CC BY
7
Protistology 17 (4): 216-232 (2023) | doi:10.21685/1680-0826-2023-17-4-3 Pl'OtiStOlO&y
Original article
New genus Valtocarpus (Myxomycetes = Eumycetozoa): molecular phylogeny and morphological analysis of aethalioid species in the order Stemonitidales
Vladimir I. Gmoshinskiy1*, Ilya S. Prikhodko2, Fedor M. Bortnikov1, Oleg N. Shchepin2, and Yuri K. Novozhilov2
1 Lomonosov Moscow State University, Faculty of Biology, Mycology and Algology Department, Moscow 119234, Russia
2 V.L. Komarov Botanical Institute of the Russian Academy of Sciences, St. Petersburg 197376, Russia
| Submitted October 10, 2023 | Accepted November 13, 2023 |
Summary
Phylogenetic position of the taxa in the order Stemonitidales with aethalioid sporophores, Brefeldia, Amaurochaete, and Symphytocarpus, is discussed. The genus Brefeldia is monotypic and is characterized by the presence of multicellular vesicles in the capillitium. Species of the genus Amaurochaete, with the exception of A. trechispora, are distinguished from Symphytocarpus by the presence of a dense cortex, which is preserved after maturation of sporophores. A. trechispora is characterized by complete destruction ofthe cortex during sporophore maturation. In order to clarify the taxonomic position of this species, a phylogenetic analysis was performed using maximum likelihood method and Bayesian inference based on partial sequences of three unlinked genes. Symphytocarpus trechisporus and A. trechispora form a highly supported monophyletic clade within the family Stemonitidaceae. Both species have purple-brown spore masses and are associated with forests around upland bogs. The other species of the genus Symphytocarpus do not form a well-defined monophyletic group. We propose to assign S. trechisporus and A. trechispora to a new genus Valtocarpus. Our results also demonstrate the non-monophyletic origin of several genera of the families Amaurochaetaceae and Stemonitidaceae and the need for further taxonomic revision of these groups.
Key words: Amoebozoa, genome skimming, molecular phylogeny, morphology, small subunit ribosomal RNA, taxonomy, translation elongation factor 1-alpha
Introduction
Myxomycetes are one of the few protist groups having a system originally based on the structure of sporophores. Sporophores are usually divided into
https://doi.org/10.21685/1680-0826-2023-17-4-3
© 2023 The Author(s)
Protistology © 2023 Protozoological Society Affiliated with RAS
5 main types: plasmodiocarps, sporangia (stalked or sessile), pseudoaethalia, and aethalia (Martin and Alexopoulos, 1969). This feature is eye-catching and intuitive, but the results of phylogenetic studies in recent years have increasingly led to the
Corresponding author:Vladimir I. Gmoshinskiy. Lomonosov Moscow State University, Faculty of Biology, Mycology and Algology Dept., Leninskiye Gori 1-12, Moscow 119234, Russia; rubisco@list.ru
conclusion that the same types of sporophores can independently develop in different phylogenetic lineages of myxomycetes (Leontyev, 2016; Prik-hodko et al., 2023; García-Martín et al., 2023). To date, information on the nucleotide sequences of the aethalioid forms of representatives of the order Stemonitidales has been insufficient to draw conclusions about the possible evolution of fruiting bodies within this order.
In 1922, T. Macbride described the order Stemonitidales as "Stemonitales" characterized by the epihypothallic type of development of sporophores and are usually represented by stalked sporangia, less often by plasmodiocarps, pseudoaethalia or aethalia (Macbride, 1922). Peridium is membranous, often easily destroyed before sporophore maturation. Columella is usually present and is an extension of the stalk, from which numerous capillitium threads arise. Lime is absent from the sporophore structures. The spore mass is black, rusty-brown, reddish-brown (Martin and Alexopoulos, 1969; Poulain et al., 2011).
As a result of the first phylogeny-based revision of the class Myxomycetes, several taxa were excluded from the order Stemonitidales, the order became monophyletic and the morphological diagnosis was corrected (Leontyev et al., 2019). In particular, genera with the capillitium tightly attached to the inner surface of the peridium were excluded from the order. Thus, taxa of the order Stemonitidales s.str. are characterized by almost complete destruction of the peridium in the process of sporophore formation, with only a few exceptions. Stemonitopsis typhina (F.H. Wigg.) Nann.-Bremek. and Comatricha sinuatocolumellata G. Moreno, H. Singer, A. Sánchez et Illana possess a relatively dense membranous peridium that falls off as a whole fragment. At the same time, representatives with compound fructifications can have a thin peridium or even cortex (Leontyev et al., 2019).
Two families are distinguished within the order Stemonitidales: Amaurochaetaceae and Stemonitidaceae. The key morphological difference between these groups is the presence of a solid fibrous stalk in Amaurochaetaceae and a hollow corneous stalk in Stemonitidaceae (Leontyev et al., 2019).
Within the order, three genera form compound fructifications: Symphytocarpus Ing et Nann.-Bremek., Amaurochaete Rostaf. and Brefeldia Rostaf. All of them are relatively small in number of species: nine species have been described in
Symphytocarpus, five in Amaurochaete and only one in Brefeldia (Lado, 2005—2023). Members of these genera form relatively large aethalia, which can sometimes reach 10—15 cm in diameter. The genus Amaurochaete is characterized by the presence of dense aethalia covered with dark cortex, which cracks and falls off easily during sporophore maturation. The cortex surface still has lines corresponding to individual sporangia. The type species of the genus is Amaurochaete atra (Alb. et Schwein.) Rostaf. In contrast to Amaurochaete, sporophores in the genus Symphytocarpus are pseudoaethalioid, not aethalioid. In addition, a real dense cortex does not form, the peridium is destroyed almost completely and may remain only as small flakes attached to capillitium threads (Ing and Nannenga-Bremekamp, 1967). The type species of the genus is Symphytocarpus flaccidus (Lister) Ing et Nann.-Bremek. The monotypic genus Brefeldia belongs to the family Amaurochaetaceae (Leontyev et al., 2019). Brefeldia maxima (Fr.) Rostaf. is characterized by the presence of large pseudoaethalia or aethalia reaching several tens of centimeters in diameter with a unique structure of capillitium represented by thin filaments with globular or elongated multicellular vesicles. Spores ofthis species are warted (verrucose).
Although the difference in the peridium structure seems to be quite a convenient character for distinguishing these two genera, it can be difficult to apply in reality, since the fragile peridium is often completely destroyed in field specimens. For example, Symphytocarpus fusiformis Nann.-Bremek. et Hark. was described from Finland in 1979. In the protologue, authors indicated that the type specimen was rather old and weathered, so they were not sure that the cortex in this species never formed (Nannenga-Bremekamp and Harkonen, 1979). A. Kuhnt later reported the discovery of a second specimen, much better preserved, that could be assigned to this species based on morphological characters, which allowed him to confirm the presence of a cortex and transfer it to the genus Amaurochaete as A. fusiformis (Nann.-Bremek. et Hark.) H. Marx et Kuhnt (Kuhnt, 2019).
Amaurochaete trechispora T. Macbr. et G.W. Martin is also a rare species (Eliasson, 2000). Until recently, it was found only in Canada, USA, Luxembourg, Sweden and Japan. Collections from the Rdeysky Nature Reserve in the Novgorod Region became the first records for Russia (Borzov et al., 2021). The species was first described by T. Macbride and W. Martin (Martin, 1932). The
protologue stated "cortex dark, shining, evanescent, and faintly tuberculate as though suggesting the tips of component sporangia". Since the species is rare, most later authors have not had the opportunity to examine fresh sporophores and make observations on the structure of the cortex and its stability during morphogenesis (for more details, see Borzov et al., 2021). Based on the protologue and not being able to study the type specimen when describing the new genus Symphytocarpus, B. Ing and N.E. Nannenga-Bremekamp did not transfer this species from the genus Amaurochaete to Symphytocarpus (Ing and Nannenga-Bremekamp, 1967).
Symphytocarpus trechisporus (Berk.) Nann.-Brem. is a more often occurring species in Europe and North America. This taxon was originally described as a variety: Stemonitis fusca var. trechispora Berk. ex Torrend (Torrend, 1908). However, T. Macbride notes the presence of stable differences repeated in a series of specimens in habit, color, net and spores and proposed to upgrade the taxon to species: Stemonitis trechispora (Berk.) T. Macbr. (Macbride, 1922). G. Lister, on the other hand, regarded it as a "poorly defined variety" of Stemonitis fusca Roth (Lister, 1925). Finally, B. Ing and N. E. Nannenga-Bremekamp considered this taxon within the genus described by them as Symphytocarpus trechisporus (Ing and Nannenga-Bremekamp, 1967).
The aim of this study is to continue the phylo-geny-based taxonomic revision of the order Stemonitidales, now with a focus on the phylogenetic relationships of the genera that form compound fructifications. For this, we reconstructed a three-gene phylogeny of the order Stemonitidales and conducted a morphological analysis of its species with compound fructifications.
Material and methods
Morphological studies
Photographs of sporophores were taken with a Micromed 3 var. 3LED light microscope equipped with a E3CMOS06300 digital camera and epi illumination or with a Canon 77D digital camera. Series of pictures were taken in different optical sections and processed using Helicon Focus ver. 6.0.18. The dimensions of spores, capillitium, and sporophores were calculated using ToupView 3.7 and ImageJ ver. 1.52a.
Microscopic measurements and photographs were made with Micromed 3 var. 3LED equipped with a E3CMOS06300 digital camera or Zeiss Axio Imager A1 light microscope (LM) with differential interference contrast (DIC). For microscopy, sporophores were mounted in 4% KOH, or polyvinyl-lactophenol. Scanning electron micrographs (SEM) of spore surface and structure of capillitium were made using Jeol JSM-6380 LA (Jeol, Japan) and Quattro S (Thermo Fisher Scientific, USA). Specimens for SEM were mounted on copper stubs using nail polish and sputter-coated with gold-palladium.
Taxon names are according to Nomenmyx database (Lado, 2005-2023).
DNA EXTRACTION
Extraction of genomic DNA for Sanger sequencing was performed from matured air-dried sporophores without a trace of fungal contamination. Approximately 2-5 sporophores were placed in 2 ml plastic tubes with screw caps. Ceramic beads 3 mm in diameter were added, tubes were frozen at -20 °C for at least 30 min and samples were finally homogenized in a Bioprep-24 homogenizer (Hangzhou Allsheng Instruments, China) with three cycles of10 seconds at a speed of 6 m/sec, with intervals of 5 sec. DNA was extracted either with a PhytoSorb kit (Sintol, Russia) according to the manufacturer's protocol with minor modifications (spore homogenate was eluted with 450 ^l of extraction buffer; lysis buffer was added without preliminary precipitation step and supernatant transfer into a new sterile tube; final elution volume was 60-80 ^l).
Since magnetic bead-based methods of purification cause uncontrolled fragmentation of high molecular weight genomic DNA, DNA extraction from specimens of the key species of the families Amaurochaetaceae and Stemonitidaceae was carried out using a spin column-based kit ExtractDNA Blood and Cells (Evrogen, Russia). For this, up to 200 mg (up to 1 g in the case of Brefeldia maxima) of spore mass were resuspended in 100-200 ^l PBS solution (pH 7.4) and the mixture was incubated at room temperature for one hour. Cell lysis and DNA extraction were performed according to the manufacturer's protocol, with a final elution volume of 50 ^l for all samples except Brefeldia maxima (elution volume 70 ^l).
Table 1. Primer pairs and amplification protocols used in this study.
Name F/R Sequence (5' - 3') Amplification protocol
S2 F TGGTTGATCCTGCCAGTAGTGT 5 min at 95 °C, 36 cycles (30 sec at 95 °C, 20 sec at 56 °C, 50 sec at 72 °C) and 5 min at 72 °C
SSU_rev R AGACTTGTCCTCYAATTGTTAC
EF03 F TGATCTACAAGTGCGGTG 5 min at 95 °C, 35 cycles (30 sec at 95 °C, 30 sec at 60 °C, 120 sec at 72 °C) and 10 min at 72 °C
KEF_R3 R CCGTTCTTGATGTTCTTGG
EF04 F TGATCTACAAGTGCGGTG 5 min at 95 °C, 30 cycles (30 sec at 95 °C, 30 sec at 60 °C, 120 sec at 72 °C) and 10 min at 72 °C
KEF_R3 R CCGTTCTTGATGTTCTTGG
Kmit_F F AGTGTTATTCGTGATGACTGG 5 min at 95 °C, 32 cycles (30 sec at 95 °C, 30 sec at 52 °C, 60 sec at 72 °C) and 10 min at 72 °C
Kmit_R R CGAATTAAACCACATCTCCACC
DNA AMPLIFICATION AND SANGER SEQUENCING
To expand taxon sampling for a phylogenetic tree, three unlinked genetic markers were studied for different species of Stemonitidales and Lamp-rodermataceae (Physarales s.lat.) using Sanger sequencing. A fragment up to approximately 900 bp from the 5' end of the nuclear 18S rDNA gene (nrSSU), which is free ofintrons, was obtained with a forward primer S2 (Fiore-Donno et al., 2008) and a reverse primer SSU_rev (Prikhodko et al., 2023). A fragment ofthe protein-coding gene for the translation elongation factor 1-alpha (EF1a; exon fragment ca. 1075 bp) was obtained by a semi-nested PCR using a set of primers EF03(EF04)/KEF_R3 (Wrigley de Basanta et al., 2017; Ronikier et al., 2020). A mitochondrial ribosomal small subunit (mtSSU) gene fragment of approximately 350 to 500 bp in length was obtained with a primer pair Kmit_F/Kmit_R (Lado et al., 2022).
All attempts to amplify a fragment of the cyto-chrome c oxidase subunit 1 (COI) gene according to the protocol described in Prikhodko et al. (2023) for Amaurochaete spp. were unsuccessful, so we excluded this gene from the analysis and discussions.
List of the primers, their sequences, and amplification protocols for different primer combi-
nations are provided in Table 1.
PCR reactions were prepared with 2 * BioMaster HS-Taq PCR-Color reaction mix (Biolabmix, Russia) containing 50 mM KCl, 0.2 mM dNTPs, 2 mM MgCl2, 0.06 U/pl TaqDNA polymerase, 0.2% Tween20, several dyes (xylene cyanol, bromphenol blue, OrangeG, tartrazine) with addition of 3 nmol of each primer, 2 pl of template DNA and diluted with diH2O to obtain a total volume of 20 pl. The amplification was carried out via thermal cycler C1000 Touch (Bio-Rad, Hercules, CA, USA). Products ofamplification were stained with dsGreen (Lumiprobe Rus, Russia), separated by 1.2% agarose gel electrophoresis, observed in GelDoc Go (Bio-Rad, USA), and then purified using the CleanMag DNA (Evrogen, Russia) purification kit before being sequenced with the BrilliantDye Terminator v3.1 Cycle Sequencing Kit (NimaGen, the Netherlands). Sequencing products were purified with the Nimagen D-Pure DyeTerminator Cleanup kit, and then analyzed on ABI 3500 automated DNA sequencer (Applied Biosystems, USA) equipped with a standard 50 cm capillary array.
Low-pass genome sequencing
DNA of11 specimens (mostly Stemonitidales) was prepared for low-pass genome sequencing to obtain full-length sequences of the target genes. The spectral characteristics and DNA content of the DNA extracts were measured with an Implen P300 nanophotometer (Implen, USA) and Qubit 4 Fluorometer (Thermo Fisher Scientific, USA) using dsDNA HS Assay Kit. Further DNA quality control, library preparation and shotgun whole-genome sequencing were performed by third-party organizations. DNA library was prepared using MGIEasy Universal DNA Library Prep Set or Fast PCR-Free FS Library Prep Set (MGITech, China). The procedure included shearing gDNA sample by fragmentase or using Covaris ME220 (Covaris, USA), end-repair, adapter ligation and purification. After DNA library pooling, circularization and DNA nanoball making, sequencing with target coverage of the nuclear genome 2—3X was performed on DNBSEQ-G400 (MGITech, China) using DNBSEQ-G400RS High-throughput Sequencing Set providing single-end reads with 100 bp length (FCL SE100) or paired-end reads with 150 bp length (FCL PE150).
The resulting reads were assembled in contigs using SPAdes 3.15.4 (Prjibelski et al., 2020) with a
--careful flag for a more thorough error correction. Summary statistics were calculated using QUAST 5.2.0 (Mikheenko et al., 2018). Candidate sequences for orthologs of nrSSU, EFla and mtSSU were identified using local discontinuous MegaBLAST search across the obtained contigs against a custom-made reference BLAST database.
Sequence alignment and phylogenetic analyses
The newly obtained nrSSU, EF1a, and mtSSU sequences were assembled into three single gene alignments in Unipro UGENE (Okonechnikov et al., 2012), combined with the sequences deposited in NCBI GenBank, and aligned using MAFFT online service (Katoh and Standley, 2013; Katoh et al., 2019) with G-INS-i option for EF1a and E-INS-I option for nrSSU and mtSSU sequences with default gap penalties. After primer trimming, intron removal and manual editing, and shortening of excessively long contigs derived from genome data, three sets of nucleotide sequences were merged into a single alignment using SequenceMatrix 1.9 (Vaidya et al., 2011). The nrSSU sequences were analyzed as a single partition, while two separate partitions were defined for the EF1 a sequences: the first and second positions of each codon were analyzed separately from the third positions. The exon parts of the EF1a sequences were determined according to the sequence from Echinostelium bisporum (L.S. Olive et Stoian.) K.D. Whitney et L.S. Olive (GenBank MH814572) obtained from transcriptome data (Fiore-Donno et al., 2019). The mtSSU fragment was not analyzed in its entirety: a hypervariable fragment at the positions 2534 to 2749 was cut off for the analysis (see Supplementary material Files S1 and S2).
The final alignment consisted of 99 sequences with 2838 sites, 1803 distinct patterns, 315 singleton sites and 1295 non-informative (constant) sites. Maximum likelihood (ML) analyses were performed using IQ-TREE 1.6.12 (the last stable release; Nguyen et al., 2015) launched on a local machine. The SYM+I + G4 model was selected for the nrSSU partition according to the ModelFinder tool implemented in the program (Kalyaanamoorthy et al., 2017). HKY+F+R6 and GTR+F+G4 models were selected for the first two and third positions of each codon in EF1a partitions, respectively. GTR+F+I+G4 model was selected for the mtSSU partition.
Ultrafast bootstrap analysis with one thousand replicates (Hoang et al., 2018) was performed to obtain confidence values for the branches. Bayesian analysis was performed with the same dataset using mrBayes 3.2.7a (Huelsenbeck and Ronquist, 2001) run on CIPRES Science Gateway (Miller et al., 2010); the GTR+G+I model was applied. The analysis was run four times as four separate chains for 10 million generations (sampling every 1000). The convergence of MCMCMC was estimated using TRACER 1.7.2 (Rambaut et al., 2018); based on the estimates by TRACER, the first 2 million generations were discarded as burn-in. Posterior probabilities (PP) of splits were exported to the best-scoring ML-tree. Phylogenetic tree with combined supports was visualized using FigTree 1.4.4 and edited using CorelDRAW 24.0.
Results
Low-pass genome sequencing data analysis
The analysis ofthe low-pass genome sequencing (genome skimming) data yielded complete or nearly complete sequences ofnrSSU and mtSSU for all 11 specimens and complete or partial EF1 a sequences for 8 specimens (Table 2). Read coverage was 3—213 for nrSSU, 0-5 for EF1a and 22-1750 for mtSSU.
Phylogeny
A total of 85 nucleotide sequences were generated for this study. The list of newly obtained sequences, the concatenated alignment, and partition file can be found as Supplementary materials and in FigShare (https://doi.org/10.6084/m9.figshare.24595638). Fig. 1 shows the resulting three-gene phylogeny. The tree is rooted with Barbeyella minutissima Meyl. and Echinostelium bisporum (Echinosteliales), followed by the clade consisting of species of the genus Meriderma Mar. Mey. et Poulain (Meridermatales) and then by Lamproderma cacographicum Bozonnet, Mar. Mey. et Poulain. Members of the orders Stemonitidales s. str. and Physarales s. lat. form two moderately supported sister clades.
All species of the family Amaurochaetaceae sensu Leontyev et al. (2019) except for Amaurochaete trechispora, Stemonitopsis spp., and Stemonaria spp. form a weakly supported monophyletic clade. Within it, three species of the genus Amaurochaete
Table 2. Sequencing depth and coverage of the three target genes for the samples analysed using low-pass genome sequencing.
Genus Species Specimen Depth (Million bp) Contigs nrSSU coverage EF1 coverage mtSSU coverage
Meriderma carestiae LE316755 2017.55 167512 107 4 346
Amaurochaete atra MYX16954 1569.65 382380 91 2 1550
Comatricha nigra LE285120 1584.71 233774 115 5 423
Enerthenema papillatum LE325046 1868.36 254080 156 5 1750
Brefeldia maxima MYX22620 9 .8 9. 1336 3 0 22
Stemonaria longa LE317506 2143.75 761023 24 2 410
Stemonitis axifera LE344639 1403.28 157828 45 0 89
Stemonitis fusca LE325066 766.38 125991 31 0 404
Symphytocarpus amaurochaetoides LE278455 608.12 121409 21 2 486
Symphytocarpus flaccidus MYX16194 1662.54 233013 213 4 261
Lamproderma cacographicum LE296965 617.25 239519 15 1 335
with a thick cortex (A. tubulina (Alb. et Schwein.) T. Macbr., A. atra and A. comata G. Lister et Brândza) are united in a highly supported monophyletic clade. Species of the other genera of this family (Comatri-cha Preuss, Enerthenema Bowman, Paradiacheopsis Hertel) form a highly supported mixed clade sister to it. The only missing species of Amaurochaete in this phylogeny is A. fusiformis due to its rarity. Another aethalioid member of the family, Brefeldia maxima, occupies a weakly supported basal position in Amaurochaetaceae.
Species ofStemonitidaceae sensu Leontyev et al. (2019) form a moderately supported clade together with Amaurochaete trechispora, Stemonitopsis spp., and Stemonaria spp. Within it, Symphytocarpus trechisporus and Amaurochaete trechispora are united a highly supported clade. These species are characterized by dark brown coloration of the spore mass, reticulate spores, absence of a well-defined cortex, and confinement to habitats near upland bogs.
The type species of the genus Symphytocarpus, S. flaccidus with finely warted spores, forms a monophyletic clade together with a representative of the genus Stemonitis Gled., having light brown in mass, finely warted spores (Stemonitis axifera). In turn, Symphytocarpus amaurochaetoides characterized by dark brown, finely reticulate spores forms a common clade with a type species of the genus Stemonitis, S. fusca, and species of the genus Stemonaria Nann.-Bremek., R. Sharma et Y. Yamam. (S. gracilis Nann. -Bremek. et Y. Yamam. and S. fuscoides Nann.-Bremek. et Y. Yamam.), which also have dark brown or almost black coloration of spores in mass and finely reticulate spore ornamentation. Two analysed
species of Stemonitopsis (Nann.-Bremek.) Nann.-Bremek. do not group together: S. aequalis (Peck) Y. Yamam. is sister to Stemonitis flavogenita E. Jahn, while Stemonitopsis amoena (Nann.-Bre-mek.) Nann.-Bremek. is sister to the Stemonitis fusca-Ste-monaria-Symphytocarpus amaurochaetoides clade.
The genera Amaurochaete, Enerthenema, Paradiacheopsis, Stemonaria, Stemonitis, Stemonitopsis and Symphytocarpus thus appear to be non-mono-phyletic in the obtained three-gene phylogeny.
Morphology
See Supplementary File S3 for the list of examined specimens.
Symphytocarpus trechisporus (Berk. ex Torrend) Nann.-Bremek.
Sporophores are pseudoaethalia with irregular surface formed by densely arranged cylindrical sporangia, united at the base (Fig. 2, B) and free at the upper part, 3—7 mm high, dark brown (Fig. 2, C). Hypothallus practically inconspicuous, remaining only in the form of small fragments at the base of sporangia. Stalk is very short, black, visible only at the late stages of sporangia morphogenesis, after which it is hidden under the settling mass of capillitium and spores; hollow, horny (Fig. 2, H). Columella is black, sinuous, irregularly shaped, sometimes branching, not reaching the apex of the sporangium (Fig. 2, D, E, G). Capillitium branches off from the column throughout its entire length (Fig. 2, D, E, G) and is represented by coarse main filaments, which are abundantly branched and anastomosing, with many small dark spindle-shaped
- Barbeyella minutissima LE317265
- Echinostelium bisporum Nx14-A1
- Meriderma fuscatum MM20052 -Meriderma carestiae LE316755 -Meriderma verrucosporum MYX14637
_i— Lamproderma cacographicum LE285755
Lamproderma cacographicum LE296965
-Brefeldia maxima MYX22620
- Amaurochaete comata AMFD171
-Amaurochaete tubulina MYX5409
-Amaurochaete atra MYX16954
rtf
94/-
Comatricha nigra MA-Fungi 86360
Paradiacheopsis rígida s.lat. MYX10230 i Paradiacheopsis cf. fimbriata MYX11125 1 Paradiacheopsis cf. fimbriata MYX12630
Amaurochaete atra MYX5118 Amaurochaete atra MYX7921 Comatricha nigra LE285120
Co I I aria nigricapiilitia AMFD114
Enerthenema papiilatum s.lat. LE325046 Enerthenema papiilatum s.lat. MYX11511 Paradiacheopsis solitaria LE324610
> 3
Q> C -! O
o
3"
ü) CD
ST
O <D Q> CD
Enerthenema papiilatum s.lat. LE306300 Enerthenema papiilatum s.lat. LE307449
-Stemonitis flavogenita AMFD2005
Stemonitopsis aequalis MYX15509
I-Symphytocarpus trechispora LE279784
-1__i Amaurochaete trechispora MYX10595 Valtocarpus gen.nov.
* Amaurochaete trechispora MYX10597 J
Stemonitis axifera LE344639
- Stemonitis axifera LE344557
-Symphytocarpus flaccidus LE324698
- Symphytocarpus flaccidus MYX16194
- Stemonitopsis amoena LE348760
i-Stemonaria fuscoides MYX12516
1-Stemonaria gracilis MYX10257
li— Stemonaria longa LE317506 n—
- Symphytocarpus amaurochaetoides LE278455 - -r Symphytocarpus amaurochaetoides LE325884 r1— Stemonitis fusca LE325066 94/ij_i— Stemonitis fusca LE279120 99/r— Stemonitis fusca LE302352 _ - Lamproderma columbinum LE306695 - Lamproderma columbinum sc24099
(JO CD
3 o
3
s a 0) o
CD 0) CD
C/)
I-H
<D
3 o
3
s a! SL
CD
c/> </> \f)
_I Lamproderma crístatum LE305775
1 Lamproderma crístatum LE305796
_i Lamproderma vietnamiense LE317740 (Holotype)
* Lamproderma vietnamiense LE326172a _ . I Didymium meianospermum MYX15354 i Didymium meianospermum LE297645 100/0.97I Didymium meianospermum MA-Fungi 62790 i- Didymium clavus MA-Fungi 69756 1 Didymium clavus MYX8813 Didymium spongiosum MA-Fungi 82547 Didymium spongiosum LE328504 Didymium spongiosum MYX12015 ^ . |- Diderma globosum LE325799
"Hi Diderma globosum LE325132 1 Diderma globosum LE325793
1 Diderma radiatum MA-Fungi 98421 1 Diderma radiatum MYX9867 Diderma tigrinum MYX17121 Diderma tigrinum AM F D192 Diderma tigrinum SLS17578 r Polyschismium granuliferum AH26323 Polyschismium granuliferum KRAM M-1045 I Polyschismium perforatum MM39531 Polyschismium perforatum sc31390 10°(Polyschismium fallax AH50473 J1 Polyschismium fallax MM40366 ^Ir Polyschismium trevelyanii MA-Fungi 83531 T- Polyschismium trevelyanii Skrzypczak 20410^ Diachea leucopodia s.lat. LE325782 ^
Lamproderma s.str.
—Di
Didymium
Diderma s.str.
Polyschismium
D
a
<
3
55 o
CD &)
CD
I Diachea leucopodia s.lat. LE325782 r*H Diachea leucopodia s.lat. LE328364 » 1 Diachea leucopodia s.lat. LE328491
It Diachea mitchellii MA-Fungi 91227
Diachea mitchellii MA-Fungi 91212 (Holotype)
100/0.851 rtiarhoa mifrhollii MA.Funni QRAD7
Diachea s.str.
0.2
Diachea mitchellii MA-Fungi 96407 _
Nannengaella mellea MA-Fungi í Nannengaella mellea MA-Fungi 87986
1-Nannengaella globulifera MA-Fungi 51647
1 r- Nannengaella globulifera MA-Fungi 46711 L Nannengaella globulifera MA-Fungi 467.70
1 Fuligo séptica var. séptica MA-Fungi 41447 Fuligo séptica var. séptica MA-Fungi 71197 Fuligo leviderma MYX9557 Fuligo leviderma MYX9862
Fuligo luteonitens MM47217 Fuligo luteonitens MYX9198 _
Physarum viride var. incanum LE317320 Physarum viride var. incanum MYX12666 Physarum álbum s.lat. LE286342 Physarum álbum s.lat. LE286368 Physarum viride var. aurantium LE302489 Physarum viride var. aurantium LE317322 r Physarum álbum s.lat. MA-Fungi 52375 "L Physarum álbum s.lat. MYX7904 Physarum leucophaeum MA-Fungi 59323 Physarum leucophaeum MA-Fungi 64418
<
V) Q)
SL o
(/>
(/) 5T
Nannengaella
Fuligo s.str.
Physarum s.str.
<
0) 0)
0) o 0 fi) 0
Fig. 1. Maximum-likelihood phylogenetic tree of the orders Stemonitidales and Physarales obtained from concatenated nrSSU, EF1a, and mtSSU sequences using IQ-Tree. Bold font indicates the type species of a genus. Branch supports are shown only for UBS/PP > 80/0.8; black dots indicate maximum supports in both analyses (UBS/PP = 100/1); scale bar represents the mean number of nucleotide substitutions per site. The nomenclature used in the tree is checked against the current version of the nomenclature database of Lado (2005-2023).
Fig. 2. Morphology of Symphytocarpus trechisporus (= Valtocarpus trechisporus) (A—L — MYX 18560; M—O
— LE 279784). A — Plasmodium; B — immature pseudoaethalium; C — mature pseudoaethalium; D—E — columella and capillitium (LM); F — fragment of capillitium (LM); G — end of columella and capillitium (LM); H —hypothallus and base of stalk (LM); I, J — spores in different optical sections (LM); K — spore (SEM); L
— columella and capillitium (SEM); M — fragment of the peripheral capillitium network (TL); H — fragment of the internal capillitium network (TL); O — spores (TL). Scale bars: A—C — 10 mm; D, E — 100 pm; F—H, M, N — 50 pm; I, J, O — 10 pm; K — 1 pm; L — 30 pm.
thickenings and with extensions at branching sites (Fig. 2, F, G, N), gradually thinning to the periphery ofthe sporangium, forming only few elements ofthe peripheral network (Fig. 2, L, M) in those places where sporangia do not touch each other. Spores dark brown to almost black in mass; violet-brown in transmitted light, 10—12 pm in diameter, reticulate with small-meshed net, with 25—35 meshes per visible spore hemisphere (Fig. 2, I, J, O). SEM shows that the network on the spore surface is formed by continuous vertical ridges, without perforations (Fig.
2, K). Plasmodium is white, turning pink and then brown when the sporangium matures (Fig. 2, A, B).
Amaurochaete trechispora T. Macbr. et G.W. Martin
Sporophores are pseudoaethalia (Fig. 3, A) formed by individual sporangia, sessile or subsessile, up to 2—7 cm in diameter and to 1 cm high. Individual sporangia are cylindrical (Fig. 3, B), sometimes club-shaped, dark olive-brown to grayish-yellowish-brown, merging together at the lower part. Peridium easily disappears at sporangium maturation, remaining only as a very thin, easily destroyed, practically transparent membrane covering sporangia (Fig. 3, B), sometimes remaining as small flake-like fragments attached to capillitium threads. Hypothallus poorly developed, thin, membranous, shining, dark yellowish-brown, with violet tint, light brown in transmitted light. Stalk inconspicuous, not more than 0.3 mm long, black, opaque, expanded, irregular at base; dark olive-brown, horny in transmitted light, gradually passing to hypothallus. Columella irregular, sinuous, often branching, with membranous extensions, reaching almost to the apex of the sporangium, opaque in transmitted light, except olive-brown extensions. Capillitium is rather lax, arising from the columella along its entire length, weakly connected with the columella, with thin irregular threads 2—3 pm in diameter (Fig. 3, C, F, G), with small spindle-shaped thickenings (Fig.
3, F) and membranous (up to 9 pm in diameter) expansions at junctions (Fig. 3, C). The filaments branch and anastomose, forming a large-meshed surface net with many thinning free ends. Spores dark olive-brown in mass; dark orange-yellow in transmitted light, globose, rarely somewhat ellipsoid, with uniformly thickened wall (Fig. 3, E), reticulate, with large-meshed net, 8—13 meshes per visible spore hemisphere (Fig. 3, D), 13—15 pm in diameter with ornamentation and 10—12 pm without. SEM shows that reticulation of the spores
is formed by ridges without perforations (Fig. 3, H). Plasmodium is unknown.
Notes: The most characteristic features of this species are dense pseudoaethalia, which develop on the surface of mosses in waterlogged areas, and spores ornamented with high ridges 1.2—2 pm high, forming a large-meshed network with 8—13 cells per visible part of the spore.
Amaurochaete atra (Alb. et Schwein.) Rostaf.
The main distinguishing characters of this species are the presence of a long-lasting dark cortex (Fig. 4, A), which is covered outside with a network corresponding to the apexes ofindividual sporangia, as well as capillitium represented by separate thick filaments, abundantly branching in the upper part and not forming a dense network (Fig. 4, B, C, D, G). Spores are 12—15 pm in diameter, finely warted, with irregularly thickened wall (Fig. 4, E, F, H).
Amaurochaete tubulina (Alb. et Schwein.) T. Macbr.
This species is characterized by the presence of a dense cortex (Fig. 4, I), which is preserved in the form of large translucent fragments that remain attached to the end of the capillitium net (Fig. 4, J, K, L, O). Our specimens were characterized by a yellowish-brown cortex, on the surface ofwhich the network corresponding to the sporangia boundaries was not visible. Spores were 12—14 pm in diameter finely warted, with an irregularly thickened wall (Fig. 4, M, N, P).
Symphytocarpus amaurochaetoides Nann.-Bremek.
Sporophores are dark brown, almost black pseudoaethalia, consisting of densely grouped individual sporangia, up to 5 mm high (Fig. 5, A, B). Peridium completely evanescent. Capillitium dense, coarse, branching off from the columella along its entire length and represented by dark brown threads with extensions at the branching points and with short stifffree ends at the periphery (Fig. 5, C, D, G). Spores are 8—10 pm in diameter, spinose-reticulate, spore wall uniformly thickened (Fig. 5, E, F, H).
Symphytocarpusflaccidus (Lister) Ing et Nann.-Bremek.
Sporophores are light brown pseudoaethalia (Fig. 5, I, J). Peridium of individual sporangia is almost completely destroyed and remains only in the form of separate flakes attached to the ends of
Fig. 3. Morphology of Amaurochaete trechispora (= Valtocarpus megaloplegmus) (MYX 10594). A — Pseudoaethalium; B — fragment of pseudoaethalium; C, F — capillitium and spores (LM); D, E —spores in different optical sections (LM); G — capillitium and spores (SEM); H — spore (SEM). Scale bars: A — 5 mm; B — 500 pm; C — 20 pm; D-G — 10 pm; H — 2 pm.
capillitium filaments. Capillitium is represented by a loose network with a large number of free endings (Fig. 5, K, L. O). Spores are 7-10 pm in diameter, verrucose, spore wall uniformly thickened (Fig. 5 M, N, P).
Brefeldia maxima (Fr.) Rostaf.
Sporophores are dark reddish-brown dense pseudoaethalia with irregular surface of cortex formed by apexes of separate sporangia (Fig. 6, A). The peridium almost completely disappears during sporangium formation and is preserved as a thin transparent film covering the surface of sporangia,
easily destroyed by the slightest mechanical impact. Capillitium is well developed, represented by dark filaments, which are abundantly branching and anastomosing and contain chamber bodies in the central part (Fig. 6, B, C, D, G, I, J). Spores are 9—12 pm in diameter, finely warted, with irregularly thickened wall (Fig. 6, E, F, H).
Discussion
The results of the phylogenetic analysis show that species of the order Stemonitidales sensu Le-
Fig. 4. A-H - Morphology of Amaurochaete atra (A-G — MYX 22638; H — MYX 16954). A — Cortex surface; B, C —pseudocapillitium in reflected light; D — pseudocapillitium (LM); E, F — spores in different optical sections (LM); G — pseudocapillitium (SEM); H — spore (SEM). I-P - Morphology of Amaurochaete tubulina (MYX 5409). I — Cortex surface; J, K — pseudocapillitium in reflected light; L— pseudocapillitium (LM); M, N — spores in different optical sections (LM); O — pseudocapillitium (SEM); P — spores (SEM). Scale bars: A-C, I — 400 pm; D, G, L, O — 50 pm; E, F, M, N — 10 pm; H, P — 3 pm; J, K — 200 pm.
Fig. 5. A-H - Morphology of Symphytocarpus amaurochaetoides (A-F — LE 278455; G-H MYX 7126). A — Fragment of pseudoaethalium; B — columella and capillitium after the dispersal of spores in reflected light; C — columella and capillitium (LM); D — fragment of columella and capillitium (LM); E-F — spores in different optical sections (LM); G — capillitium (SEM); H — spore (SEM). I-P - Symphytocarpus flaccidus (I-N MYX16194; O-P MYX 7330). I — Fragment ofpseudoaethalium; J — pseudoaethalium; K, L — fragment of columella and capillitium (LM); M-N — spores in different optical sections (LM); O — capillitium (SEM); P — spore (SEM). Scale bars: A, B, I — 500 ^m; C — 100 ^m; D, K, O — 50 ^m; E, F, M, N — 10 ^m; G — 20 ^m; H — 3^m; J — 5 mm; L — 20 ^m; P — 1 ^m.
H
¿J X A
Fig. 6. Morphology of Brefeldia maxima (A-F, I — MYX 22620; G, H, J — MYX 3279). A — Pseudoaethalia; B, C, I — champer bodies in capillitium (LM); D — an expanded fragment of capillitium with attached filaments (LM); E, F — spores in different optical sections (LM); G — chamber body and attached spores (SEM); H — spore (SEM); J — fragment of chamber body with attached filaments (SEM). Scale bars: A — 1 cm, B — 50 pm, C-G, I — 10 pm, H, J — 2 pm.
ontyev et al. (2019) with moderate support form a monophyletic group. Our data also support the separation of the families Amaurochaetaceae and Stemonitidaceae, which are divided into separate clades with weak and moderate support, respectively.
Within the family Amaurochaetaceae, genera Amaurochaete and Brefeldia occupy the basal position. If within the genus Amaurochaete we consider only species having dense cortex, three out of four species considered in this study form a monophyletic clade with maximal support. A. fu-
siformis is the only species of Amaurochaete that we have not been able to examine. The specimens of A. atra and A. tubulina examined by us corresponded to the morphological diagnoses given in the literature (Martin and Alexopoulos, 1969; Ing, 1999; Adamonyte, 2010) and were characterized by coarse capillitium represented by individual tree-like branched filaments in A. atra and much finer, spongy capillitium forming a three-dimensional network in A. tubulina. In agreement with literature data, the sporophores of A. comata are characterized by relatively small size and weakly branching and
anastomosing, almost straight capillitium filaments (Moreno et al., 2018). All members of this clade possess finely warted spores.
The main feature of the genus Brefeldia is the presence of chamber bodies in the structures of the capillitium (Fig. 6, B, C, I, J, see also Martin and Alexopoulos, 1969; Ing, 1999; Adamonytè, 2010). At the same time, unlike in Amaurochaete, the formation of a dense cortex is not characteristic for this genus (Fig 4, A, I).
Thus, our data support the validity of separation and correctness ofmorphological diagnoses used for the genera Amaurochaete and Brefeldia.
The phylogenetic analysis of Stemonitidaceae has demonstrated a number of complex phylogenetic relationships within this group. According to our results, four highly supported major clades can be distinguished within the family. The first clade unites species with warted-reticulate spores. This clade includes Stemonitis fusca (type species of the genus Stemonitis), Symphytocarpus amaurochaetoides, Stemonitopsis amoena, Stemonaria gracilis, S. longa (Peck) Nann.-Bremek., R. Sharma et Y. Yamam., and the type species of the genus Stemonaria: S. fus-coides. It is important to note that in this phylogene-tic group, there are species with both fibrous and horny stalks. Thus, this feature, previously proposed for the separation ofthe families Amaurochaetaceae and Stemonitidaceae, has shown its inconsistency.
The second clade includes species with finely warted spores. In the present study, it includes only Stemonitis axifera and Symphytocarpus flaccidus, which is a type species of the genus Symphytocarpus.
The third clade unites species also with minutely warted spores. This clade includes Stemonitopsis ae-qualis and Stemonitis flavogenita.
The fourth clade with maximum support includes representatives of two species: Amaurochaete trechispora and Symphytocarpus trechisporus. These two species inhabit coniferous-broadleaved forests growing on the border of upland bogs, and form sporophores either on leaf litter or directly on mosses of the genera Sphagnum spp. and Polytrichum spp. Sporophores of both species are represented by compact pseudoaethalia, and their distinctive feature from other representatives of the genus Symphytocarpus is the presence of a truly reticulate ornamentation of spores formed by continuous ridges on the spore surface (Fig. 2, I—K, O; Fig. 3, C—H). The specimens of A. trechispora studied by us did not possess dense cortex (Fig. 3, A, B). Only a thin translucent film, which corresponds to
the peridium of individual sporangia, stays on the surface of sporangia of this species after maturation. Of all the species studied, the closest to A. trechispora is S. trechisporus, which has similar ecology and morphology of sporangia. It is important to note that the type species ofthe genus Symphytocarpus, S. flaccidus, does not form a monophyletic group with these species (Fig. 1). For this reason, we propose a new genus Valtocarpus for these two species.
With the simultaneous transfer of Symphytocarpus trechisporus (Berk. ex Torrend) Nann.-Bremek. and Amaurochaete trechispora T. Macbr. et G.W. Martin to a new genus, their names would become homonymic, and for this reason we propose a new combination for S. trechisporus (V. trechisporus) and a replacement name for A. trechispora (V. megaloplegmus) as required by the Shenzhen Code (Art. 6.11).
Taxonomic inference
Valtocarpus Gmoshinskiy, Prikhodko, Bortni-kov, Shchepin et Novozh. gen. nov.
MycoBank: MB 850647
Etymology: From Greek Расход — bog and карпод — fruit. Refers to a habitat associated with sphagnum bogs.
Sporophores are pseudoaethalia consisting of sporangia tightly pressed together. Stalks of sporangia are hollow, horny. Columella is irregular, branched. Capillitium branches offfrom the column along its entire length and forms a loose network with fusiform swellings and many free endings. Spores are dark brown in mass, reticulate; network on the spore surface is formed by continuous vertical ridges. Fruiting happens in forests near sphagnum bogs or in waterlogged forests on mosses of genera Sphagnum L. and Polytrichum Hedw., small twinges and leaf litter.
Type species: Valtocarpus trechisporus (Berk.) Gmoshinskiy, Prikhodko, Bortnikov, Shchepin et Novozh.
Valtocarpus trechisporus (Berk. ex Torrend) Gmoshinskiy, Prikhodko, Bortnikov, Shchepin et Novozh. comb. nov.
MycoBank: MB 850648
Basionym: Stemonitisfusca var. trechispora Berk. ex Torrend, Broteria, Ser. Bot. 7:81 (1908).
= Stemonitis trechispora (Berk. ex Torrend) T. Macbr., N. Amer. Slime-moulds, ed. 2, 159 (1922)
= Symphytocarpus trechisporus (Berk. ex Torrend) Nann.-Bremek., in Ing et Nannenga-Bre-mekamp, Proc. Kon. Ned. Akad. Wetensch., C. 70(2):219 (1967)
Valtocarpus megaloplegmus Gmoshinskiy, Prikhodko, Bortnikov, Shchepin et Novozh. nom. nov.
MycoBank: MB 850650
Etymology: from Greek ^sya^og — big and nlsy^a — net.
Replaced synonym: Amaurochaete trechispora T. Macbr. et G.W. Martin, in Martin, J. Wash. Acad. Sci. 22(4):89 (1932).
= Lachnobolus trechisporus (T. Macbr. et G.W. Martin) Lado, Cuad. Trab. Fl. Micol. Iber. 16:49 (2001).
Conclusion
The study demonstrates monophyly and correctness of morphological diagnoses for the genera Amaurochaete and Brefeldia after the transfer of Amaurochaete trechispora to the new genus Valtocarpus with a new epithet. At the same time, the polyphyletic nature of the genus Symphyto-carpus is shown. The studied species occupy different phylogenetic positions within the clade corresponding to the family Stemonitidaceae. The obtained results demonstrate the inadequacy of the use of the stem fibrousness feature for the separation of the families Amaurochaetaceae and Stemonitidaceae. Thus, the morphological diagnoses ofthe families should be further corrected. Within the family Stemonitidaceae, the key feature for distinguishing phylogenetic groups appears to be spore ornamentation rather than sporophore type or the structure of the peripheral capillitium network, which should warrant a revision of the morphological diagnoses and species now considered within the genera Stemonaria, Stemonitopsis, Stemonitis, and Symphytocarpus in further studies. The monophyletic group within the family Stemoni-tidaceae that includes Symphytocarpus trechisporus and Amaurochaete trechispora that have similar spore ornamentation, structure of sporophores and ecological peculiarities, is described here as a new genus Valtocarpus.
Acknowledgments
DNA extraction, low-pass genome sequencing of samples and bioinformatic analysis of the data were fully supported by the Russian Science Foundation (project No. 22-24-00747; https://rscf.ru/ project/22-24-00747/).
We acknowledge the use ofequipment ofthe Core Facility Center "Cell and Molecular Technologies in Plant Science" at the Komarov Botanical Institute ofthe Russian Academy of Sciences (BIN RAS, St. Petersburg). We express our gratitude to the staff of the Interdepartmental Electron Microscopy Laboratory (ILEM) of the Faculty of Biology, MSU. We are grateful to Nadezhda I. Kireeva for help in preparing the illustrations for the current study. We are also grateful to Andrey Komissarov and Margarita Korzhanova from the Smorodintsev Research Institute of Influenza for their help with low-pass genome sequencing.
References
Adamonyte G. 2010. Lithuanian Stemonitales (Myxomycetes). Genera Amaurochaete and Brefel-dia. Bot. Lith. 16 (2): 75-82.
Borzov N.I., Bortnikov F.M., Matveev A.V. and Gmoshinskiy V.I. 2021. First data on plasmodial slime moulds (Myxomycetes = Myxogastrea) of Rdeysky Nature Reserve (Novgorod Region, Russia). Novosti Sist. Nizsh. Rast. 55 (2): 361-377. https://doi.org/10.31111/nsnr/2021.55.2.361
Eliasson U.H. 2000. Observations on the genus Amaurochaete (Myxomycetes), and a European record of A. trechispora. Karstenia. 40: 31-38. https://doi.org/10.29203/ka.2000.348
Fiore-Donno A.M., Meyer M., Baldauf S.L. and Pawlowski J. 2008. Evolution of dark-spored Myxomycetes (slime-molds): molecules versus morphology. Mol. Phylogenetics Evol. 46(3): 878889. https://doi.org/10.1016/j.ympev.2007.12.011 Fiore-Donno A.M., Tice A.K. and Brown M.W. 2019. A non-flagellated member of the Myxogastria and expansion of the Echinosteliida. J. Eukaryot. Microbiol. 66 (4): 538-544. https:// doi.org/10.1111/jeu.12694
Garcia-Martin J.M., Zamora J.C., Lado C. 2023. Multigene phylogeny of the order Physarales (Myxomycetes, Amoebozoa): shedding light on the dark-spored clade. Persoonia. 51: 89-124. https:// doi.org/10.3767/persoonia.2023.51.02
Hoang D.T., Chernomor O., von Haeseler A., Minh B.Q. and Vinh L.S. 2018. UFBoot2: Improving the ultrafast bootstrap approximation. Mol. Biol. Evol. 35: 518-522.
Huelsenbeck J.P. and Ronquist F. 2001. MrBa-yes: Bayesian inference of phylogeny. Bioinforma-tics. 17: 754-755. https://doi.org/10.1093/bioinfor-matics/17.8.754
Ing B. 1999. The myxomycetes of Britain and Ireland. Richmond Publishing company, London.
Ing B. and Nannenga-Bremekamp N.E. 1967. Notes of Myxomycetes XIII. Symphytocarpus nov. gen. Stemonitacearum. Proc. K. Ned. Akad. Wet. C. 70 (2): 217-231.
Kalyaanamoorthy S., Minh B.Q., Wong T.K.F., von Haeseler A. and Jermiin L.S. 2017. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat. Methods. 14: 587-589. https://doi. org/10.1038/nmeth.4285
Katoh K. and Standley D.M. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 30(4): 772-780. https://doi. org/10.1093/molbev/mst010
Katoh K., Rozewicki J. and Yamada K.D. 2019. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 20 (4): 1160-1166. https://doi.org/10.1093/bib/bbx108
Kuhnt A. 2019. Bemerkenswerte Myxomyceten funde: Neue Arten, Neukombinationen und Nachweise seltener Arten, Teil 2. Ber. Bayer. Bot. Ges. 89: 139-221.
Lado C. 2005-2023. An on-line nomenclatural information system of Eumycetozoa. Available online at: http://www.eumycetozoa.com
Lado C., Trevico-Zevallos I., Garcia-Martin J.M. and Wrigley de Basanta D. 2022. Diachea mitchellii: a new myxomycete species from high elevation forests in the tropical Andes of Peru. My-cologia. 114 (4): 798-811. https://doi.org/10.1080 /00275514.2022.2072140
Leontyev D.V. 2016. The evolution ofsporopho-re in Reticulariaceae. Ukr. Bot. J. 73 (2): 178-184. https://doi.org/10.15407/ukrbotj73.02.178
Leontyev D.V., Schnittler M., Stephenson S.L., Novozhilov Y.K. et al. 2019. Towards a phylogenetic
classification of the Myxomycetes. Phytotaxa. 399 (3): 209-238. https://doi.org/10.11646/phytotaxa. 399.3.5
Lister A. 1925. A monograph of the Mycetozoa being a descriptive catalogue of the species in the Herbarium of the British Museum. [Revised by G. Lister]. British Museum (Natural History), London.
Macbride T.H. 1922. The North American Slime-Moulds. A Descriptive List of All Species of Myxomycetes Hitherto Reported from the Continent of North America, with Notes on Some Extra-Limital Species. MacMillan, New York. https://doi.org/10.5962/bhl.title.33432
Martin G.W. 1932. New species of slime moulds. J. Wash. Acad. Sci. 22 (4): 88-92.
Martin G.W. and Alexopoulos C.J. 1969. The Myxomycetes. Iowa University Press, Iowa.
Mikheenko A., Prjibelski A., Saveliev V., Anti-pov D. et al. 2018. Versatile genome assembly evaluation with QUAST-LG. Bioinformatics. 34(13): i142—i150. https://doi.org/10.1093/bioin-formatics/bty266
Miller M.A., Pfeiffer W. and Schwartz T. 2010. Creating the CIPRES Science Gateway for inference oflarge phylogenetic trees. Gateway Computing Environments Workshop (GCE). IEEE, New Orleans. P. 1—8. https://doi.org/10.1109/GCE. 2010.5676129
Moreno G., Castillo A. and Thüs H. 2018. Critical revision of type material of Stemonitales (Myxogastria) at the Natural History Museum London (BM). Phytotaxa. 344 (2): 149—159. https:// doi.org/10.11646/phytotaxa.344.2.3
Nannenga-Bremekamp N.E. and Härkönen M. 1979. Symphytocarpus fusiformis (Myxomycetes) a new species from Finland. Proc. K. Ned. Akad. Wet. C. 82 (3): 371—374.
Nguyen L.T., Schmidt H.A., von Haeseler A. and Minh B.Q. 2015. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 32 (1): 268—274. https://doi.org/10.1093/molbev/msu 300
Okonechnikov K., Golosova O., Fursov M. UGENE team. 2012. Unipro UGENE: a unified bioinformatics toolkit. Bioinformatics. 28: 1166— 1167. https://doi.org/10.1093/bioinformatics/ bts091
Poulain M., Meyer M. and Bozonnet. 2011. Les Myxomycetes. Tome 1, guide de determination. Mycologique et botanique Dauphine -Savoie, Sevrier.
Prikhodko I.S., Shchepin O.N., Bortnikova N.A., Novozhilov Y.K. et al. 2023. A three-gene phylogeny supports taxonomic rearrangements in the family Didymiaceae (Myxomycetes). Mycol. Progr. 22 (2): 11. https://doi.org/10.1007/s11557-022-01858-1
Prjibelski A., Antipov D., Meleshko D., Lapidus A. et al. 2020. Using SPAdes de novo assembler. Curr. Protoc. Bioinform. 70: e102. https://doi. org/10.1002/cpbi.102
Rambaut A., Drummond A.J., Xie D., Baele G., et al. 2018. Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Syst. Biol. 67: 901— 904. https://doi.org/10.1093/sysbio/syy032
Ronikier A., Garcia-Cunchillos I., Janik P. and Lado C. 2020. Nivicolous Trichiales from the austral Andes: unexpected diversity including two new species. Mycologia. 112 (4): 753—780. https:// doi.org/10.1080/00275514.2020.1759978
Torrend C. 1908. Les Myxomycètes. Étude des Espèces connues jusqu'ici. Brotéria, Sèr. Bot. 7: 81.
Vaidya G., Lohman D.J. and Meier R. 2011. SequenceMatrix: concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics. 27: 171—180. https://doi.org/10.1111/j.1096-0031.2010.00329.x Wrigley de Basanta D., Estrada-Torres A., Garcia-Cunchillos I., Cano Echevarria A. et al. 2017. Didymium azorellae, a new myxomycete from cushion plants of cold arid areas of South America. Mycologia. 109(6): 993-1002. https://doi.org/10. 1080/00275514.2018.1426925
Supplementary material
File S1. Concatenated alignment. File S2. Partition file in RAxML format. File S3. List of specimens providing the basis for the morphological descriptions.
Table S1. List of sequences used in this study.
