CC BY
51Russian Journal of Nematology, 2017, 25 (2), 143 - 165
Newsletter of the Russian Society of Nematologists
Abstracts of the Twelfth International Symposium of the Russian Society of
Nematologists (Russia, Nizhny Novgorod, 31 July-6 August, 2017)
AKHATOVA F.S., FAKHRULLINA G.I., GAYAZOVA E.I., NAUMENKO E.A. & FAKHRULLIN R.F. Visualisation of nematode cuticle using atomic force microscope.
Caenorhabditis elegans is widely used as a model object in studies on genetics, developmental biology, toxicology and drug screening, which in turn strongly depend on the structure of the cuticle. In our work, we analysed the surface of the cuticle of nematodes in different environments - in air and in water. Detailed Atomic Force Microscopy images with high resolution in air of cuticles of nematodes were obtained. These images clearly demonstrate the typical morphological features of epicuticle (rings, furrows, sensory hillocks). We investigated the nematodes in their native liquid medium. As a rule, C. elegans nematodes live in a thin film of water either in soil particles (their natural environment) or on wet agar plates (under laboratory conditions). In this study, we have firstly demonstrated the AFM visualisation of nematodes, fully immersed in water. Scanning in an aqueous medium gives a more accurate 3D picture of the surface. In the PeakForce Tapping mode, we can not only demonstrate the structure of the cuticle, but also obtain the data on the mechanical properties of the surface (elasticity, stiffness, adhesion etc.). In our work, we have demonstrated the new features of this mode for accurate nanomechanical mapping of nematodes surface (Support: RFBR 15-04-99660-a, performed according to the Russian Government Program of Competitive Growth of Kazan Federal University, RSF 14-14-00924). - Kazan (Volga Region) Federal University, Kazan, 420008, Russia; e-mail: akhatovaf@gmail.com.
AKHATOVA F.S., FAKHRULLINA G.I., GAYAZOVA E.I., NAUMENKO E.A. & FAKHRULLIN R.F. Identification of nanoparticles in the organism of soil nematode Caenorhabditis elegans.
Every year new nanomaterials are used, the detection of which in living organisms is very complicated. The method of hyperspectral analysis is a promising method for visualising nanoparticles. Spectral curves from libraries can be used to classify or automatically identify particles on a hyperspectral image. A free-living soil nematode Caenorhabditis elegans N2 Bristol was chosen as a model for research. Various nanoparticles of natural or artificial origin were used as nanomaterials. As carriers of nanoparticles bacteria Escherichia coli 0P50 was used. Such microorganisms-carriers of nanoparticles will help to penetrate the particles into the body of nematodes. Immobilisation of nanoparticles on microbial cells was carried out by layer-by layer application of oppositely charged polyelectrolytes and particles. Using a dark field hyperspectral microscopy, we visualised nanoparticles in the digestive system of nematodes. We used this type of microscopy to identify silver, gold, magnetic and natural nanoparticles. A spectral database of selected particles has been developed. A method for nanomaterials identification in living systems has also been developed, using the spectral characteristics of nanoparticles (Support: RFBR 17-04-02182-a, performed according to the Russian Government Program of Competitive Growth of Kazan Federal University). - Kazan (Volga Region) Federal University, Kazan, 420008, Russia; e-mail: akhatovaf@gmail.com.
ANIKIEVA L.V. & IESHKO E.P. Nematode parasites of European smelt, Osmerus eperlanus.
Materials on nematodes found in European smelt, Osmerus eperlanus, within its distribution range are being summarised for the first time. Altogether 20 nematode species have been recorded. They are distributed among three orders: Enoplida (2 families, 2 genera, 3 species), Ascaridoidea (1 family, 7 genera, 7 species) and Spirurida (5 families, 10 species). Thirteen species belong to the marine ecological grouping. Smelt act as an intermediate and reservoir host. Definitive hosts are marine mammals (seals) and birds. Members of genera Anisakis, Contracaecum, Hysterothylacium, Porrocaecum, Pseudoterranova and Raphidascaris are pathogenic for humans, fish and other animals. Seven nematode species belong to the freshwater ecological grouping of parasites. Smelt can be a definitive host for freshwater species Pseudocapillaria tomentosa, Pseudocapillaria salvelini, Cystidicola farionis and
Cystidicoloides tenuissima. For Raphidascaris acus and nematodes of the genus Camallanus, smelt serve as an intermediate and reservoir host. The nematode fauna has been analysed for different ecoforms of smelt. The species assemblages and diversity structure of nematodes were found to have features specific to different ecological forms of smelt. - Institute of Biology, Karelian Research Centre, RAS, Petrozavodsk, 185910, Russia; e-mail: anikieva@krc.karelia.ru.
ANIKIEVA L.V., BESPYATOVA L.A. & MATVEEVA E.M. The role of general and specialised mechanisms in the resistance of the nematode Toxascaris leonina, a parasite of carnivorous animals to a changing environment.
There is complex interplay of adaptation mechanisms involved in maintaining the infection of the nematode Toxascaris leonina in free-ranging and captive hosts. In the wild, T. leonina features a complex chorological structure with a wide range of definitive, intermediate and reservoir hosts. In captive hosts, the structure of the parasite population plays a more important role. Prolonged egg production (spanning most of the year), relatively fast development of eggs to invasive stages compared to other ascarid species, and high tolerance of a wide range of temperatures predetermine the polycyclic development and complex structure of the T. leonina population. The main population parameters of T. leonina (abundance, fecundity and size-age structure) depend on the age and condition of the host. The factors supporting the infection are the low immunity level in animals and its low specificity. - Institute of Biology, Karelian Research Centre, RAS, Petrozavodsk, 185910, Russia; e-mail: anikieva@krc.karelia.ru.
CHAIKA C.1, ABAKUMOV E.2 & RYSS A.Y.3 Soil nematode communities in humus of the great cormorant Phalacrocorax carbo sinensis breeding colony.
Nematoda is a phylum with a wide range of habitats and plural trophic roles in the soil food web. Nematodes are increasingly frequently used as the mesofauna indicator of soil environmental changes. Current research is aimed to determine the nematode indicator species in humus layer polluted by the great cormorant waste products, and to compare the nematode communities in inside and outside the bird colony. Soil sampling was done in 2014-2016 along the profile including 8 stations from the Alnus glutinosa forest throughout cormorants breeding colony to the Curonian Lagoon coast. It was revealed that a diversity of free-living soil nematodes in the breeding colony and in the control areas of the Alnus glutinosa forest is represented by 27 species, of which 13 species were found in the humus horizon. In the centre of the colony only five species survive, from which Pelodera strongyloides and Rhabditoides longispina had almost 100% persistence and thus may be used as bioindicators of ornithogenic pollution. It was found that the pathogens of sanitary and veterinary importance, Diploscapter coronata and Pelodera strongyloides, are massive species in the breeding colony territory. Correlation of soil parameters change along profile with nematode number and species diversity has been revealed (Support: RFBR 16-34-00353-mol_a, RFBR 15-34-20844-mol_a_dk, SPSU CAMR Centre, State Academic Program FSR AAAA-A17-117030310322-3). - 1Immanuel Kant Baltic Federal University, Kaliningrad, 236041, Russia; e-mail: KCHaika@kantiana.ru; 2Saint Petersburg State University, Saint Petersburg, 199034, Russia; 3Zoological Institute, RAS, Saint Petersburg, 199034, Russia.
DORONIN-DORGELINSKIY E.A. The analysis of international and national Russian Federation legislation for prevention and fight against trichinosis.
We have analysed the Codes of the health of terrestrial and aquatic animals, Codex Alimentarius FAO/WHO, Guidelines CAC/GL 86-2015, Guidelines FAO/WHO/OIE, Technical regulations of the EAU, Russian Sanitary-epidemiological standards and rules of veterinary-sanitary examination in respect of trichinosis. A biology, classification, identification, distribution and resistance to various factors, diagnostics, veterinary-sanitary examination of carcasses of farm and game animals, control and supervision of risk goods at the border, etc. are described. Differences in the approach of protecting the public from trichinosis was revealed as a result. Thus, the Russian veterinary regulations include all trichinelloscopy with the removal of diseased carcasses. The codes of the OIE, FAO/WHO, Technical regulations of the EAU allow for the possibility of inactivation of Trichinella risk products exposed to high or low temperatures. Given the global distribution of Trichinella, the presence of strains with different resistance, and the fact that expertise for species identification of larvae in carcasses is not available, the probability of its survival is not excluded. In this regard, it is necessary to optimise the current legislation taking into account the localisation, the diagnostic and the stability of the pathogen, according to the latest achievements in Parasitology. -Perm State Agro-Technological University named after Academician D.N. Pryanishnikov, Perm, 614045, Russia; e-mail: dokveter@yandex.ru.
EKINO T.1,2, YOSHIGA T.1,2, TAKEUCHI-KANEKO Y.3 & KANZAKI N.4 Transmission electron microscopic observation of body cuticle structures of phoretic and parasitic stages of Parasitaphelenchinae nematodes.
The nematode cuticle structure is extremely variable, not only among different taxa but also between sexes and across the developmental stages within a species, reflecting its function in adaption. However, the functional morphology of the nematode cuticle is not yet sufficiently understood, largely because of its incredible diversity. In the present study, we obtained primary information on the cuticle structure of phoretic and parasitic stages of Parasitaphelenchinae species and compared the structures in relation to their biological (mostly behavioural) characteristics and phylogenetic context. Their cuticles mainly consisted of three layers, a cortical layer, a median layer and a basal layer. The phoretic stages of Bursaphelenchus spp., isolated from the tracheal systems of longhorn beetles or the elytra of bark beetles, had a thick and striated basal layer, whereas the parasitic stage of Parasitaphelenchus sp., isolated from bark beetle hemocoel, had no striations in the basal layer. This difference probably reflects the peculiar ecological characteristics of the phoretic stage, because a well-developed basal striated layer, composed of very closely linked proteins directly connected to the body wall muscle, is necessary for the phoretic species to be able to seek, enter and depart from host/carrier insects, but is not essential for internal parasites. Phylogenetic relationships inferred from near-full-length small subunit ribosomal RNA gene sequences suggest that the cuticle structures of parasitic species have apomorphic characters concurrent with the evolution of insect parasitism from a phoretic life history. - 1Faculty of Agriculture, Saga University, Saga, 840-8502, Japan; e-mail: t.ekino888@gmail.com; 2The United Graduate School of Agricultural Sciences, Kagoshima University, Kagoshima, 890-8580, Japan; 3Graduate school of Agriculture, Kyoto University, Kyoto, 606-8501, Japan; 4Kansai Research Centre, Forestry and Forest Products Research Institute, Kyoto, 612-0855, Japan.
FEDYAEVA M.A. Diversity of gut epithelium structure in various marine nematode species.
The intestine of all nematodes consists of single-layered epithelium more or less uniform throughout its length. Intestine cells are structured basically similarly in all nematodes but vary in finer details depending on the systematic position and diet of species. The most diverse structure is a glycocalyx cover above the cell apical surface: it varies from almost invisible amorphous to thick complex and multilayered coat in different species. Apical microvilli usually vary in length and density. Parasitic nematodes have widely varying terminal web (fibrillary structure in apical part of the cell): it can be absent for one species and be very dense for another. Spherocrystalles occur in both parasitic and free-living nematode gut cells. Their function is believed to be either digesting or storage of metabolism products. An important detail for understanding metabolism is the type of storage compound. For nematodes, it can be lipid or glycogen. They occur in cells in different proportion depending on conditions of existence (anaerobic or aerobic, respectively) (Support: RFBR 15-04-02597-a). - Biological Faculty, Lomonosov Moscow State University, Moscow, 119991, Russia; e-mail: mariaf92@mail.ru.
FEDYAEVA M.A.1 & PORTNOVA D.A.2 Spatial distribution and taxonomic diversity of nematode community in the Laptev Sea.
The nematode community of the Arctic shelf is still poorly studied. The main goal of this research was to study the spatial distribution and taxonomic diversity of the nematode community along a depth transect in the Laptev Sea. The transect was located from the Lena River delta to shelf of the Laptev Sea. The length of the transect was 550 m, with a depth range of 18 to 91 m. Nine samples were collected by multiple corer (MUC) and Niemisto corer. Nematodes were the most abundant taxon, harpacticoid copepods (excluding nauplii) were the second most abundant. The abundance and taxonomic diversity of meiobenthos and nematodes increases from the Lena River delta to shelf. The analysed data from the Laptev Sea were compared with data from the Kara Sea. A comparison was made to identify the general patterns in the spatial distribution and taxonomic diversity of the nematode community in the two neighbouring Arctic seas (Support: RFBR 14-05-05003-a, RSF 14-17-00681). - biological Faculty, Lomonosov Moscow State University, Moscow, 119991, Russia; e-mail: mariaf92@mail.ru; 2P.P.Shirshov Institute of Oceanology, RAS, Moscow, 117218, Russia.
FEDYAEVA M.A. & TCHESUNOV A.V. Midgut ultrastructure of some White Sea nematode species in connection with their type of feeding and the taxonomy position.
A survey of the intestine structure of marine free-living nematodes was undertaken particularly in order to find an approach to study nematode digestion and diet. Seven species of different taxa and apparently different ways of feeding were collected and fixed for transmission electron microscopy study at the White Sea Biological Station: Bathylaimus sp. (Enoplida, Tripyloididae), Paracanthonchus caecus (Chromadorida, Cyatholaimidae), Halichoanolaimus robustus (Chromadoridae, Selachinematidae), Desmodora communis (Desmodorida, Desmodoridae), Odontophora deconincki
(Araeolaimida, Axonolaimidae), Sabatieria ornata (Araeolaimida, Comesomatidae) and Paramonhystera filamentosa (Mohysterida, Xyalidae) (Support: RFBR 15-04-02597-a). - Biological Faculty, Lomonosov Moscow State University, Moscow, 119991, Russia; e-mail: mariaf92@mail.ru.
FEDYAEVA M.A. & TCHESUNOV A.V. Odontophora deconincki (Areolaimida: Axonolaimidae): fine structure of alimentary tract.
Odontophora deconincki is a common White Sea species living in surface sand layer in the intertidal zone. It can be characterised as an epigrowth-feeder according to the classification of Wieser (1953). The buccal cavity is composed of hemispherical cheilostom and elongated pyramidal trihedral pharyngostom. The cheilostom is armed with six equal claw-like odontia that stick out radially like a flower when the mouth is opened. The pharyngostoma consists of gymnostoma and stegostoma, which are equal in length and scarcely differ in ultrastructure from one another. Diagonal muscles promote opening of mouth. Sparse muscle cells adjacent to basal membrane are found around the pharynx. The midgut consists of six to seven trapezoidal cells on cross section. Spherocrystalls are most peculiar structure in the cells, which apparently are dynamic structures like lysosomes at an early digestive stage. Microvilli are cylindrical. The glycocalyx varies from amorphous to multilamellar, probably due to stage of food digestion (Support: RFBR 15-04-02597-a). - Biological Faculty, Lomonosov Moscow State University, Moscow, 119991, Russia; e-mail: mariaf92@mail.ru.
GANSHCHUK S. V.1, LITVINOV N.A.1 & SIVKOVA T.N.2 The parasitic nematodes of three amphibian species in Kama region of Ural mountains, Russia.
Amphibians play an important role in natural processes as a component of trophic chains providing transmission of different parasites to reptiles, birds and mammals. The aim of this work is the determination of species composition of nematodes and the prevalence of infestation of amphibians in Kama, Ural. A partial helminthological autopsy surveyed 30 grass frogs, 16 lake frogs and 10 grey toads. Collection, fixation and processing of data were performed using standard methods, and the extensiveness (EI) and the intensity of invasion (AI) were determined. Following species of nematodes were detected: Cosmocerca ornata (Dujardin, 1845), Oswaldocruzia goezei (filiformis) Skrjabin & Schulz, 1952 (or Goeze 1782), Strongyloides mirza Singh, 1954, Spauligodon sp. Skrjabin et al., 1960 and Rhabdias sp. Railliet, 1915. All nematodes were adult stages of soil-transmitted helminths. - 1Perm State Humanitarian Pedagogical University, Perm, 614990, Russia; e-mail: ganshchuk@mail.ru; 2Perm State Agro-Technological University named after Academician D.N. Pryanishnikov, Perm, 614045, Russia; e-mail: tatiana-sivkova@yandex.ru.
GAYAZOVA E.I., FAKHRULLINA G.I., AKHATOVA F.S. & FAKHRULLIN R.F. Investigation of the halloysite nanotubes impact on the viability of free-living nematodes Caenorhabditis elegans.
Halloysite nanotubes (HNT) are regarded as one of the most promising natural nanoscale materials. However, no complete investigation of halloysite nanotoxicity using a whole animal model has been performed. The purpose of our work is to examine the nanosafety of halloysite for soil nematodes Caenorhabditis elegans. The comprehensive study of interaction of HNT with the C. elegans is of great importance because these worms are one of the first organisms that may encounter these nanotubes in the polluted soil. For nanoparticle delivery into C. elegans nematodes we used the microbial cells (Escherichia coli) coated with halloysite via the sequential layer-by-layer deposition of polymers. Next, the HNT-coated bacteria are ingested by nematodes as a sole food source. We found that HNT is localised in the alimentary system and does not induce severe toxic effects on nematodes. HNT within the 0.05-1 mg ml-1 concentration range inhibited the body size of the worms, have no significant negative effect on fertility and lifespan of the nematodes (within 16 days). We demonstrated that HNT does not cause the production of active forms of oxygen and does not lead to premature aging of the organism in the form of accumulation of aging-lipofuscin pigment. Low toxicity of halloysite to nematodes suggests that its quickly growing industrial application is likely to be environmentally safe. - Kazan (Volga Region) Federal University, Kazan, 420008, Russia; e-mail: elvirag.gayazova@gmail.com, namaz1000@gmail.com, kazanbio@gmail.com.
GAYAZOVA E.I., FAKHRULLINA G.I., AKHATOVA F.S. & FAKHRULLIN R.F. Investigation of the halloysite nanotubes distribution inside nematodes Caenorhabditis elegans using enhanced dark field microscopy.
Enhanced dark field (EDF) microscopy allows for rapid, simple and effectively visualisation of nanoparticles inside living organisms without any chemical fixation or fluorescent staining. For the direct delivery of halloysite nanotubes (HNT) into C. elegans, we have used nanoparticle-coated Escherichia coli bacteria as a sole food source. EDF microscopy images showed that after 30 min feeding on the nanocoated bacteria HNT mainly concentrated in the
pharynx and the front part of the intestine. After 2 h of feeding, we detected that the HNT were distributed evenly inside the gut of the nematodes, starting from the buccal cavity to the anus with predominant aggregation in the interior bulb and terminal bulb. In the midgut and hindgut areas, HNT were also clearly visible, but less aggregation was observed. Interestingly, some of the individual particles exhibited clearly visible Brownian motion inside the intestine of nematodes. Importantly, the intestine of the nematodes was filled with randomly distributed HNT, whereas no nanoparticles were detected outside the intestines. We did not observe any particles in the vulva, ovaries and inside the uterus or in the embryos. We hypothesise that this effect is due to the relatively large sizes of HNT (up to 1500 nm) if compared with the 50-nm silica detected in ovaries in a previous study (Scharf et al., 2013). - Kazan (Volga Region) Federal University, Kazan, 420008, Russia; e-mail: elvira.gayazova@gmail.com, namaz1000@gmail.com, kazanbio@gmail.com.
GROMOV A.R. & SPIRIDONOV S.E. Intestinal parasitic nematodes of micromammals in the contact zone of rodent species.
The eastern part of Vladimir Region of the Russian Federation is a zone of contact between two species of voles: Microtus rossiaemeridionalis (Ognev, 1924) and Microtus arvalis s. l. It is also a region where two chromosomal forms of Microtus arvalis can be found. The intestinal parasitic nematodes of these two rodent species were studied in Murom and Sudogda administrative districts of the Vladimir Region - the areas situated on both sides of the biogeographical border between two species and intraspecific forms of one of this species. Parasitic nematodes were collected, fixed in ethanol and formalin, and studied with molecular and morphological methods. The representatives of two taxa of parasitic nematodes were found in the studied material: those of the genus Syphacia (Oxyuroidea) and the nematodes of the superfamily Trichostrongyloidea. The partial sequences of mitochondrial gene coxI were studied for the nematodes of both forms with two pair of primers ('Folmer' ones and NEM_COI_F - NEM_COI_R proposed by Malysheva et al., 2016). An examination of cephalic ends of the collected Syphacia females demonstrated the presence of at least two morphologically distinct forms. Phylogenetic analysis of obtained coxI mtDNA sequences was based on the approximately 420 bp long alignment and revealed at least two groups of Syphacia sequences in the material, and confirmed the morphological identification as all the obtained sequences were clustering inside the clade consisting of Syphacia sequences. For the obtained trichostrongylid sequences, the one of H. glareoli from Poland was the most similar one (DQ408634) and these nematodes were primarily identified as belonging to the genus Heligmosomoides. No nucleotide diversity was reported for these trichostrongylid sequences. The sequences of Syphacia nematodes collected on both sides of the host distribution borders differ in 1-3 bp (Support: RFBR 17-04-00095-a). - A.N. Severtsov Institute of Ecology and Evolution, RAS, Moscow, 119071, Russia; e-mail: s_e_spiridonov@rambler.ru.
HATAM G.R., HEIDARI A., FOULAD V. & SADJJADI S.M. Analysis of prevalence of intestinal parasitic infections, in immunocompromised patients with persistent diarrhoea referred to hospitals in Bushehr province of Iran in 2014-2015.
Intestinal parasitic pathogens as causative agents of chronic persistence diarrhoea especially in high-risk patients are one of the important health problem in tropical and subtropical regions. Strongyloidiasis, cryptosporidiasis, isosporiasis and microsporidiasis are listed as the main opportunistic parasitic infections in child and immunodeficient persons. Stool specimens from 201 immunocompromised patients aged 1 to 69-years-old with acute, chronic persistence diarrhoea including HIV/AIDS patients, solid organ transplant recipients, children and patients with malignancies undergoing chemotherapy or bone marrow transplantation were selected from several tertiary care hospitals from August 2014 to October 2015 in Bushehr city, southern part of Iran. The infection rate among protozoal agents was higher than helminthes infection between studied patients with persistent diarrhoea and Giardia lamblia (7.4%), Cryptosporidium parvum (3.9%), Blastocystis hominis (4.9%), Isospora belli (1.5%), E. histolytica/dispar (1%) were detected as the most important protozoa causing diarrhoea in immunocompromised patients. Two types of helminths including one pathogenic nematode: Strongyloides stercoralis with 0.5% and one cestode Hymenolepis nana with 0.5% were detected in our study. Gastrointestinal opportunistic parasitic infections are a universally recognised problem in patients with down-regulation of the immune system. These infections mostly present with diarrhoea, leading to life threatening complications. - Basic Sciences in Infectious Diseases Research Centre, Shiraz University of Medical Sciences, Shiraz, 71348-45794, Iran; e-mail: hatamghr@sums.ac.ir.
IVANOVA E.S. & SPIRIDONOV S.E. Gastropod-associated nematodes of the genus Phasmarhabditis.
Recently, several new species of the genus Phasmarhabditis associated with terrestrial gastropods were described from China, USA, Czech Republic and Italy. Also, a number of undescribed Phasmarhabditis spp. were identified in different locations including Africa and South-East Asia. Such accumulation of morphological and molecular data on
this genus is expected to shed light on the taxonomic status of the genus. The genus Phasmarhabditis has a controversial nomenclature history and, according to the last nomenclature act by Sudhaus (2011), is the junior synonym to Pellioditis, although recent researchers prefer to treat Phasmarhabditis as valid. So far, all phylogenetic analyses conducted showed the presence of a monophyletic clade comprising all known species and strains of Phasmarhabditis (= papillosa group of Pellioditis sensu Sudhaus) while other species of Pellioditis formed a different clade (Nermut' et al., 2016). However, the presence of several sequences of other gastropod-associated nematodes, Angiostoma and Agfa, within the clade containing Phasmarhabditis species and strains prevents the decision on its status (Nermut' et al., 2016; Tandingan de Ley et al., 2016). Discovery of new strains originated from different, phylogenetically distant gastropod hosts will help to resolve the status of Phasmarhabditis. Information on the morphology of the species comprising Phasmarhabditis is limited, with the main diagnostic traits being female shape and gonochoristic or hermaphroditic mode of reproduction thus preventing effective discrimination between species. The use of molecular methods allows species discrimination as well as elucidatation of the Phasmarhabditis status and its relationships with Pellioditis. The discovery of new Phasmarhabditis populations in previously unexplored areas (Russian Caucasus, Vietnam) demonstrates the existence of forms with the 7-10% nucleotide differences of comparable LSU rDNA sequences with described species. The interspecific difference between Phasmarhabditis species is 3.35.8% of LSU rDNA (Tandingan de Ley et al, 2016) (Support: RFBR 17-04-00095-a). - Centre of Parasitology, A.N. Severtsov Institute of Ecology and Evolution, RAS, Moscow, 119071, Russia; e-mail: s_e_spiridonov@rambler.ru.
IVANOVA E.S.1, SPIRIDONOV S.E.1 & DOKUCHAEV N.E.2 A new spirurid parasite from a tundra vole.
A new spirurid parasite was discovered in the duodenum area of a tundra vole, Microtus oeconomus, in the NorthEast of Russia. The rodent is widespread in the Holarctic region and is known to serve as a host to many nematode parasites of several orders and families. Among 10 nematode species recorded for a tundra vole in the North-East of Russia, Russian Far East and Yakutia (Nadtochi, 1966; Gubanov & Fedorov, 1965, 1967; Yudin et al., 1976; Domnich, 1984, 1985), three species were represented by spirurids from Spiruridae family (1 species) and Rictulariidae family (2 species), whilst the new nematode is a representative of yet another family, Acuariidae. The family is generally considered to be bird parasites but members of four genera are known to parasitise mammals. Morphologically, the nematode from a tundra vole reminds the representatives of Antechiniella originated from native mammals in Australia. Molecular analysis of 18S rDNA sequence obtained for the new parasite placed it closest to the acuariid Echinuria borealis from birds (no molecular data for the genus in question were available). The newly discovered nematodes parasitised overwintered animals with the intensity level reaching hundreds of nematodes per animal. The mode of transmission for the new parasite is yet to be elucidated as invertebrate species normally acting as intermediate hosts for acuariid nematodes are absent in a tundra vole diet as it is regarded as strictly vegetarian (Support: RFBR 17-04-00095-a). - 1Centre of Parasitology, A.N. Severtsov Institute of Ecology and Evolution, RAS, Moscow, 119071, Russia; e-mail: elena_s_ivanova@rambler.ru; 2Institute of Biological Problems of the North, FEB RAS, Magadan, 685000, Russia.
KALINKINA D.S., SUSHCHUK A.A. & MATVEEVA E.M. Nematodes in the soil under woody plants of Polar-Alpine Botanical Garden.
The soil nematode fauna under woody plants (8 species) grown in the Polar-Alpine Botanical Garden, located above the Arctic Circle (Murmansk Region: 67°N, 33°E) was investigated. Total soil nematode fauna varied considerably among the investigated trees: from 52 genera only 10 of them were common for all plant species. The highest diversity was noted under Quercus robur and Ulmus glabra, the lowest under Larix sibirica and Acer platanoides. Rare (for North-West of Russia) species of plant-parasitic nematodes such as Cephalenchus leptus, Nagelus leptus, Rotylenchus robustus and Paratrichodorus pachydermus were found. Nematode abundance under the majority of trees had low values (497-1440 ind. (100 g of soil)-1), except F. mandshurica and L. sibirica (5810 and 11111 ind., respectively). Bacterial feeding nematodes were the dominant eco-trophic group in the nematode communities. Fungal feeders and plant-parasitic nematodes (PPN) had usually the second positions. Share of PPN in the soil of biotopes with coniferous trees was lower, than under deciduous ones. Analysis of ecological indices showed that soil nematode communities reflect complex, structured soil food web in the majority of investigated biotopes, except for F. mandshurica, which was assessed as strongly disturbed. In addition, the interesting phenomenon "endotokia matricida" was found for Rhabditis producta in the soil under some trees (Support: RFBR 15-04-07675-a, State Order 0221-2014-0030). -Institute of Biology, Karelian Research Centre, RAS, Petrozavodsk, 185910, Russia; e-mail: kalinkinads@gmail.com.
KERCHEV I.A.1, 2, KRIVETS S.A.2 & RYSS A.Y.3 Associations of parasitic nematodes of Polygraphus proximus Blandf. (Coleoptera: Curculionidae: Scolytinae) in West Siberia.
A survey of 2015-2016 aimed to list the nematode biota in expanding wilt areas of fir Abies sibirica in Tomsk and Kemerovo oblasts, and to reveal the possible pathogens causing wilt. The infected fir trees were populated by bark beetle Polygraphus proximus. In addition to extraction of nematodes from wood, beetles were thoroughly investigated to find the entomophilic nematodes, both ecto- and endoparasites. Among bacterial feeders inhabiting the beetle intestine as commensals, nematodes of the genus Parasitorhabditis (Rhabditidae) are dominant. Under the beetle elytra the myco-phytophagous nematodes belonging to Aphelenchoides (Aphelenchoididae) were common. The species of the genus Cryptaphelenchus were found at coxae of hind legs between abdomen and chest (at dauer juvenile stage) and in haemocoel as adult males and females. Juveniles are able to crawl on dry surfaces due to their hydrophobic surface coat. One of the Cryptaphelenchus species was successfully multiplied in agar culture of the fungus Botrytis cinerea. This fact illustrates the facultative nature of the parasitism of this species in beetle and tree softwood. In the beetle haemocoel the mycophagous nematodes belonging to genera Sychnotylenchus (Anguinidae), Parasitylenchus (Allantonematidae) were found as juveniles and adults. In bark of Abies sibirica the fungal feeders Laimaphelenchus deconincki and L. penardi (Aphelenchoididae) were revealed. In decaying softwood, the bacteriotrophic nematodes of the genera Panagrellus and Panagrolaimus (Panagrolaimidae), Acrostichus (Dipologasteridae) and Cylindrocorpus (Cylindrocorporidae) were detected. Among the species listed above, none may be considered as the possible causative agent of fir wilting. The most common nematodes in samples and insects are Cryptaphylenchus spp.; these nematodes contribute to the secondary wood decomposition due to symbiosis with the saproxylic fungi (Support: RSF 15-1410014, State Academic Program FSR AAAA-A17-117030310322-3). - institute of Systematics and Ecology of Animals, SB RAS, Novosibirsk, 930091, Russia; 2Institute of Monitoring of Climatic and Ecological Systems, SB RAS, Tomsk, 634055, Russia; 3Zoological Institute, RAS, Saint Petersburg, 199034, Russia; e-mail: ikea86@mail.ru, alryss@gmail.com.
KULINICH O.A.1, 2, DRENOVA N.V.1, ARBUZOVA E.N.1, KOZYREVA N.I.2 & MAZURIN E.S.1 Studies of pathogenicity of the bacteria associated with Bursaphelenchus mucronatus and B. xylophilus nematodes.
The studies show that the pine wood nematode, Bursaphelenchus xylophilus, carries bacteria, including pathogen species, which are believed to contribute to the development of pine wilt disease. Based on research of three nematode isolates of B. xylophilus from the USA and Portugal, and 26 isolates of closely-related species of B. mucronatus from different regions of Russia, twenty species of nematode-associated bacteria were identified. The most common bacteria were species of Pseudomonas spp. (frequency of occurrence 96%), Stenotrophomonas (64%), Pantoea (28%), Bacillus (8%), Burkholderia (4%) and Serratia (4%). The occurrence of Pseudomonas fluorescens and P. brenneri bacteria was 52% and 36%, respectively. The goal of the next research was to determine the pathogenicity of the bacterial strains isolated. The pathogenicity of the bacteria strains was determined by hypersensitive reaction to tobacco Nicotiana tabacum leaves. The 50 nematode-associated bacterial strains were tested in laboratory tests. From twenty-four isolates of bacteria in the genus Pseudomonas only four strains induced necrosis on the tobacco leaves. Typical hypersensitivity reactions with necrosis leaf spots were produced by P. fluorescens (65) and Pseudomonas sp. (X 61) strains isolated from B. xylophilus, plus P. fluorescens (M 118) and P. brenneri (M 98) strains from the B. mucronatus population from the Russian Far East. The greenhouse test on pine seedlings of Pinus sylvestris by injection of Pseudomonas and Burkholderia bacteria strains did not show the typical pine wilt disease (Support: RFBR 15-04-07559-a). - 1All-Russian Centre for Plant Quarantine, Bykovo, Moscow Region, 140150, Russia; 2Centre of Parasitology, A.N. Severtsov Institute of Ecology and Evolution, RAS, Moscow, 119071, Russia; e-mail: okulinich@mail.ru.
KULINICH O.A.1, 2, SHCHUKOVSKAYA A.G.1, ARBUZOVA E.N.1 & KOZYREVA N.I.2 Wood packaging materials as a pathway of the pine wood nematode Bursaphelenchus xylophilus.
Wood packaging material is a pathway of quarantine pest introduction from one country to another. It is considered that the pine wood nematode, Bursaphelenchus xylophilus, was introduced to Portugal and China by this pathway. In case of further distribution of B. xylophilus in Europe and absence of monitoring of this pathogen the estimated annual losses may amount to 3 billion euros for the EU forestry and from 47 to 112 billion rubles for the Russian Federation. The 2014-2016 data on detection of the pine wood nematode B. xylophilus in wood packaging material of consignments from Europe have been analysed. For the last three years, B. xylophilus has been detected in wood packaging material by inspectors of plant quarantine services of France (12 times), Finland (2 times), Cyprus (1 time), Austria (1 time) and United Kingdom (1 time). The nematodes were mainly found in the packaging of consignments from the countries where B. xylophilus occur (China, Portugal, USA). Records of B. xylophilus in the consignments from Vietnam are of interest. It is officially considered that B. xylophilus is absent in this country. There are no records of B. xylophilus in
the consignments from Russia, but there are some data concerning detection of closely-related species B. mucronatus. Usually, the packaging infested by the nematodes is subjected to incineration and burning. - 1All-Russian Centre for Plant Quarantine, Bykovo, Moscow Region, 140150, Russia; 2Centre of Parasitology, A.N. Severtsov Institute of Ecology and Evolution, RAS, Moscow, 119071, Russia; e-mail: okulinich@mail.ru.
KUZNETSOV D.N.1, 2, AKSYONOV A.P.1, ROMASHOV B.V.3 & ROMASHOVA N.B.4 Nematodes parasitising in the European roe deer (Capreolus capreolus) in Russia.
Roe deer (Capreolus capreolus Linnaeus, 1758) is one of the most abundant species among the wild ruminants in Europe. At the same time, data on the taxonomic composition of helminths parasitising roe deer are still insufficient. The goal of the present study was to enrich the data on the species composition of nematodes parasitising C. capreolus. Eight roe deer of different ages were obtained during licensed hunting in Ryazan, Tver and Voronezh regions. The samples of nematodes were collected during helminthological dissections of the abomasa and thin intestines. Ostertagia ostertagi, Teladorsagia circumcincta, Mazamastrongylus dagestanica, Trichostrongylus axei, T. colubriformis and T. vitrinus were registered in Ryazan Region. Ostertagia leptospicularis, Ostertagia antipini, Spiculopteragia asymmetrica, Ashworthius sidemi, Bunostomum trigonocephalum, Chabertia ovina, Nematodirus filicollis and Trichostrongylus capricola were detected in Tver Region. Ostertagia leptospicularis, O. antipini, S. asymmetrica, M. dagestanica, B. trigonocephalum and N. filicollis were found in Voronezh Region. Thus, there was a fairly significant species diversity of gastrointestinal nematodes in roe deer. This is the first detection of a blood-sucking, highly pathogenic nematode A. sidemi in the European roe deer in the territory of Russia. - 1Centre of Parasitology, A.N. Severtsov Institute of Ecology and Evolution, RAS, Moscow, 119071, Russia; e-mail: dkuznetsov@mail.ru; 2All-Russian Scientific Research Institute of Fundamental and Applied Parasitology of Animals and Plants named after K.I. Skryabin, Moscow, 117292, Russia; 3Voronezh State Agricultural University, Voronezh, 394087, Russia; 4Voronezhsky State Nature Biosphere Reserve named after V. Peskov, Voronezh, 394080, Russia.
LAVROVA V.V., VASIL'EVA O.B., MATVEEVA E.M. & KALINKINA D.S. The lipid content and fatty acid composition of cysts and juveniles of Globodera rostochiensis developed in the roots of temperature-primed plant hosts.
The lipid content and fatty acid composition of cysts filled by juveniles and eggs of Globodera rostochiensis developed in the roots of DROP-treated (temperature drop from +23 to +5°C for 2 h at the end of the night for 6 days) potato plants were investigated. Lipid composition of cysts was similar to those from control plants (susceptible non-treated plants), whereas the amount of lipid components was different. Cysts developed in DROP-treated potato roots had reduced content of triacylglycerols and phospholipids and increased amounts of steroid components compared with controls. The fatty acid profile of these cysts was characterised by increased content of saturated fatty acids (mainly due to 16:0) and polyunsaturated fatty acids of the n-3 family (mainly due to 18:3), and reduced level of monounsaturated fatty acids (16:1, 18:1), with the exception of 20:1. It should be noted the lower level of polyunsaturated fatty acid of the n-6 family such as 18:2 (n-6). Thus, the lipid profile of cysts indicates that change of plant physiological state after DROP-treatment negatively influenced on viability and infectivity of new generation of the nematode (Support: RFBR 16-34-00650-mol_a, State Orders 0221-2014-0004 and 0221-2014-0030). - Institute of Biology, Karelian Research Centre, RAS, Petrozavodsk, 185910, Russia; e-mail: victoria.v.lavrova@gmail.com.
LAVROVA V.V.1, UDALOVA ZH.V.2, ZINOVIEVA S.V.2 & MATVEEVA E.M.1 An effect of salicylic and jasmonic acids on the expression of pathogenesis-related genes in tomato plants infected with root-knot nematode.
The expression of PR1 and PR6 genes in roots of salicylic and jasmonic acid (SA/JA)-treated tomato plants during Meloidogyne incognita invasion was investigated. Results have shown that PR1 and PR6 genes are expressed at low level in the roots of susceptible plants at the pre-invasion stage. Nematode infestation of these plants had no significant effect on gene activity. However, dynamics of gene expression in SA/JA-treated plants were different. Exogenous SA-treatment of tomato plants increased the level of PR1 gene expression at pre-invasion stage. Nematode infestation of these plants was accompanied by significant rise of the accumulation of PR1 gene transcripts with a maximum by the 18th day. Other aspects were observed for JA-treated plants. Exogenous JA-treatment of tomato plants enhanced the expression of PR6 gene at pre-invasion stage and during nematode invasion by 7th day, after which the level of the gene expression reduced. Thus, results indicate that exogenous treatments can modulate expression of pathogenesis-related genes that contribute to the formation of induced resistance to root-knot nematode in the susceptible plants. It should be noted that changes in gene expression are dependent on a type of inductors (SA or JA). Probably it is connected with the fact that SA and JA are involved in different signalling pathways (Support: RFBR 15-04-04625-a). - institute of Biology, Karelian Research Centre, RAS, Petrozavodsk, 185910, Russia; e-mail: victoria.v.lavrova@gmail.com; 2Centre of Parasitology, A.N. Severtsov Institute of Ecology and Evolution, RAS, Moscow, 119071, Russia.
LAVROVA T.V. Vertical diurnal distribution of crustacean zooplankton in shallow Lake Velikoe (Nizny Novgorod Region).
Diurnal vertical distribution of zooplankton in the freshwater Lake Velikoe (Arzamas district, Nizhny Novgorod Region) was investigated in July 2015. Samples were taken at five depths from the surface to the bottom four times a day. It is shown that maximal abundance of zooplankton is in deeper strata at noon - in 1.5 m from the lake bottom (at a depth of 3.5 m), and is closer to a surface at night - at a depth of 1 m. This trend distribution is common for zooplankton. Morning migration to deep aphotic waters has a protective function, whereas evening migration to shallow waters is associated with a grazing function. This tendency is clearly shown for crustacean general abundance. However, the pattern of vertical distribution of separate species and stages is ambiguous. It was shown that only single species - Daphnia cucullata - follow the described trend clearly. The rest can be divided into two groups by the type of distribution. The first group form maximal aggregation in shallow waters at night but do not reach the upper strata (1.5 m depth). At noon, the maximal abundances are found at the middle of the water column (on the lower boundary of the euphotic zone). This type of migration within 1 m strata can be construed as an economical version of classical picture. The second group of species migrate upward at noon and downward at night. These are small-sized species feeding on phytoplankton and their high abundances in the euphotic zone correlates with the concentration of algae. - Institute of Biology and Biomedicine, N.I. Lobachevsky State University of Nizhny Novgorod, Nizhny Novgorod, 603950, Russia; e-mail: tlav@mail.ru.
LAZAREVA O.I. An effect of Anisakis simplex extracts on the tissues of multicellular organisms.
There is evidence that many helminths and their metabolites damage tissue of the host organism. The aim of our work was to study the effect of extract from Anisakis simplex larvae on the morphology and ultrastructure of tissues of mammals, as well as to the histogenesis in, for example, chicken embryos. As a result of this work, it was found that the toxic influence of A. simplex somatic extract caused dyscirculatory processes and degenerative changes, which indicate perturbation of metabolism at the cellular level. Testes cells were in a state of widespread desquamation, disorganisation, and hydropic dystrophy. The ultramicroscopic study revealed destruction of the cytoplasm of germ cells, and the output of the organelles. The main changes recorded at the level of mitochondria were the disintegration of cristae and the clearing out of the mitochondrial matrix. In the spleen of mice congestion of the red pulp and macrophage reaction was marked. The appearance of immunocompetent cells (lymphocytes and histiocytes) in the tissues is explained by the antigenic action of the extract. In the tissues of chicken embryos degenerative changes developed, including impaired blood circulation and weakened hematopoiesis, and lymphocytic infiltrates were formed. Morphological changes caused by somatic extract are like effects from live helminth larvae. - Perm State Agro-Technological University named after Academician D.N. Pryanishnikov, Perm, 614045, Russia; e-mail: ol.manina@yandex.ru.
LEBEDINSKII A.A. Nematode infestation in European common frog (Rana temporaria) and moor frog (R. arvalis), and its particular characteristics under the conditions of anthropogenic influences.
This work is based upon long-term data, collected since 1979 within urbanised areas of the city of Nizhny Novgorod, as well as in various regions of the European Russia - in Nizhny Novgorod Region, Leningrad Region and the Republic of Karelia. The data were sampled from populations under anthropogenic influences, as well as from control populations in pristine natural conditions. The frogs were dissected for complete helminthological analysis. In addition, the size-age parameters of the hosts were recorded, as well as their colour phenotype polymorphism (Ishchenko, 1978) in the upper and lower body section. In total, four species of mature stage nematodes were found in the two host species studied. It was shown that under conditions of strong anthropogenic influences the level of nematode infestation increased. A connection was discovered between the traits of nematode infestation and certain phenotypical characteristics of the hosts, in particular the lower levels of infestation with Rhabdias bufonis (Schrank, 1788) and Oswaldocruzia filiformis (Goeze, 1782) in moor frogs with 'hemimaculata' phenotype under the conditions of intense urbanisation. Of all nematode species, Cosmocerca ornata (Dujardin, 1845) was found to be the most influenced by the anthropogenic factors. - Institute of Biology and Biomedicine, N.I. Lobachevsky State University of Nizhny Novgorod, Nizhny Novgorod, 603950, Russia; e-mail: leb-nn@yandex.ru.
LYCHAGINA S.V.1, BUGAEVA L.N.2 & SLABODNYUK G.A.2 Root-knot nematodes in vegetable crops of Lazarevskaya experimental plant protection station.
Root-knot nematodes Meloidogyne Goldi, 1892 are obligate endoparasites of plant root system, and have significant economic importance in some geographic zones (Karssen, 2002). Root-knot samples were taken from cucumber, parsley and tomato plants on shelves in a greenhouse and in open ground of Lazarevskaya experimental plant protection
station. The oviposition in both greenhouse and open ground nematodes initiates, when female nematodes are extracted from root knots. The identification of species was carried out using sections of anal-vulvar sheets of mature females. The majority of identified female nematodes belong to the species M. incognita. Interestingly, the females of M. javanica were also recorded. Thus, two species of Meloidogyne were reported: M. incognita as a prevalent species in greenhouse and M. javanica as less frequent one- 1All-Russian Scientific Research Institute of Fundamental and Applied Parasitology of Animals and Plants named after K.I. Skryabin, Moscow, 117292, Russia; e-mail: lychagina-svetlana@rambler.ru; 2Lazarevskaya Experimental Station of Plant Protection, All-Russian Research Institute of Biological Plant Protection, Sochi, 354200, Russia; e-mail: bugaevaln@mail.ru.
MATVEEVA E.M., SUSHCHUK A.A., KALINKINA D.S., YURKEVICH M.G. & SIDOROVA V.A. Long-term changes of soil profile, plant communities and soil nematode fauna in northern meadows (Republic of Karelia, Russia).
Changes in plant communities, soil profile and soil nematode fauna of two meadows were estimated. The meadows had obviously different vegetation during secondary succession after the land had not been cultivated for over 50 years. Analysis of soil profiles showed that thickness of arable layer and root penetration zone either increased (site 1) or decreased (site 2 that was never ploughed). The composition of plant community changed from Agrostetum poacoso-leguminoso-mixtoherbosum to Dactylisetum poacoso-mixtoherbosum (site 1), and from Carexetum nigrais rostratis to Filipenduletum (site 2). In spite of considerable changes in plant composition the abundance and eco-trophic structure of nematode communities remained similar. However, on the site 2 the bacterial feeders were less numerous, and omnivores and predators increased in numbers. The main changes of nematode fauna in the long-term succession were related with shifts of dominant genera: highly abundant Prismatolaimus (sites 1 and 2) was replaced by Eucephalobus (site 1) and Aglenchus, Acrobeloides (site 2). Thus, vegetation cover and features of soil conditions determined the multidirectional character of long-term changes during ecosystem restorations. In site 2 with high soil moisture level the nematode community associated with forest soils was established. Nematode community on site 1 maintained (over 50 years) the structure that was typical for sown meadows of South Karelia (Support: RFBR 15-04-07675-a, State Orders 0221-2014-0030 and 0221-2015-0006). - Institute of Biology, Karelian Research Centre, RAS, Petrozavodsk, 185910, Russia; e-mail: matveeva@krc.karelia.ru.
MIGUNOVA V.D.1, TABOLIN S.B.1,2, STRANISHEVSKAYA E.P.3, MATVEYKINA E.A.3, VOLKOV Y.A.3, VOLODIN V.A.3 & KONRAT A.N.1 Plant-parasitic nematodes associated with grapevines in Crimea.
In the last several years, the area under vines in Crimea has considerably increased. Previously plant-parasitic nematodes, Xiphinema brevicolle, X. diversicaudatum, X. index, X. vuittenezi, X. vineacola, Longidorus elongatus, L. attenuatus and L. macrosoma were identified from the rhizosphere of grapes of this region. These data suggested that populations of the above-mentioned species may be present at damaging levels in some Crimean vineyards. For this reason, the purpose of this work was to study soil nematode fauna in the rhizosphere of grapes of the peninsula. Plants and soil samples were collected in seven farmyards in three regions of Crimea (Yalta, Sevastopol, Bakhchysarai) in spring 2016. Nematodes were extracted from soil using two methods: the Baermann funnel method and Flegg's decanting and sieving method. Then the nematodes were killed by applying gentle heat, fixed in 5% formalin solution and mounted in glycerin slides using Seinhorst technique. Nine species of plant-parasitic nematodes were found associated with grapevines in south of the Crimean Peninsula: Xiphinema pachtaicum, X. index, Rotylenchus fallorobustus, Helicotylenchus digonicus, H. vulgaris, Zygotylenchus guevarai, Tylenchorhynchus dubius, Paratylenchus microdorus and Criconemoides morgensis. The most commonly encountered plant-parasitic nematodes were Helicotylenchus spp. and Xiphinema pachtaicum. - 1All-Russian Scientific Research Institute of Fundamental and Applied Parasitology of Animals and Plants named after K.I. Skryabin, Moscow, 117292, Russia; e-mail: barbarusha@rambler.ru; 2Centre of Parasitology, A.N. Severtsov Institute of Ecology and Evolution, RAS, Moscow, 119071, Russia; 3All-Russian National Research Institute of Viticulture and Winemaking "Magarach", RAS, Yalta, 298600, Russia.
MOKROUSOV M.V. Digger wasps (Hymenoptera: Crabronidae) of sandy deserts in the Southeast of European Russia.
Sandy deserts with movable poorly fixed sands occupy small highly fragmented areas in the Southeast of European Russia including Volgograd and Astrakhan regions, Kalmykia and northern Dagestan. Many of the habitats have anthropogenic origin. The role of these sites in the formation of digger wasp fauna is very high. During my 2010-2016 survey 96 species (30.6%) were detected at sand biotopes from 314 known for the region; of them 42 species (13.4%) are associated only with sands. The revealed Crabronidae fauna is a part of the desert associations of Kazakhstan and
Central Asia. The sand deserts species were attributed to six biogeographic groups: Mediterranean (Tethyan) species -39 (40.6%); Iranian-Turanian - 25 (20%); Southern Trans-Palaearctic, South-Western-Palaearctic and Eastern-Mediterranean - 9 (9.3% each); Holarctic - 3 species (3.1%). The most xerophilous are: Ammoplanellus chorasmius Guss., Belomicrus corniger Kaz., B. tricolor Kaz., Cerceris angelica Kaz., C. errata Shest., C. vitticollis F. Mor., Crabro pubens Marsh., Eremiasphecium bicolor Guss., E. desertorum Guss., Miscophus gussakovskiji de Andrade, M. tricolor Kaz., Parapiagetia kaszabi Tsun., Philanthus desertorum F. Mor., Prosopigastra globiceps F. Mor., P. latifrons Guss., Pseudoscolia corporica Kaz., P. fronticalis Kaz., Solierella zimini Guss., Tachysphex argentatus Guss., T. erythropus Spin., T. gussakovskii Pul., T. micans Rad. and T. schmiedeknechti Kohl (Support: RFBR 16-54-00041-Bel_a). - Research Botanical Garden, N.I. Lobachevsky State University of Nizhny Novgorod, Nizhny Novgorod, 603950, Russia; e-mail: sphecid@inbox.ru.
NGUYEN D.T.1, NGUYEN T.X.PH.1, NGUYEN V.T.1 & PHAN K.L.2 A comparative analysis of marine nematode community in different mangrove areas in Viet Nam.
The free-living marine nematodes from mangrove areas were investigated in 2016. Five stations in Tien Yen mangrove (Quang Ninh province), four stations in Ba Lat (Nam Dinh province) and 3 stations in Can Gio (Ho Chi Minh city) were established and triplicate samples in each station were randomly taken for nematode assemblages. The average of nematode densities varied between 151 ± 28 ind. (10 cm 2)-1 (TY5) and 1386 ± 178 ind. (10cm2)-1 illustrating the strong variability. In total 161 nematode species were recorded in this area belonging to 23 families of 7 orders (Enoplida, Chromadorida, Desmodorida, Desmoscolecida, Plectida, Monhysterida and Aerolaimida). The family Xyalidae has the highest number of species (25), followed by the family Linhomoeidae (8), whereas the family Selechinematidae has the lowest number of species with only one. Four species, Dichromadora affinis, Parodontophora fluviatilis, Paracanthonchus sp. and Trissonchulus sp., were present in all zones. By contrast, some other species were only present with high abundances in zone 1, for instance Spilophorella bidentata and Sphaerolaimus maeoticus. The three species as Terschellingia longicaudata, Linhystera sp., Diplolaimelloides elegans had the highest abundance in zone 2 and Dichromadora affinis, Desmodora vietnamica had the highest abundance in zone 4. Based on MultiDimensional Scaling (MDS) analysis, at 10% level, four stations in zone 2 and 3 stations in zone 4 were separated in one group with five stations in zone 1. - 1Institute of Ecology and Biological Resources, VAST, Hanoi, Vietnam; email: ngdtu@yahoo.com; 2Vietnam National Museum of Nature, VAST, Hanoi, Vietnam.
NGUYEN T.A.D.1, 2, REIZE M.2, VOSS C.2 & BONKOWSKI M.2 Comparison of the nematode community structure in litter and soil layer of Cao Bang (Viet Nam) at different land use intensities.
Increasing land-use intensity has likely strong impacts on soil biodiversity and fertility in the tropics. Nematodes are known to respond rapidly to soil disturbance and changing resources. Therefore, the functional composition of the nematode community offers a reliable measure for the biological assessment of the quality and functioning of tropical soils. In Cao Bang we investigated the diversity of soil nematode communities at twenty four sites with two layers: mineral soil and litter. To analyse how local land management interferes with species richness, the soil samples have been taken along gradients of increasing land-use intensity: i) primary rain forest, ii) secondary forest, iii) slash and burn agriculture/casava, iv) intensive agriculture, to investigate changes in nematode community composition, soil carbon storage and nutrient cycling. Land-use intensity had general and distinct impacts on the functional composition and food web structure of nematodes. Indicators of these changes, such as the Maturity Index, Channel Index or Plant Parasitic Index will be correlated to and discussed in relation to changes in soil carbon and nutrient levels. - institute of Ecology and Biological Resources, VAST, Hanoi, Vietnam; e-mail: nad2807@yahoo.com; 2Institute for Zoology, Department of Terrestrial Ecology, University of Cologne, Koln, 50674, Germany.
NGUYEN T.X.PH.1, PHAM T.M.1, NGUYEN D.T.1 & KLEIN J.C.2 Free-living nematode communities in mangroves subject to clear cutting activities in Xuan Thuy National Park, Viet Nam.
Diversity and community structure of free-living nematodes have been investigated in mangroves worldwide and it is recognised that the type of biotope is the main determinant of the diversity. The free-living nematode communities in mangroves of the Xuan Thuy National Park, the first Ramsar site in Southeast Asia, were investigated in March 2014 to understand the differences in biodiversity patterns of two different mangrove areas, clearcutting and unaffected mangroves after the Son Tinh Typhoon (2012). In each area, two stations were established (XT1 and XT2 in cutting area, XT3 and XT4 in unaffected area). The estimates of nematode densities and biodiversity were calculated. The abundant families and species were determined to understand the different dominant taxa between two areas. Multivariate analyses were used to reveal the significant differences of species patterns between clearcutting and unaffected mangroves areas in relation to their grain size composition and indicate which species were responsible for
the different patterns. (Support: FWO.106-NN.2015.04, JEAI EFESE project) - institute of Ecology and Biological Resources, VAST, Hanoi, Vietnam; e-mail: ntxphuong.iebr@gmail.com; 2Institute of Research for Development, UMR MARBEC, Marseille, 13572 CEDEX 02, France.
NIKONOROVA I.A. & BUGMYRIN S.V. Nematode fauna of common shrew (Sorex araneus) in Europe.
The common shrew Sorex araneus Linnaeus, 1758 (Insectivora: Soricidae) is one of the most numerous and widespread species of small mammals. The aim of the study was the synthesis of information on the nematode species composition of S. araneus in the European part of the range, and a comparative analysis of local populations. Nematode fauna of the common shrew is characterised by high species diversity, in Europe 34 species belonging to 6 orders and 16 families have been recorded. About 60% of nematodes belong to Palearctic faunistic complex, 23% - cosmopolitans, 16% - holarctic species. Parasitic nematodes of S. araneus are characterised by the diversity of life cycles; common shrew is the definitive host for 22 nematode species, among which 16 species - geohelminthes with a simple development cycle, other species - biohelminthes where infection occurs by eating intermediate hosts, mainly earthworms. In the larval stage in S. araneus 12 species of nematodes were noted. The most widespread species of the family Capillariidae (Aonchotheca kutori, Eucoleus oesophagicola and Heligmosomidae (Longistriata didas and L. codrus), are parasites with a simple development cycle. The comparative analysis of S. araneus helminths in European part of the area showed a high originality of the local component of parasitic communities. - Institute of Biology, Karelian Research Centre, RAS, Petrozavodsk, 185910, Russia; e-mail: nikonnira@mail.ru.
OCAL A.1, TOKTAY H.2, TAN A.3 & ELEKCIOGLU H.4 Plant parasitic nematodes associated with persimmon (Diospyros kaki) and pomegranate (Punica granatum) growing areas in Adiyaman Province, Turkey.
In this study, plant-parasitic nematode species in Persimmon (Diospyros kaki) and Pomegranate (Punica granatum) growing areas in Adiyaman province were examined faunistically and taxonomically. When adult nematodes are more abundant, 21 soil and plant root samples from Persimmon growing areas and 34 soil and plant root samples from Pomegranate growing areas were taken during June and September in 2012-2014 and nematode samples were extracted, prepared and identified. As a result of this study plant-parasitic nematode specimens were determined of which species were placed in superfamilies of Tylenchoidea, Dolichodoroidea, Anguinoidea, Aphelenchoidea, Hoplolaimoidea and Longidoridea, and of Tylenchida, Aphelenchida and Dorylaimida orders. The species encountered most in this study are Helicotylenchus varicaudatus, Ditylenchus myceliophagus and Filenchus cylindricauda in persimmon growing areas, and Helicotylenchus digonicus, Xiphinema pachtaicum and Aphelenchus avenae in Pomegranate growing areas. No records exist in the literature about the presence of plant-parasitic nematodes in Persimmon and Pomegranate growing areas in Adiyaman province. - 1Ataturk Horticultural Central Research Institute, Yalova, 77100, Turkey; e-mail: atilla_ocal@hotmail.com; 2Faculty of Agricultural Sciences and Technologies, Omer Halisdemir University, Nigde, 51240, Turkey; 3Sakarya Universitesi Pamukova Meslek Yuksekokulu, Sakarya, 54900, Turkey; 4Faculty of Agriculture, University of Qukurova, Adana, 01330, Turkey.
ODOYEVSKAYA I.M.1, SERYODKIN I.V.2 & SPIRIDONOV S.E.3 Molecular characterisation of Trichinella pseudospiralis isolated from leopard cat (Prionailurus bengalensis) in Sikhote-Alin Nature Reserve.
The muscular tissue samples were collected from the corpses of several leopard cats found in autumn-spring period on the territory of the Sikhote-Alin nature reserve. These samples were transported to All-Russian Institute for Fundamental and Applied Parasitology of Animals and Plants. Muscle tissue biopsy was used to detect Trichinella juveniles. Small pieces (20-50 g) of muscles with encysted Trichinella juveniles were ground and then digested in the artificial gastric juice. Obtained juveniles were twice washed in physiological saline. DNA was extracted from 5-20 juveniles with Proteinase K digestion. Partial sequences of CoxI mtDNA gene were obtained with primers 37F_Tri GCAGTAAATTTAGAATTTAAAC and 42R_Tri CCTAATATTCATGGTGTTCATA. Obtained sequences were compared with corresponding parts of the complete mitochondrial genomes or deposited partial sequences of this gene. Obtained 1320 bp long sequence was found to be 100% identical to those from three Trichinella pseudospiralis strains: ISS13 (KM357408); ISS588, (KM357409); ISS176 (KM357410). These strains originated from the following hosts: raccoon (Russia), brown rat (Russia) and tawny eagle (Kazakhstan). As no complete CoxI mtDNA sequence is available for strain ISS141, the analysis of all available six samples was based on 420 bp long alignment. Significant differences (25 bp or 6%) was observed between four Russian-Kazakhstan strains and strain ISS470 (KM357411) from a black vulture from the United States. The sequence of the strain ISS141 (EF601545) from spotted quoll from Australia differed in 8 bp (2%). The existence of different haplotypes in the species T. pseudospiralis can be used in the studies of possible transfer of these parasites by birds (Support: RSF 14-16-00026). - 1All-Russian Scientific Research Institute of Fundamental and Applied Parasitology of Animals and Plants named after K.I. Skryabin, Moscow, 117292,
Russia; e-mail: odoevskayaim@rambler.ru; 2Pacific Geographical Institute, FEB RAS, Vladivostok, 690041, Russia; 3Centre of Parasitology, A.N. Severtsov Institute of Ecology and Evolution, RAS, Moscow, 119071, Russia.
PANOVA O.A. & KHRUSTALEV A.V. Development peculiarities of Toxocara canis and T. cati larval stages in eggs.
The details of early development in Toxocara remain poorly understood; particularly the number of moults is still debated. In this research we observed the development process and studied the morphology of egg stage larvae of Toxocara canis and T. cati. In both species two moults were definitely marked. At +25°C in the eggs of T. canis on the 5th day we observed the stage of 'pre-larvae' ('tadpole' stage), and on the 6th day the larvae began to move. The first moult was on the 9th day, the second on the 11th day. The development of T. cati in egg takes longer. The pre-larvae stage was marked on the 8th day, the larvae began moving on the 10th day. The first moult occurred on the 13th day, the second on the 20th day. In both species occurrence of the first moult was barely noticeable. The second moult is clearly manifested by the formation of the cuticular sheath. In T. cati this sheath permanently remains on the body of larvae. In T. canis larvae discard the sheath a few days after moulting. The morphometry of invasive larvae of Toxocara revealed the statistically significant difference in species in the width (diameter) of larvae. The width of T. canis larvae was 1820 ^m, and T. cati 14-16 ^m. A characteristic morphological feature of invasive larvae of T. canis is a peculiar dorsal bend of the caudal end, which is absent in T. cati. The described differences in morphology of the third larval stage may be useful for species differentiation of eggs, as well as for identification of larvae localised in the tissues of paratenic hosts, including larva migrans in humans (Support: RSF 14-16-00026). - All-Russian Scientific Research Institute of Fundamental and Applied Parasitology of Animals and Plants named after K.I. Skryabin, Moscow, 117292, Russia; e-mail: 79161971494@yandex.ru, akhrustalev@yandex.ru.
PRIDANNIKOV M.V., NIKITIN M.M., STATSYUK N.V., FRANTSUZOV P.A. & GOLIKOV A.G. Use of a microchip-based Q-PCR for molecular diagnostics of potato cyst nematodes.
Potato is very important culture for the economics of the Russian Federation. Since 2008, Russia takes the 3d place in a worldwide potato production (33.6 Mtons). However, the annual potato production in Russia is only 22 t ha-1, which is significantly lower than in Europe (29-30 t ha-1) or North America (34 t ha-1) and is caused by a difference in the applied agrotechnologies and a poor quality of seed material often infected by various pathogens, including plant-parasitic nematodes. Rapid and accurate diagnostics of plant diseases is very important to prevent the spread of infection and significant yield losses. A real-time multiplex PCR technology was developed for simultaneous diagnostics of two potato cyst nematodes, Globodera rostochiensis and G. pallida, using a disposable long-stored microchip. Laboratory trials showed an excellent diagnostic efficiency and specificity of both test systems with a detection limit equal to 10 and 100 DNA copies for G. rostochiensis and G. pallida, respectively. A small reaction volume (~1 ^l) reduced both amplification time to 20-30 min and reagent costs, whereas a special technology of preparation of disposable ready-to-use microchips increased their lifetime up to 6 months at a room temperature and reduced the number of required manipulations. The developed test system has a good potential for rapid field diagnostics in the case of a low pathogen concentration in plant tissues or soil (Support: RSF 16-16-04109). - All-Russian Research Institute of Phytopathology, Bolshie Vyazyomy, Moscow Region, 143050, Russia; e-mail: mikhail.pridannikov@yahoo.com.
PRIDANNIKOV M.V. & PEREVERTIN K.A. Modern challenges of agricultural nematology in Russia.
The agricultural sector of the economy of the Russian Federation has increased dramatically over the last ten years. Many middle-sized agriculture companies and big holdings use modern technologies for growing various crops and for plant protection against phytoparasitic microorganisms. They can choose necessary agrochemicals from an extensive list of market pesticides. This minimises yield losses due to the influence of phytopathogen fungi, insects and weeds. But there is an 'other side of the coin'; most farmers or agro producers do not take into account some hidden pathogens, such as plant-parasitic nematodes. The results of interviews with some agro producers during 2014-2016 showed an awareness of problems caused by plant-parasitic nematodes, especially by cyst and stem nematodes. Unfortunately, the actual information about distribution of plant-parasitic nematodes on fields in various regions of Russia is not available. The Russian pesticide market cannot offer any officially registered nematicides if nematode infection was discovered in a field or affected yield. All of this results in a contradictory situation: the one side - nematode problems in agriculture progress to the extreme situation without control; the other side - there is no official government programme for nematode management. (Support: FASO Russia 0109-2014-0030). - Centre of Parasitology, A.N. Severtsov Institute of Ecology and Evolution, RAS, Moscow, 119071, Russia; e-mail: mikhail.pridannikov@yahoo.com.
RASHIDIFARD M.1, FOURIE H.1, DANEEL M.2, SHOKOOHI E.1 & MARAIS M.3 Comparison of CoxI and Nadh5 mitochondrial DNA data for identification of South African Meloidogyne populations.
A survey conducted in the Mpumalanga Province resulted in 17 Meloidogyne populations being collected from roots of guava, pumpkin, tomato and weeds. Species were determined by means of morphological and molecular techniques, resulting in identification of the predominant M. enterolobii, followed by M. incognita and M. javanica. Morphological data suggested that 16 of the populations contained M. enterolobii, either as single or mixed species. The perineal patterns of these populations showed great intraspecific variation, making accurate identification of M. enterolobii difficult using only this approach. Molecular data generated for the 17 Meloidogyne populations based on NADH5 mtDNA sequences placed M. incognita and M. javanica in separate clades together with their respective peers obtained from GenBank. Phylogenetic analysis based on of COI mtDNA results placed all M. enterolobii in a well-supported clade (99% bootstrap values) with sequences of the same species obtained from GenBank. Sequences obtained for M. javanica clustered in the same clade with sequences of M. javanica, M. incognita and M. arenaria extracted from Genbank. Phylogenetic analysis according toNADH5 sequences placed all M. enterolobii sequences together with sequences of the same species obtained from GenBank. Sequences generated for M. incognita and M. javanica grouped in separate sub clades, together with their respective peers' sequences from Genbank. According to this study, the NADH5 technique proved to be more specific and accurate in characterising and distinguishing Meloidogyne spp. especially between M. incognita and M. javanica, which was not true for the COI gene. - 1Unit for Environmental Sciences and Management, North-West University, Potchefstroom, 2520, South Africa; e-mail: 27216179@nwu.ac.za; 2Agriculture Research Council - Institute for Tropical and Subtropical Crops, Nelspruit, 1200, South Africa; 3Agriculture Research Council - Plant Protection Research Institute, Pretoria, 0121, South Africa.
ROMANENKO N.D.1, POPOVA E.N.2, 3, TABOLIN S.B.1 & POPOV I.O.3 The faunistic list of nematodes of the Moscow Region.
Since the 1990s, we have studied carefully the fauna of soil nematodes of various biocenoses of the Moscow Region. Survey of the territory was carried out horizontally, selecting soil samples from the upper organogenic soil horizons by the methods of envelope and randomised blocks, and vertically from individual horizons of the soil profile using a profile method. The inspected biocenoses were classed using elements of the relief - floodplain, meadow, meadow-marsh, peat-bog, forest (mixed and coniferous) and agrocenoses with different crops. From these studies, a list of the identified species and genera of soil nematodes was compiled. It is now possible to describe the nematode fauna of the Moscow Region. The data obtained were statistically processed by various methods and classified. As a result of the analysis, reliable differences between the faunae of individual biocenoses were established. It was found that some species preferred certain elements of the relief, which was associated mainly with the moisture content of the soil profile. - 1Centre of Parasitology, A.N. Severtsov Institute of Ecology and Evolution, RAS, Moscow, 119071, Russia; e-mail: stabolin@mail.ru; 2Institute of Geography, RAS, Moscow, 119017, Russia; e-mail: en_popova@mail.ru; 3Institute of Global Climate and Ecology, Roshydromet and RAS, Moscow, 107258, Russia.
ROMASHOV B.V.1, 2 & ROMASHOVA N.B.2 Metastrongylid nematodes (Nematoda: Metastrongylidae) in populations of wild boar in the Voronezh Reserve.
In the Voronezh Reserve the wild boar appeared in the 1940s. The number of wild boar in comparison with other ungulate species is about 50%. In the last 10 years the Voronezh Reserve is home to between 500 and 700 wild boars. The high number of wild boar causes problems in the population due to wide spread incidence of the animal-parasitic metastrongylid nematodes (Metastrongylus spp., Nematoda, Metastrongylidae). In the Voronezh Reserve three species of Metastrongylus were recorded from wild boars: M. elongatus, M. pudendotectus and M. salmi. Nematodes are localised in the lungs and cause pneumonia and bronchitis, or bronchopneumonia. For wild boars the high incidence of Metastrongylus spp. was from 70% to 100%. The highest rates of infestation were observed in young wild boars (younger than 1 year) (P < 0.001); the occurrence index was 98.6-100% and the index of abundance was 140-1500 individuals. The infection resulted in numerous cases of death of young wild boar, especially in winter, because of Metastrongylus parasitism. In the Voronezh Reserve at high snowpack, death of young wild boars reached 50% of their population. Currently, Metastrongylus spp. are widespread in wild boars of Voronezh Reserve. We consider that these nematodes are one of the most significant and permanent ecological factors that significantly affect the abundance and structure of wild boar populations. - 1Voronezh State Agricultural University, Voronezh, 394087, Russia; e-mail: bvrom@rambler.ru; 2Voronezhsky State Nature Biosphere Reserve named after V. Peskov, Voronezh, 394080, Russia.
ROMASHOVA N.B.1, DUEVA V.A.2 & ROMASHOV B.V.1, 2 Circulation of the nematodes Capillaria hepatica (Nematoda: Capillariidae) in the island forests of the Central Blacksoil region of Russia.
In the island forests of Central Blacksoil nematode Capillaria hepatica (Nematoda: Capillariidae) parasitise a large number of hosts: Castor fiber, Ondatra zibethicus, Arvicola terrestris, Microtus arvalis, M. agrestis, Myodes glareolus, Apodemus uralensis, A. flavicollis, A. agrarius, Mus musculus and Canis lupus. Infection of the red vole is, on average, 37.5%. Infection of other host species is 1.1% to 10.7%. Red vole (M. glareolus) is responsible for the main circulation of C. hepatica in the area. Features of the C. hepatica life cycle depends on environmental conditions. We found differences in the infection of red voles by C. hepatica in three habitats, which have varying degrees of moisture. The alders registered the maximum prevalence of infection of red vole (68.8%) and the highest rate of intensity of infection (2.0 specimens) and abundance index (1.4 specimens). The optimal biotope for the implementation of the nematode life cycle is alder. We found significant differences in the levels of contamination in the bank vole populations of C. hepatica in different seasons. In the spring, the rate of occurrence of C. hepatica is 72.2%, in the autumn 61.0%. Spring populations are dominated by adult animals, which results in more effective circulation of this nematode. In natural habitats, island forests have a substantial reservoir of C. hepatica. - 1Voronezhsky State Nature Biosphere Reserve named after V. Peskov, Voronezh, 394080, Russia; e-mail: bvnrom@rambler.ru; 2Voronezh State Agricultural University, Voronezh, 394087, Russia; e-mail: ryaskina.lera@yandex.ru.
RYSS A.Y. Evolution of Aphelenchoididae nematodes - parasites of fungi, insects and plants.
The evolution of the polyxenic life cycles of aphelenchoidid nematodes started from ancestors combining mycotrophism and predation. The diversification of their life cycles includes adaptation either to the plant host or to an insect vector (a detritophage or pollinator), until transformation of the latter into the real host of the parasitic nematode with a cycle involving two hosts (plant and insect) or to the obligatory only entomoparasitic mode of life with a secondary monoxenic cycle. There were two ways of the specialisation to the insect vector. In the first way, the resistant nematode juveniles were transformed into the transmission stages (dauer juveniles) and then into the endoparasitic juveniles. In the second way, inseminated but immature (non-egg-laying) females took the transmission function. In both evolutionary pathways the trend to minimise the body sizes of the transmission juveniles took place in two versions: a) via a shift of the transmission function to an earlier juvenile stage, or b) the body size decrease of immature females and acquisition of the male dwarfism. The success of the spread of aphelenchoidids into the cold Holarctic territories was ensured by the acquisition of the resistant juvenile, which later was transformed into the infective dauer juvenile, specialised for transmission by insect vectors to the new plant hosts (Support: RSF 14-14-00621, State Academic Program FSR AAAA-A17-117030310322-3). - Zoological Institute, RAS, Saint Petersburg, 199034, Russia; e-mail: nema@zin.ru.
RYSS A.Y.1 & MOKROUSOV M.V.2 Saproxylic nematodes of the Nizhny Novgorod Region of Russia and parameters for risk modelling of forest wilt in conditions of the anthropogenic stress.
In 2014-2015 forest wilt areas survey in Nizhny Novgorod Region, the possible factors of the pest spread risk modelling were analysed for six nematode species of the genus Bursaphelenchus using parameters: plant host species, beetle vector species, average temperatures in July and January and annual precipitation. The parameters in the evaluated forest wilt spots correspond to climate and associated data from the published records of wilt caused by the same nematode pest species. The combination of annual precipitation of 600 mm or lower, with an average temperature in the hottest 25-days period in July-August of +25°C or higher, are the critical wilt risk factors in predicative modelling of forest wilt (Support: RSF 14-14-00621, State Academic Program FSR AAAA-A17-117030310322-3). - Zoological Institute, RAS, Saint Petersburg, 199034, Russia; e-mail: nema@zin.ru; 2Research Botanical Garden, N.I. Lobachevsky State University of Nizhny Novgorod, Nizhny Novgorod, 603950, Russia; e-mail: sphecid@inbox.ru.
RYSS A.Y.1 & PETROV A.V.2 Study of saproxylic nematodes under confocal microscope.
Muscles of pharynx and copulation structures were studied in two saproxylic nematode species: myco-phytophagous nematode, Bursaphelenchus mucronatus, and the bacterial feeder, Chiloplacus sp. (Nematoda: Rhabditida). For functional opening dynamics of s tracts of nematodes, the antagonistic alternation of two phases is typical: t contraction of dilatators and inner body cavity pressure. Head muscles combine the 6-radial lip symmetry with bilateral amphids positions. In locomotion, the bilateral symmetry of two hypodermic chords combines with four radii of muscle sectors. Protractors of tubular or needle-like stoma form a 3-band structure stretching from the stoma base to head basal ring. In both species, the pharynx is a modification of the primitive two-bulb Secernentea pharynx. In Chiloplacus sp. the medial bulb is reduced, whereas the posterior bulb is increased. In B. mucronatus the median bulb is functional but the
posterior bulb (postcorpus) is reduced, transforming it into a minute circular valve between the pharynx and the mid-intestine; the postcorpus glands are grouped in an external lobe. In both modifications of bulbs (metacorpus or postcorpus), the walls consist of two layers of radial muscles. In dual cycle of dilation and closing of a feeding tract, the food mass first reaches the bulb anterior chamber at contraction phase of outer muscles, then inner muscles open the central valve of the bulb. Differences in vulval structure (circular vs arc-like flap) and male bursal alae (lateral alae vs terminal sticky flap) between two species reflect the dissimilar ways of the male and female attachment at copulation. The presence of gubernaculum and lateral bursa alae in Chiloplacus sp. are ancestral features. In B. mucronatus a change in copulation position led to partial substitution of the male tail attachment function with enhancement of the female copulative structures, whereas the male gubernaculum was fused with the spicules (Support: RSF 14-14-00621, State Academic Program FSR AAAA-A17-117030310322-3, ZIN, RAS work plan 01201351194, and CUC 'Taxon'). -Zoological Institute, RAS, Saint Petersburg, 199034, Russia; e-mail: alryss@gmail.com, a.pet@mail.ru.
RYSS A.Y.1 & POLYANINA K.S.1, 2 Saproxylic nematodes of elm and their associations with insect vectors.
The life cycle of the wood-inhabiting nematodes of the genus Bursaphelenchus is polyxenic. It includes three associates: a beetle vector and the tree and fungus hosts. There are two generations in the cycle: the transmissive and propogative ones. The vector infects the tree host with the fungus of the fam. Ophiostomataceae and nematode dauer juveniles of the transmission generation. The nematodes moult inside the plant host, forming the adult males and females that start feeding on cells of softwood. Further multiplication of the infection synergists (the fungus and nematodes of the propagative generation) leads to the host tree death; nematodes start to feed on fungal mycelium inside the dying tree. The goal of the present research was morphological diagnostics (measurements, genital primordium and pharynx) of the juvenile stages of B. ulmophilus a parasite of elm Ulmus spp. Nematodes of transmission stage collected from beetles, Scolytus spp., as well as nematodes multiplied in the fungus Botrytis cinerea cultures, are being studied using the modification of acetic orcein staining (Ryss, 1981). Nematodes of a series of stages and moulting juveniles were studied. Propagative generation: first moult inside the egg, and the second-stage juvenile (J2) leaves the egg shell. Already at J3 the male and female juveniles can be recognised according to the genital primordium structures. Pre-adult juveniles, J4, differ in a long genital primordium and presence of the copulative organs primordia (vulval primordium in female juvenile and cloacal primordium in male juvenile). Adult male and female have completely developed genital system parts and copulative structures. Juveniles grow during moult, and also between moults. Dauers are the third-stage juveniles (J3D) according to the genital primordium structure; their stoma and pharynx are strongly reduced; thus, possibly dauers do not feed. Dauers of J3D stage in B. ulmophilus (Hofmanni group) differ from the species of the Xylophilus group with their J4D dauers (Support: State Academic Program FSR AAAA-A17-117030310322-3). -1Zoological Institute, RAS, Saint Petersburg, 199034, Russia; 2Herzen State Pedagogical University of Russia, Saint Petersburg, 191186, Russia; e-mail: nema@zin.ru, i.kristy17@mail.ru.
RYSS A.Y.1 & SUBBOTIN S.A.2, 3 Coevolution of the nematodes of the genus Bursaphelenchus with insect vectors and plant hosts.
The genus Bursaphelenchus is unique in combination of evolutionary distanced symbionts in the life-cycle: the fungus and woody plant are hosts, and the insect is vector. The evolution of the genus was reconstructed using ribosomal RNA genes. In the Bursaphelenchus speciation insect vector taxa were more important than plant hosts. The package SIMMAP was used for interpretation of the morphological and biological transformations. Four major evolutionary lineages: macroclades A, B, C and B. abruptus basal clade have been revealed. The general node of A, B and C macroclades originated from an ancestor with the trixenic cycle and association of the Scolytinae beetles with coniferous plants. Species groups demonstrated the host and vector switch, in some groups the trixenic ancestor cycle evolved to the dixenic and monoxenic cycles. In the newly revised Bursaphelenchus grouping the Sexdentati group was integrated with Leoni, the Africanus group with Okinawaensis, and the Abietinus with Sinensis. Previous erections of Hylobianus and Trypophloei groups were considered as reasonable. The best morphological markers for clades are number of incisures in the lateral field and male tail papillae patterns. Supplementary characters are spicule, vulva, female tail, associations with specific insect vector and plant, transmission dauer stage (J3D or J4D) (Support: RSF 1414-00621, State Academic Program FSR AAAA-A17-117030310322-3). - Zoological Institute, RAS, Saint Petersburg, 199034, Russia; e-mail: nema@zin.ru; 2Plant Pest Diagnostics Centre, CDFA, Sacramento, CA, 95814, USA; 3Centre of Parasitology, A.N. Severtsov Institute of Ecology and Evolution, RAS, Moscow, 119071, Russia.
SADJJADI S.M. 1 2, SOLGI R.1, MOHEBALI M.3, 4, DINPARAST DJADID N.5, RAZ A.5, ZAKERI S.5 & ZAREI Z.3 Susceptibility of Anopheles stephensi (Liston,1901) biological form 'mysorensis' to zoonotic nematode Dirofilaria immitis (Leidy, 1856).
Dirofilaria immitis (Leidy 1856) is endemic in different parts of Iran including southern parts, which has a favourable environment for development of Anopheles stephensi (Liston 1901). The aim of the present study was to evaluate the susceptibility of An. stephensi biological form mysorensis as a vector for D. immitis under laboratory conditions. Dog blood containing 4000 mf ml-1 was artificially offered to 53 mosquitoes (T group) while 50 mosquitoes were left as a control (C group). The engorged mosquitoes of the (T) group were dissected at scheduled day post infection and tested for D. immitis larval stages by morphological and molecular analysis. The results showed that the average number of ingested microfilaria per female was 10.6. Of the 40 dissected mosquitoes in T, 16 (40%) were infected by D. immitis larvae. At the end of the study, the average number of infective larvae developed in mosquitoes after extrinsic development period was 1, giving an estimated IR of 40% and VEI of 10.6%. The high infection rate and vector efficiency index suggested that the variety An. stephensi mysorensis could be a potential vector of D. immitis (Support: TUMS and SUMS grants 27251 and 7568). - 1School of Medicine, Shiraz University of Medical Sciences, Shiraz, 71345-1735, Iran; e-mail: sadjjadi316@gmail.com, smsadjjadi@sums.ac.ir; 2Basic Sciences in Infectious Diseases Research Centre, Shiraz University of Medical Sciences, Shiraz, 71348-45794, Iran; 3School of Public Health, Tehran University of Medical Sciences, Tehran, 14155-6446, Iran; 4Centre for Research of Endemic Parasites of Iran, Tehran University of Medical Sciences, Tehran, 14155-6446, Iran; 5Biotechnology Research Centre, Pasteur Institute of Iran, Tehran, 13169-43551, Iran.
SHATILOVICH A.V.1, TCHESUNOV A.V.2 & NERETINA T.V.3 Pleistocene nematodes are discovered alive from permafrost of Yakutia.
Viable ancient microorganisms are known to be present within the Arctic and Antarctic permafrost. For the first time, the viable metazoan organisms have been discovered in subsurface frozen layers, and their ability to survive within permafrost during dozen thousands years is shown. Two species of free-living soil nematodes, Panagrolaimus aff. detritophagus (Rhabditida) and Plectus aff. parvus (Plectida), were obtained from samples of Pleistocene permafrost deposits of northern Yakutia. Panagrolaimus were isolated from the frozen material of the buried fossil burrows while Plectus from a sample of permafrost deposits obtained during drilling of the Late Pleistocene ice complex. The age estimate of the deposits was based on stratigraphy and radiocarbon dating. The longevity of nematodes cryoconservation corresponded to the permafrost age and reached about 30 thousand years. Revitalization of ancient viable nematodes was observed during enrichment cultivation at 20°C without nutritional supplementation. All adult animals were females. The phylogenetic analysis based on 18S rRNA gene sequences nests the investigated species within the genera Panagrolaimus and Plectus, respectively (Support: RFBR 17-04-01397-a). - institute of Physicochemical and Biological Problems in Soil Science, RAS, Pushchino, Moscow Region, 142290, Russia; email: nastya.shat@rambler.ru; 2Biological Faculty, Lomonosov Moscow State University, Moscow, 119991, Russia; 3Pertsov White Sea Biological Station, Biological Faculty, Lomonosov Moscow State University, Moscow, 119991, Russia.
SHCHUKOVSKAYA A.G.1, TKACHENKO O.B.2 & SHESTEPEROV A.A.3 Mycohelminths in protection of winter wheat from pink snow mold.
The possibility was investigated of using, at low positive temperatures, three kinds of mycohelminths Aphelenchoides saprophilus Franklin, Aphelenchus avenae Bastian, Paraphelenchus tritici Baranowskaja as bioagents of the fungus Microdochium nivale (Fr.) Samuels & IC Hallett. Aphelenchus avenae, P. tritici and A. saprophilus fed and multiplied on mycelium M. nivale fungus at +5°C in test tubes, in a climate chamber, and destroyed mycelium in 60-70 days; their number increased by 5.5-14.7 times compared to the original. Feeding on the mycelium of the fungus in the tissues of plants A. saprophilus, A. avenae, P. tritici reduced the harmfulness of the pathogen, which affected the condition of the model plants of winter wheat. In small-scale experiments from three species of mycohelminths, A. saprophilus showed the greatest efficiency in protecting winter wheat from pink snow mold. The number of affected wheat plants was reduced to 80.5%, while A. avenae and P. tritici species were reduced to 70.5 and 60.5%, respectively. The introduction of a drug based on mycohelminth A. saprophilus (normally 100000 ind. m-2) on the sowing of winter wheat affected by pink snow mold contributed to the reduction of damage from 58.8 to 17.7% and an increase in productivity to 359.7 g m-2. Biological efficiency was 69.8%, economic efficiency was 28.7%. - 1All-Russian Centre for Plant Quarantine, Bykovo, Moscow Region, 140150, Russia; 2Tsytsin Main Moscow Botanical Garden, RAS, Moscow, 127276, Russia; 3All-Russian Scientific Research Institute of Fundamental and Applied Parasitology of Animals and Plants named after K.I. Skryabin, Moscow, 117292, Russia; e-mail: nyama.r@yandex.ru.
SHESTEPEROV A.A., LYCHAGINA S.V. & AMELIN P.L. Agro-phytocoenotic method to control phytohelminthes.
Agrophytocenotic control method of phytohelminthes comprises the following procedures: phytohelminthological evaluation of precursors and crop rotation; application of nematode-resistant varieties and hybrids; use of trap and hostile plants; application of phytoagents obtained from catching and hostile plants and extermination of plant-reservoirs of nematodes. - All-Russian Scientific Research Institute of Fundamental and Applied Parasitology of Animals and Plants named after K.I. Skryabin, Moscow, 117292, Russia; e-mail: Aleks.6perov@yandex.ru, lychagina-svetlana@rambler.ru.
SHESTEPEROV A.A., EVREMENKO V.A. & GRIBOEDOVA O.G. Computer prognostic model to predict the nematode population dynamics of Globodera rostochiensis in the fields with resistant potatoes varieties.
As a result of conducted experiments and the analysis of the scientific literature, a computer-based dialogue model for predicting the density dynamics of populations of the golden cyst nematode (Globodera rostochiensis) in the soil, depending on 80 species of undamaged crops, has been developed. The development of this model consisted of several stages: the creation of an information base, verbal and conceptual models, the formalisation and development of a mathematical model, the transformation of a mathematical model into a computer model. The use of a computer model for predicting the population density of G. rostochiensis in the soil, depending on the preplant numbers of nematodes and the type of non-infecting plants in the globoderosis area, will help a large amount of information be used for practical and educational purposes. - All-Russian Scientific Research Institute of Fundamental and Applied Parasitology of Animals and Plants named after K.I. Skryabin, Moscow, 117292, Russia; e-mail: Aleks.6perov @yandex.ru.
SIVKOVA T.N. Helminths of primates in the conditions of the zoo and circus.
Different species of primates are found in many zoos of the Russian Federation and involved in a variety of circus programmes. However, some parasitic diseases are zoonoses, and since these animals are in close contact with people, the possibility of cross-contamination is very high. The aim of our work was to study the prevalence of helminthiasis in circus and zoo primates and to identify potential zoonotic infestations. Investigation of faeces was carried out by G.A. Kotelnikov & V.M. Khrenov method with a solution of ammonium nitrate. Identification of eggs and larvae of parasites was carried out according to the Atlas of VIGIS (Cherepanov et al., 2002). Among the circus animals examined were 35 individuals, 35.14% of which revealed helminth infection. The extensity of invasion (EI) of Oxyurida was 22.86%, Strongylida - 8.57%, Trichocephalida - 2.86%. Thirty-four monkeys from the zoo were investigated and in 11.76% of cases helminths were found, including 2 Trichuris and 1 Enterobius infection in 9 Eastern colobuses. In one case in the Brazz monkey faeces eggs of mice nematodes Aspiculuris tetraptera were found. All these worms are potentially dangerous to humans. The higher EI in the circus primates may be the result of a lack of high level of sanitary-hygienic conditions of animals in some circus programmes. - Perm State Agro-Technological University named after Academician D.N. Pryanishnikov, Perm, 614045, Russia; e-mail: tatiana-sivkova@yandex.ru.
SIVKOVA T.N. Toxocariasis of domestic, wild and circus carnivorous.
Toxocariasis in carnivores is a serious problem concerning not only veterinary medicine, as nematodes of the genus Toxocara can cause a human syndrome 'larva migrans'. According to the Centre of Hygiene and Epidemiology in Perm Region, toxocariasis is registered annually with the 222-322 incidents in the territory of our region. The aim of our study is to elucidate the spread of toxocariasis in domestic pets in Perm city, animals from the company Rosgostsirk and wild carnivores on the territory of Perm Region during the period 2007-2016. Investigation of faeces was carried out by G.A. Kotelnikov & V.M. Khrenov method with a solution of ammonium nitrate. Determination of eggs and larvae of parasites was carried out according to the Atlas of VIGIS (Cherepanov et al., 2002). The carcasses were examined by the method of K.I. Scriabin partial helminthological autopsy. For the specified period 3,258 pet dogs and 4,099 pet cats were examined and the extent of Toxocara infection (EI) was 5.89 and 8.39%, respectively. Among the predators in the closed environment of the circus toxocariasis was recorded in 5.56% of dogs, of 8.51% of cats, of 6.25% of Africa's leopards and 22.22% of the Amur tigers. Eggs of T. canis were identified in the 35.29% of foxes and 25% of raccoon dogs. Therefore, toxocariasis is widely distributed among domestic, circus and wild representatives of the Carnivora. -Perm State Agro-Technological University named after Academician D.N. Pryanishnikov, Perm, 614045, Russia; e-mail: tatiana-sivkova@yandex.ru.
SMOL N., DEHENNIN I., DECRAEMER W. & BERT W. International Master of Science in agro- and environmental nematology.
Recently the International MSc programme in Nematology at Ghent University, Belgium, originally named "Postgraduate International Nematology Course" has changed its name into "International Master of Science in Agro-and Environmental Nematology". The programme focuses more on the agricultural and environmental aspects that are nowadays important parts of Nematology and should attract more students. It is an English taught 2-year programme, globally unique in its kind, offering a dynamic, interactive and multidisciplinary approach, attracting students from across the world and bridging with universities in the South. The first year offers a variety of basic compulsory Nematological courses and the second year offers a series of elective courses, tailor made to the needs and future perspectives of the students. Strong points are the teaching staff of national and international experts, international mobility, internships, networking courses with visits to European universities, institutes and companies involved into the current top priority research in Nematology. Key objectives of the programme include: (1) disseminate knowledge of nematode effects on crops and their role in disease complexes; (2) transfer of information to implement sustainable farming practices and improve agricultural productivity under rapidly changing environmental and climate conditions; (3) facilitate the use of nematodes as biological control agents; (4) advance the knowledge of nematodes in their role as ecosystem service providers. A new strategy is launched for international capacity building and sustainability in the South, through satellite programmes in Ethiopia (a Summer Course in Nematology) and Kenya (Basic Nematology Crash Course). - Nematology Research Unit, Department of Biology, Ghent University, Ghent, 9000, Belgium; email: nic.smol@ugent.be.
SMOL N.1, MOKIEVSKY V.2, CAMPINAS BEZERRA T.N., EISENDLE-FLOCKNER U., GUILINI K., HOLOVACHOV O., LEDUC D., MILJUTIN D., SHARMA J., TCHESUNOV A. & VENEKEY V. An introductory guide to NeMys - the world database of free-living nematodes.
NeMys is the online nematode biodiversity database erected in 1998 from the taxonomic filing cabinet of the marine Biology Research unit at Ghent University (Belgium). NeMys is now transferred and integrated into the World Register of Marine Species (WoRMS), hosted at the Flanders Marine Institute (VLIZ). An international group of nematode taxonomy experts have been appointed as editorial board members, whose role is the online management and updating of this database. This includes providing the most authorative list of taxon names of all marine and estuarine species ever published and classified according to the classification of De Ley & Blaxter (2002), with further amendments by Schmidt-Rhaesa (2014). It also includes ecological information and distribution records in a user-friendly system. As such, NeMys has become an indispensable tool for taxonomic and ecological research and can be used for educational purposes all over the world. Registered users will have full access to the PDF of entire taxonomic papers and to snippets of species descriptions. This easy access to literature is a major advantage because original descriptions are necessary to correctly identify nematodes to species level. The poster aims to demonstrate a basic introduction to NeMys and some of the most recently added or updated features and tools. - hematology Research Unit, Department of Biology, Ghent University, Ghent, 9000, Belgium; e-mail: nic.smol@ugent.be; 2P.P.Shirshov Institute of Oceanology, RAS, Moscow, 117218, Russia; e-mail: vadim@ocean.ru.
SOGRINA A.V. Dirofilaria infection in service dogs in Perm: distribution and seroepidemiological monitoring.
Dirofilaria infection is widespread throughout Russia over the past decade, including the northern regions. Dogs, including service animals, play a special role in the spread of the disease. The aim of our study was to conduct monitoring of dirofilariasis among dogs in the Perm city. A study of 562 samples of venous stabilised blood from service animals for the presence of microfilariae was performed by the V.B. Yastreb method over the period 2007-2016. To conduct seroepidemiological studies by ELISA with somatic Dirofilaria immitis extract as antigen, sera of 186 dogs were selected. Because of the investigation, we confirmed persistent focus of dirofilariasis in the Perm Region. The greatest number of infected animals was recorded in 2013-2014, where prevalence of infection was 16.8%. Results of ELISA of blood serum samples with a high titer of IgG antibodies where microfilaria in the blood of dogs were absent, may indicate a latent form of infection. - All-Russian Scientific Research Institute of Fundamental and Applied Parasitology of Animals and Plants named after K.I. Skryabin, Moscow, 117292, Russia; e-mail: sograv@yandex.ru.
SOKOLOV S.G. & MALYSHEVA S.V. The phylogeny of nematodes of the family Skrjabillanidae Shigin et Shigina, 1958 (Dracunculoidea) - parasites of freshwater fishes.
The family Skrjabillanidae unites nematodes parasitising the body cavity and the tissues of freshwater fish. This family includes 7 species and a number of forms with an obscure species identity, grouped into two subfamilies -
Skrjabillaninae (Agrachanus Tikhomirova, 1971, Kalmanmolnaria Sokolov, 2006, Sinoichthyonema Wu, 1973 and Skrjabillanus Shigin et Shigina, 1958) and Esocineminae (Esocinema Moravec, 1977). We obtained sequences of 18S rDNA about 1700 bp long for Skrjabillanus tincae Schigin and Schigina 1958 from Tinca tinca, K. intestinalis and A. scardinii from Scardinius erythrophthalmus and Sinoichthyonema amuri (Garkavi 1972) from Ctenopharyngodon idella from Volga delta. On the phylogram, the genus Esocinema forms an outer branch in relation to the clade, uniting representatives of the paraphyletic genus Mexiconema Moravec, Vidal & Salgado Maldonado, 1992 (family Daniconematidae) and the terminal Skrjabillaninae clade. Within the Skrjabillaninae only a group consisting of Agrachanus, Kalmanmolnaria and Skrjabillanus genera demonstrates a strict monophyly. Within this group, A. scardinii (type species of the genus) forms a sister relationship with K. intestinalis and is phylogenetically distant from S. tincae (the type species of the genus), which indicates the validity of the genus Agrachanus (Support: RFBR 17-04-00095-a, Research Program RAS "Bioresources"). - Centre of Parasitology, A.N. Severtsov Institute of Ecology and Evolution, RAS, Moscow, 119071, Russia; e-mail: malysheva24@gmail.com.
SUDARIKOVA S.V. & KHUDIAKOVA E.A. Situation on the soybean cyst nematode Heterodera glycines in the Far East of Russia.
Heterodera glycines Ichinohe, the soybean cyst nematode, was first detected in Japan and Korea in 1915. At present, it is spread in many countries, causing 10% of soybean crop losses. In 2014, the species Heterodera glycines was included in the list of the quarantine pests absent in the Russian Federation. Occasionally, the occurence of this nematode species in the Primorye and Amur Regions was reported. In summer 2016, All-Russian Plant Quarantine Centre organised an expedition to the Far East to gather collection material and update the information concerning the quarantine species. The soybean cyst nematode was detected in one case in the field with no crop rotation where soybeans were cultivated after soybeans. Among the extracted cysts, only 20% had viable eggs and larvae. The species Heterodera glycines was identified with morphological and molecular PCR methods using two pairs of universal primers, with the following sequencing on genetic analyzer AB-3500 (Life Technologies, USA). The primers JB3/JB5 turned out to be the best (Eurogene). The sequencing results were interpreted with BioEdit and Q-bank database. The species was identified as Heterodera glycines, the soybean cyst nematode. - All-Russian Centre for Plant Quarantine, Bykovo, Moscow Region, 140150, Russia; e-mail: sudarikovah@mail.ru.
SUSHCHUK A.A., MATVEEVA E.M. & KALINKINA D.S. Do metabolic footprints of soil nematodes differ in various types of biocenoses on the North?
The metabolic footprints (MF) is an estimator of nematode contribution to various ecosystem services and functions. The nematode MF consists of enrichment (EF) and structure (SF) footprints, which are representative for the carbon (C) metabolism on low and high trophic levels, respectively. Nematode data from forests, meadows and agrocenoses were used to estimate the MF associated with the type of natural biocenoses and under crop cultivation. It was revealed that pine forests had low and spruce forests high EF values among natural biocenoses, but in agrocenoses this parameter reached the highest values. The increase of EF indicates a connection with either higher quality (in the first case) or a recent organic matter application (in second case). By contrast, SF had the lowest values in agrocenoses of disturbed annually-cropped fields. Deviations from 'metabolic balance' state of soil ecosystems, changes in the composite footprints of nematodes and their contribution of C flows were analysed. Therefore, for spruce forests there was a high composite MF, but for meadows the value was intermediate. Based on these results it was suggested that in spruce forests C flows in soil food webs are connected with nematodes to larger extent than in meadows (Support: RFBR 15-04-07675-a, State Orders 0221-2014-0030 and 0221-2015-0006). - Institute of Biology, Karelian Research Centre, RAS, Petrozavodsk, 185910, Russia; e-mail: anna_sushchuk@mail.ru.
TABOLIN S.B. On the faunistic diversity of nematodes of the family Criconematidae in the European part of Russia.
The purpose of this work was to study nematode fauna of the family Criconematidae in the European territory of Russia. There were several objectives in the study: 1) collect soil samples at different points of the European part of Russia and identify criconematid species; 2) compile and systematise literature data on the nematode fauna of this family in the territory. From 2010 to 2017, about 600 soil samples were collected from natural and agricultural ecosystems in North Western, Central, and Southern regions of Russia. Nematodes were extracted using the Flegg's decanting and sieving method. Then the nematodes were killed with hot water, fixed in 5% formalin solution and mounted in glycerin on slides using the Seinhorst technique. The identification of individual species was conducted by morphometric characters under a light microscope. The total taxonomic list of species of the family Criconematidae registered in the European Russia is as follows: Criconema annuliferum*, C. princeps, C. demani*, Criconemoides amorphus*, C. informis*, C. morgensis*, C. quadricornis, C.
pleriannulatus*, Mesocriconema curvatum*, M. dherdei, M. rusticum*, M. ornatum*, M. xenoplax*, M. solivagum, Ogma octangularis*, O. murrayi, Xenocriconemella macrodora, Crossonema multisquamatum. Species marked with * have been found during this study. - Centre of Parasitology, A.N. Severtsov Institute of Ecology and Evolution, RAS, Moscow, 119071, Russia; e-mail: stabolin@mail.ru.
TCHESUNOV A.V.1, VELUSHOVA A.I.1, SANAMYAN K.E.2 & NERETINA T.V.3 A new Styraconyx species (Tardigrada: Arthrotardigrada) found in a marine aquarium.
A presumably new species of Styraconyx (Arthrotardigrada: Halechiniscidae) was discovered in a marine aquarium situated in the Pacific Geographical Institute, Petropavlovsk-Kamchatsky, Russia. Abundant tardigrade specimens were found within a sparse of silty sediment in an aquarium containing nothing but tufts of Chaetomorpha alga. The genus Styraconyx contains 13 species recorded worldwide including Arctic, temperate and tropical zones; however, individual species are selective in choice of substrate. The newly found species differs distinctly from other known species in sculpture of dorsal surface (transversal ridges) as well as in details of toes and claws, and shape of primary clava. The native area and habitat of the species is not known. The aquarium was initially filled with 'living stones' imported from Indonesia - hence it is possible that this tardigrade is an epiphytic tropical Indo-West-Pacific species. The phylogenetic analysis based on 28S rRNA gene sequences nests the investigated species within the genus Styraconyx (Support: RFBR 15-04-02597-a). - 1Biological Faculty, Lomonosov Moscow State University, Moscow, 119991, Russia; email: AVTchesunov@yandex.ru.; 2Kamchatka Branch of the Pacific Institute of Geography, FEB RAS, Petropavlovsk-Kamchatsky, 683000, Russia; 3Pertsov White Sea Biological Station, Biological Faculty, Lomonosov Moscow State University, Moscow, 119991, Russia.
TCHESUNOV A.V. & FEDYAEVA M.A. Fine structure of the alimentary tract of Sphaerolaimus balticus.
Sphaerolaimus balticus (Monhysterida: Sphaerolaimidae) is a predatory nematode species common in the intertidal zone of the White Sea, northern Russia. Analyses of the gut content and from direct observations indicates that S. balticus mainly feed upon other free-living nematodes . The buccal cavity is voluminous and barrel-shaped. Unlike that of most other marine nematode species, the major part of the buccal cavity is actually a cheilostome formed only by somatic cuticle and differentiated into divisions: hemispherical labial division, truncate conical striated division composed of about 30 longitudinal ribs grouped in six sets, and a spacy division formed by broad 'shagreen' band with posterior circular ridge. The latter consists of six lobes with outgrowths of arcade tissue between them. Pharyngostome formed by pharyngeal cuticle consists of narrow gymnostome enveloped by arcade tissue and cup-shaped stegostome whose cuticle continues gradually to the internal lining of the pharynx. By capturing a prey nematode, the mouth opens due to contraction of longitudinal body wall muscles. By relaxation the muscles, the mouth grips a prey by bringing together the longitudinal ribs. The pharynx has a wide triradial lumen, its cuticle unequally thickened forming a trefoil-shaped pattern. Gut cells contains a lot of lipid drops and various lysosomes. Long and dense microvilli are covered by a complex three-layered glycocalyx (Support: RFBR 15-04-02597-a). - Biological Faculty, Lomonosov Moscow State University, Moscow, 119991, Russia; e-mail: AVTchesunov@yandex.ru.
TCHESUNOV A.V.1 & MOKIEVSKY V.O.2 Peculiarities of nematode species diversity on Atlantic seamount Great Meteor.
Great Meteor is a giant seamount rising from the seabed at about 4500 m to a summit plateau of 1450 km2 square at average depth 287 m below sea level located at ~30°N and at 1600 m from the nearest continental coast. The plateau is an isolated 'sublittoral habitat' covered with biogenic coarse calcareous sand consisted largely of shells of planctonic foraminiferans and pteropod gastropods. Nematofauna is very diverse and represented by about 75 species belonging to 51 genera and 32 families. The dominant family is Selachinematidae, followed by Comesomatidae, Desmodoridae, Ceramonematidae, Thoracostomopsidae and Neotonchidae. A peculiar feature of the assemblages is high percentage of predatory families Selachinematidae (mostly Latronema). Another peculiar feature is high percentage and diversity of Ceramonematidae. Most species are new species belonging to genera common in shallow coarse sediments. A few typical deep-sea genera such as Acantholaimus and Manganonema are also present but their percentage occurrence is low. The pattern of the species composition and morphological analysis support a hypothesis on intensive local speciation processes on the isolated seamount plateau (Support: RFBR 15-04-02597-a). - 1Biological Faculty, Lomonosov Moscow State University, Moscow, 119991, Russia; e-mail: AVTchesunov@yandex.ru; 2P.P.Shirshov Institute of Oceanology, RAS, Moscow, 117218, Russia.
TOKTAY H.1, IMREN M.2, OCAL A.3, BOZBUGA R.4 & DABABAT A.5 Studies on the cereal nematodes, Heterodera spp. and Pratylenchus spp. in East Anatolian Region of Turkey.
The aims of this study were to identify cyst and root lesion nematodes, determine their distribution and density, define the reaction response of commonly grown wheat varieties against cyst and root lesion nematodes, and determine the most common cyst nematode species. The result of the study revealed that 32% and 34% of wheat fields were infested by cyst nematodes and root lesion nematodes, respectively, and both were found as mixed populations. Heterodera filipjevi, H. latipons, Pratylenchus thornei and P. neglectus were identified but the most common species of cyst and root lesion nematodes were H. filipjevi and P. neglectus, respectively, in the fields. There were no wheat varieties with full resistant to H. filipjevi, and root lesion nematodes (Pratylenchus thornei and P. neglectus), but Siyah Bugday, Yazlik Bugday (Wisari), Palandoken and Daphan varieties were found to be moderately resistant to H. filipjevi. Ceyhan, Menceki, Pehlivan varieties moderately resistant to P. thornei and Ümranhanim, Kirmizi Bugday, Menceki, Pehlivan, Karasu wheat varieties were moderately resistant to P. neglectus. Umranhanim, Pehlivan and Menceki wheat varieties were moderately resistant to both nematodes (P. thornei and P. neglectus). The live nematode collections were created from collected nematode species (cyst nematodes; H. filipjevi and H. latipons, root lesion nematodes P. thornei and P. neglectus) in this study (Support: TÜBÍTAK 112O565). - 'Faculty of Agricultural Sciences and Technologies, Omer Halisdemir University, Nigde, 51240, Turkey; e-mail: h.toktay@ohu.edu.tr; 2Faculty of Agriculture and Natural Science, Abant izzet Baysal University, Golkoy Bolu, 14280, Turkey; 3Atatürk Horticultural Central Research Institute, Yalova, 77100, Turkey; 4Biological Control Research Institute, Adana, 01321, Turkey; international Maize and Wheat Improvement Centre, Ankara, 06511, Turkey.
TREBUKHOVA Y.A.1, PAVLYUK O.N.1, NGUYEN D.T.2, NGUYEN V.T.2, NGUYEN T.X.PH.2 & CAO V.L.3 Community structure of nematodes assemblages in tropical deltaic system in Tien Yen District, Quang Ninh Province, Viet Nam.
The seasonal changes in density, species biodiversity and trophic groups of free-living marine nematode communities inhabiting seagrass meadows with different seagrasses ratio in tropical deltaic system within Tien Yen District of Quang Ninh Province, Vietnam were studied in April and Ocrober, 2015. Sampling was conducted on intertidal mud flats in Ha Dong (HD, six species: Halaphila ovalis, H. beccarii, Halodule pinifolia, H uninervis, Zostera japonica, Ruppia maritime), Con Mat (CM, one species: H. ovalis), Cua Song (CS, three species: Z. japonica, H. ovalis; H. pinifolia) and Xom Giao (XG, Zostera japonica) where seagrasses were abundantly distributed. A total of 73 nematode species were identified at the sites, belonging to 43 genera and 17 families. In general, the present study shows that in Tien Yen Estuary, seven families of nematode species were dominant: Oncholaimidae, Xyalidae, Chromadoridae, Desmodoridae, Sphaerolaimidae, Linhomoeidae and Comesomatidae. Density and diversity of nematodes inhabiting sea grass meadows of Tien Yen estuary differs from station to station and repetitions, beside the slight difference between repetitions and similar habitats. In October noticeable decrease of nematode density, changes in species composition and dominant species and percentage of trophic groups was registered comparing to April. Heavy rainfall resulted in salinity decrease and caused changes in sediment composition, which lead to changes in the nematode community structure. An ANOSIM test for the densities of the nematode communities in the seagrass meadows of the areas are not similar in all stations and show significant differences between season (R = 0,329, P = 0.01) and between stations (R = 0,596, P = 0.01) but no significance for replicates. Thus, our studies confirm that the main factor responsible for seasonal changes of nematode community in intertidal zone of Tien Yen estuary is the precipitation (heavy rainfall) (Support: RFBR 17-04-00719-a, VAST.HTQT.NGA.09/15-16, BAHT 17-010). -1National Scientific Centre of Marine Biology, FEB RAS, Vladivostok, 690041, Russia; e-mail: trebukhova@gmail.com; 2Institute of Ecology and Biological Resources, VAST, Hanoi, Vietnam; 3Institute of Marine Environment and Resources, VAST, Hai Phong, Vietnam.
YUSHIN V.V.1, 2, CLAEYS M.3, SLOS D.3 & BERT W.3 Male gametes in the order Rhabditida: new observations and conclusions.
One of the most striking examples of aberrant male gametes is amoeboid sperm of nematodes described in detail in a hundred of species and studied at the molecular level in the rhabditid nematode Caenorhabditis elegans. The cytoplasm of nematode spermatozoa includes unique cellular organelles and unique cytoskeletal motor protein (major sperm protein, MSP). Recent studies of spermatozoa in the rhabditids from several poorly studied families together with information on about 50 rhabditid species previously studied enables us to propose several conclusions on morphology, development, biology, and evolution of the rhabditid spermatozoa. The nuclear envelope in spermatozoa of rhabditids is missing, mitochondria are numerous, and the cytoskeleton is well developed and forms the basis of pseudopods. In the rhabditid spermatozoa both forms of aberrant organelles, membranous organelles (MO) and fibrous bodies (FB), develop as FB-MO complexes appearing in spermatocytes. Each complex contains MO derived from Golgi bodies, and paracrystalline FB accumulating cytoskeletal proteins. Dissociation of the FB-MO complex in immature spermatozoa
terminates in mature spermatozoa where FB proteins acquire a filamentous form and build the cytoskeleton of the pseudopod. Synchronised formation of the specific FB-MO complexes is one of the most characteristic features of the rhabditid spermatozoa (Support: RFBR 17-04-00719-a; RSF for the FEFU 14-50-00034). - 1National Scientific Centre of Marine Biology, FEB RAS, Vladivostok, 690041, Russia; 2Far Eastern Federal University, Vladivostok, 690600, Russia; e-mail: vvyushin@yandex.ru; 3Nematology Research Unit, Department of Biology, Ghent University, Ghent, 9000, Belgium.
ZINOVIEVA S.V.1, UDALOVA ZH.V.1, LAVROVA V.V.2 & MATVEEVA E.M.2 Pathogenesis-related proteins in plant defence mechanism by infection parasitic nematodes.
The defence strategy of plants against stress factors involves a multitude of tools, including various types of stress proteins with putative protective functions. Pathogenesis-related (PR) proteins include a wide variety of proteins with diverse functions, predominantly associated with resistance to pathogens. The activity of certain PR and expression of genes encoding PR was studied on two systems: potatoes - Globodera rostochiensis and tomatoes - Meloidogyne incognita. It is shown that invasion of nematodes into plants leads to changes: i) activity of chitinase and P-1,3-glucanase, which can destroy cell walls of parasite and in so doing to influence on nematodes vitality, and also to produce oligomers with immunoregulated properties; ii) activity of peroxidase, taking part in hypersensitive death of plant cells and strengthening of plant cell walls, which restrict the nematode development; iii) activity of phenylalanine ammonium lyase - a key enzyme of phenyl-propanol cycle in plants; iv) activity of lipoxygenase, which leads to the formation of signal molecules, taking part in transduction process and intensifying the elicitors activity of pathogen; v) activity of proteinase inhibitors - inhibition of proteolytic enzymes the parasite, purturbing the parasite's ability to digest proteins of plants (Support: RFBR 15-04-04625-a). - 1Centre of Parasitology, A.N. Severtsov Institute of Ecology and Evolution, RAS, Moscow, 119071, Russia; e-mail: zinovievas@mail.ru; 2Institute of Biology, Karelian Research Centre, RAS, Petrozavodsk, 185910, Russia.
ZRYANIN V.A. & YAKIMOV B.N. Relationships between the species structure of ground beetle community and various layers of broadleaf forest.
We estimated the relationship between the species structure of three layers of plain broadleaf forest and the ground beetle community with the co-inertia analysis (coefficient RV). The data were collected in August 2016 on a transect (100 plots 10 x 10 m) established in a protected area "Oak forest of Nizhny Novgorod botanical garden". Herb layer was described with 1 x 1 m subplots (total of 500 subplots). All stems were recorded in the tree and shrub layers. Beetles (Carabidae and Staphylinidae mostly) were sampled with Barber traps during a 2-day exposition (total of 1000 trap-days). We recorded 11 species in a tree layer (Acer platanoides, Ulmus glabra, Fraxinus excelsior were most abundant), 10 species in a shrub layer (Corylus avallana), and 43 species in a herb layer (Aegopodium podagraria, Mercurialis perennis, Pulmonaria obscura). Carabidae were represented by 22 species (Pterostichus niger, Carabus granulatus, P. melanarius, P. oblongopunctatus) and Staphylinidae were represented by17 species (Philonthus decorus, Drusilla canaliculata). We have found a strong relationship between beetle community and herb layer (RV = 0.37). The relationships between beetle community and tree and shrub layers were less pronounced (RV = 0.31 and 0.20, respectively). The coefficients were highly significant (P < 0.05). Similar relation strength was found for different layers (RV = 0.33-0.35) (Support: RFBR 16-54-53037). - Institute of Biology and Biomedicine, N.I. Lobachevsky State University of Nizhny Novgorod, Nizhny Novgorod, 603950, Russia; e-mail: zryanin@list.ru.
