region of the cyto b gene. This finding helps explain the observed genetic distance between the resistant Iraqi isolate (0M937770.1) and strains from India, Iran, and Turkey (Figure 4, Parveen et al., 2021). This is further supported by a study performed in Iraq suggesting several mutations in the cyto b gene may have been responsible for the resistance of the parasite against buparvaquone (Alfatlawi et al., 2021).

Theileriosis is of high susceptibility in exotic breeds and crossbred bovines, including buffalo, and its significant effect on animal health leads to economic losses (Al-Taiy et al., 2020). There is no doubt that the treatment with longstanding protocols, may develop drug resistance, especially in the exotic breeds of the infected animals.

321

CONCLUSION

Molecular approaches have shown higher specificity in detecting the prevalence of theileriosis compared to blood smear examinations. In this study, it was found that buparvaquone, the primary hydroxynaphthoquinone drug, has become ineffective against tropical theileriosis due to the emergence of drug resistance. The Cytochrome b gene plays a crucial role as a target gene and marker in characterizing and understanding the failure of buparvaquone therapy caused by drug resistance.

DECLARATIONS

Availability of data and materials

The authors declared that all data and materials supporting the results of this study are available in present article.

Funding

The project did not receive financial support and it was funded by the authors.

Ethical consideration

The authors considered all the ethical concerns, including plagiarism, the double submission, and the originality of the presentation.

Authors' contributions

All authors contribute equally to the research plan. Shehala R. Feidhel, and Howaida H. Abed, collected samples and prepared them for laboratory work. Amer R. Alhaboubi contributed to molecular application and DNA analysis. All authors contribute in writing the manuscript and have agreed to publish the last version and revisions. Amer R. Alhaboubi was the correspondent of the submitted article.

Competing interests

All authors declared no conflict of interest

Acknowledgments

Authors appreciate all the laboratory assistance and technical support from the Zoonotic Diseases Research Unit, University of Al-Qadissyia College of Veterinary Medicine.

REFERENCES

Abdel Rahman MM and Ismaiel WM (2018). Comparative study for diagnosis of babesiosis and theileriosis in different age groups of cattle in some localities in Egypt with treatment trials. Egyptian Veterinary Medical Society of Parasitology Journal, 14(1): 1-14. DOI: https://www.doi.org/10.21608/evmspi.2019.33911 Abdullah SH and Ali SA (2021). Molecular investigation and phylogeny of Theileria spp. from naturally infected sheep and the first report of Theileria sp. OT3 in Sulaymaniyah governorate/Iraq. Polish Journal of Veterinary Sciences, 24(2): 201-209. DOI: https://www.doi.org/10.24425/pivs.2021.136809 Abid K, Bukhari S, Asif M, Sattar A, Arshad M, Aktas M, Ozubek S, Shaikh RS, and Iqbal F (2021). Molecular detection and prevalence of Theileria ovis and Anaplasma marginale in sheep blood samples collected from Layyah district in Punjab, Pakistan. Tropical Animal Health and Production, 53: 439. DOI: https://www.doi.org/10.1007/s11250-021-02870-5 Al-Abedi GJK and Al-Amery AMA (2021). Molecular diagnosis and phylogenetic analysis of babesia species isolated from ticks of infested cattle in Wasit Governorate, Iraq. Iraqi Journal of Agricultural Sciences, 52(1): 136-145. DOI: https://www.doi.org/10.36103/iias.v52i1.1245

Al-Amery AR and Al-Amery AMA (2022). Molecular diagnosis of Cryptosporidium ssp. In water buffaloes at Babylon province, Iraq. Iraqi Journal of Agricultural Sciences, 53(1): 147-156. DOI: https://www.doi.org/10.36103/iias.v53i1.1519

Alfatlawi MA, Jasim AA, Jarad NE, and Khlaif SF (2021). Clinical and molecular identification of ruling Theileria annulata strains in cattle calves in Al-Diwaniyah province, Iraq. Iraqi Journal of Veterinary Science, 5(1): 115-119. DOI: http://www.doi.org/10.33899/iivs.2020.126429.1319

Alhaboubi AR, Pollard DA, and Holman PJ (2017). Molecular and morphological characterization of a haemogregarine in the alligator snapping turtle, Macrochelys temminckii (Testudines: Chelydridae). Parasitology Research, 116: 207-215. DOI: https://www.doi.org/10.1007/s00436-016-5280-2%20

Ali Z, Maqbool A, Muhammad K, Khan M, and Younis M (2013). Prevalence of Theileria annulata infected hard ticks of cattle and buffalo in Puniab, Pakistan. The Journal of Animal & Plant Sciences, 23(1): 20-26. Available at: http://www.theiaps.org.pk/docs/v-23-1/04.pdf AL-Judi AMH (2001). Treatment of mange in buffaloes with Abamectin. Iraqi Journal of Veterinary Medicine, 25(1): 194-198. DOI: https://www.doi.org/10.30539/iivm.v25i1.1160

322

Al-Taiy HK, Al-Salhi ATH, and Al-Mashadani ALJ (2020). Development extension service to meeting the requirements of buffalo

breeders in Iraq. Iraqi Journal of Agricultural Sciences, 51(1): 432-442. DOI: https://www.doi.org/10.36103/ijas.v51i1.942 Anwar K (2018). Epidemiology of tick-borne infection in ruminants in Peshawar. The Journal of Advances in Parasitology, 5(1): 6-10. Available at: http://nexusacademicpublishers.com/uploads/files/JAP 5 1 6-10.pdf

Arwa RK and Kawan MH (2022). Microscopic examination of ovine Babesiosis at Baghdad city. Iraqi Journal of Agricultural

Sciences, 53(4): 798-801. DOI: https://www.doi.org/10.36103/ijas.v53i4.1591 Bilgic HB, Karagenj T, Shiels B, Tait A, Eren H, and Weir W (2010). Evaluation of cytochrome b as a sensitive target for PCR based detection of T. annulata carrier animals. Veterinary Parasitology, 174(3-4): 341-347. DOI: https://www.doi.org/10.1016/j.vetpar.2010.08.025 Edith R, Harikrishnan TJ, Gomathinayagam S, Kumarasamy P, and Senthilkumar TMA (2018). Cytochrome b gene based molecular survey of Theileria annulata infection in cattle in Tamil Nadu, India. Journal of Entomology and Zoology Studies, 6(5): 23562359. Available at: https://www.entomoljournal.com/archives/2018/vol6issue5/PartAB/6-5-305-115.pdf Faraj AA, Hade BF, and Al-Amery AM (2019). Conventional and molecular study of Babesia spp. of natural infection in dragging horses at some areas of Baghdad city, Iraq. Iraqi Journal of Agricultural Sciences, 50(3): 909-915. DOI: https://www.doi.org/10.36103/ijas.v50i3.707

Farooq U, Tufani NA, Malik HU, and Mir MS (2019). Clinical and morpho-molecular epidemiology of bovine theileriosis in Kashmir, India. Indian Journal of Animal Research, 53(3): 375-381. Available at: https://arccarticles.s3.amazonaws.com/webArticle/Final-attachment-published-B-3512.pdf

Gharbi M, Sassi L, Dorchies P, and Darghouth MA (2006). Infection of calves with Theileria annulata in Tunisia: Economic analysis and evaluation of the potential benefit of vaccination. Veterinary Parasitology, 137(3-4): 231-241. DOI: https://www.doi.org/10.1016/j.vetpar.2006.01.015

Goodman CD, Buchanan HD, and McFadden GI (2017). Is the mitochondrion a good malaria drug target?. Trends Parasitology, 33(3): 185-193. DOI: https://www.doi.org/10.1016/j.pt.2016.10.002

Hasso SA and Al-Nashy NA (2002). Single and mixed blood protozoa infection with Anaplasma and Theileria in Buffaloes (Bubalus bubalis) in Baghdad-Iraq. Iraqi Journal of Veterinary Medicine, 26(1): 149-152. DOI: https://www.doi.org/10.30539/ijvm.v26i1.1133 Hsiao SJ (2019). Sources of error in molecular diagnostic analyses. Accurate results in the clinical laboratory. Chapter 21, pp. 337347. DOI: https://www.doi.org/10.1016/B978-0-12-813776-5.00021-2 Jacob SS, Sengupta PP, Paramanandham K, Suresh KP, Chamuah JK, Rudramurthy GR, and Roy P (2020). Bovine babesiosis: An insight into the global perspective on the disease distribution by systematic review and meta-analysis. Veterinary Parasitology, 283: 109136. DOI: https://www.doi.org/10.1016/j.vetpar.2020.109136

Kumar S, Stecher G, and Tamura K (2016). MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 33(7): 1870-1874. DOI: https://www.doi.org/10.1093%2Fmolbev%2Fmst197

Mhadhbi M, Chaouch M, Ajroud K, Darghouth MA, and BenAbderrazak S (2015). Sequence polymorphism of cytochrome b gene in Theileria annulata Tunisian isolates and its association with buparvaquone treatment failure. PloS one, 10(6): e0129678. DOI: https://www.doi.org/10.1371/journal.pone.0129678

Nayel M, El-Dakhly KM, Aboulaila M, Elsify A, Hassan H, Ibrahim E, and Yanai T (2012). The use of different diagnostic tools for Babesia and Theileria parasites in cattle in Menofia, Egypt. Parasitology Research, 111(3): 1019-1024. DOI: https://www.doi.org/10.1007/s00436-012-2926-6 Paramanandham K, Mohankumar A, Suresh, KP, Jacob SS, and Roy P (2019). Prevalence of Anaplasma species in India and the world in dairy animals: A systematic review and meta-analysis. Research in Veterinary Science, 123: 159-170. DOI: https://www.doi.org/10.1016/j.rvsc.2019.01.013 Parveen A, Alkhaibari AM, Asif M, Almohammed HI, Naqvi Z, Khan A, Aktas M, Ozubek S, Farooq M, and Iqbal F (2021). Molecular epidemiology of Theileria annulata in cattle from two districts in Punjab (Pakistan). Animals, 11(12): 3443. DOI: https://www.doi.org/0.3390/ani11123443 Passos LMF, Bell-Sakyi L, and Brown CGD (1998). Immunochemical characterization of in vitro culture-derived antigens of Babesia bovis and Babesia bigemina. Veterinary Parasitology, 76(4): 239-249. DOI: https://www.doi.org/10.1016/S0304-4017(98)00095-8

Rafiullah A, Rahman K, Khan A, Ali A, Khan A, and Sajid NK (2019). Prevalence of Theileria parva in large ruminants through conventional and molecular techniques in district Lakki Marwat and Peshawar (Pakistan). Sarhad Journal of Agriculure, 35: 320329.

Sallemi S, Rjeibi MR, Rouatbi M, Amairia S, Ben Said M, Khamassi Khbou M, and Gharbi M (2018). Molecular prevalence and phylogenetic analysis of Theileria 323nnulate and Trypanosoma evansi in cattle in Northern Tunisia. Veterinary Medicine Science, 4(1): 17-25. DOI: https://www.doi.org/10.1002/vms3.79

Sarahan B and Pa§a S (2008). Therapeutic efficacy of buparvaquone (buparvon) in cattle with theileriosis. Turkiye Parazitolojii Dergisi, 32(4): 317-321. Available at: https://europepmc.org/article/med/19156603

Soulsby EJL (1982). Helminths, arthropods, and protozoa of domesticated animals, 7th Edition. Bailliere Tindall., London. p. 809.

DOI: https://www.doi.org/10.1016/0035-9203(84)90110-X Ullah R, Shams S, Khan MA, Ayaz S, Akbar NU, Din QU, Khan A, Leon R, and Zeb J (2021). Epidemiology and molecular characterization of Theileria annulata in cattle from central Khyber Pakhtunkhwa, Pakistan. PloS one, 16(9): e0249417. DOI: https://www.doi.org/10.1371/journal.pone.0249417 Wheeler TJ and Kececioglu JD (2007). Multiple alignment by aligning alignments. Bioinformatics, 23(13): 559-568. DOI: https://www.doi.org/10.1093%2Fbioinformatics%2Fbtm226

323