CC BY
3Research Results in Pharmacology
Research Results in Pharmacology 9(4): 75-83 UDC: 57.084.1 DOI 10.18413/rrpharmacology.9.10058
Neuroprotective properties of Na/H+-exchanger isoform-1 inhibitor in experimental POAG
Anna S. Pobeda1, Alexander A. Spasov2, OlgaN. Zhukovskaya3, Kristina V. Shchurovskaya4, Nikolai V. Solovev5, Valentina A. Kulikovskaya6, Vladimir M. Pokrovsky1, Evgeny A. Patrakhanov1, Anastasia V. Turpakova1, Anna I. Ustinova1
1 Belgorod State National Research University, 85 Pobecly St., Belgorod 308015 Russia
2 Volgograd State Medical University, Department of Pharmacology! and Bioinformatics, 1 Pavshikh Bortsov Sq., Volgograd 400131 Russia
3 Research Institute of Physical and Organic Chemistry, Southern Federal University, 194/2 Stachki Ave., Rostov-on-Don 344090 Russia
4 Regional State Budgetary Institution of Healthcare "Children's Regional Clinical Hospital", 44 Gubkina St., Belgorod 308024 Russia
5 OOO Diagnosticheskiy tsentr "Zreniye", 15 Kolomyazhsky Ave., Big. 2, St. Petersburg 191023 Russia
6 Regional State Budgetary Institution of Healthcare "Belgorod Regional Clinical Hospital of St. Joasaph", 8/9 Nekrasova St., Belgorod 308007 Corresponding author: Anna S. Pobeda (pobedaixibsu.edu.ru)
Academic editor: Oleg Gudyrev ♦ Received 02 August 2023 ♦ Accepted 19 November 2023 ♦ Published 21 December 2023
Citation: Pobeda AS, Spasov AA, Zhukovskaya ON, Shchurovskaya KV, Solovev NV, Kulikovskaya VA, Pokrovsky VM, Patrakhanov EA, Turpakova AV, Ustinova AI (2023) Neuroprotective properties of Na+/H+-exchanger isoform-1 inhibitor in experimental POAG. Research Results in Pharmacology 9(4): 75-83. https://doi.Org/10.18413/rrphannacology.9.10058
Introduction: Worldwide glaucoma is the leading cause of irreversible vision loss. The processes associated with the loss of retinal ganglion cells are multifactorial and have much in common with neurodegenerative diseases. Therefore the search for means to prevent the death of retinal neurons is an important task of modem pharmacology.
Materials and Methods: The study was conducted on male Wistar rats. Glaucoma was modeled by injecting a 1% solution of hyaluronic acid into the anterior chamber of the eye. The IOP level was recorded on the 0th, 63rd and 73rd days of the experiment. The effectiveness of the drugs was evaluated based on the results of ophthalmoscopy, electroretinography, followed by the determination of gene expression.
Results and Discussion: In the group with RU-1355 correction, the fundus picture improved; the index in the group was 18.0% lower compared to the model. The introduction of the RU-1355 compound provided an increase in the a-wave amplitude by 18.1%, and b-wave amplitude by 39.0% relative to the group with pathology. The most pronounced effect was observed on the expression level of BDNF, Bcl-2, Caspase 3 and NF-kB p65, which indicates that the compound has the capacity to influence the slowdown of the apoptosis process through an increase in the neurotrophic factor and the anti-apoptotic factor Bcl-2.
Conclusion: RU-1355 has neuroprotective properties, which was expressed by a decrease in ophthalmoscopic manifestations, preservation of the b-wave amplitude of the electroretinogram and the influence on gene expression of factors involved in apoptosis and neuroprotection. Based on the pharmacological activity of the RU-1355 compound in relation to POAG, further study of its action against other retinal diseases is promising.
Abstract
Copyright Probed AS. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC-BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Graphical Abstract
Neuroprotective properties of a type 1 Na+/H+ exchanger inhibitor in experimental POAG in rats
Group
1) Intact group (n=10)
2) POAG (n=10)
3) Negative control (n=10)
4) POAG+ RU-1335 (1,12mg/kg)(n=10)
5) POAG + Zoniporide (1 mg/kg) (n=10) _
6) POAG + Timolol (0,009ml/kg)(n=10)
Study design
25 mcl Hyaluronic acid
injection into the anterior chamber of the eye
Instillation of group 6 once for 10 days
Itraperitoneal injection of the drug in group 4 and 5 once for 10 days
IOP level,ERG, C0 2 euthanasia ophthalmoscopy
-ff-
Day
Created in BioRender.com bio
Keywords
Intraocular pressure, retinal ganglion cells, glaucoma, neurodegeneration, ophthalmoscopy, retina, electroretinography
Introduction
Worldwide glaucoma is the leading cause of irreversible vision loss. The processes associated with the loss of retinal ganglion cells are multifactorial and have much in common with neurodegenerative diseases (Beykin et al. 2021). Worldwide there are more than 60 million people with glaucomatous optic neuropathy, of which 8.4 million are blind. The global incidence of glaucoma is expected to rise to 111.8 million by 2040 (Downs 2015).
The most common clinical sign of glaucoma is increased intraocular pressure (IOP). Under conditions of increased IOP, there is a decrease in eye perfusion, which causes oxygen and nutritional starvation, which leads to disruption of cell energy metabolism and the accumulation of free radicals. In addition, under conditions of increased intraocular pressure, the retrograde transport of neurotrophins is disrupted and the internal pathway of apoptosis is activated (Qu et al. 2010). Also a prolonged increase in IOP in combination with oxidative stress and neurotrophin deprivation leads to a malfunction in the regulation of the local immune response, which causes a neuroinflammatory process that contributes to the progression of the disease (Baudouin et al. 2020).
Current drug therapy aimed at reducing IOP does not
always stop the process of vision loss. Moreover the disease can progress despite significant IOP control (Pitts et al. 2022).
Therefore, there is a need to search for drugs that can prevent the progression of the disease and protect ganglion cells in the context of ongoing pathological processes (Boia et al. 2020).
Given the critical importance of neuronal death in the pathogenesis of many disorders and neurodegeneration being mediated by multiple mechanisms that may overlap (Fan et al. 2017), a better understanding of the types, mechanisms, and roles of neuroprotection is lundamental to the development of strategies to combat neurodegeneration in glaucoma (Monteiro et al. 2017).
The role of Na+/H+-exchanger isoform-1 (NHE-1) in cerebral ischemia, disorders of the cardiovascular system, and the effect on the atioxidant system of the body and the blood system have been extensively studied (Perfilova et al. 2019; Ovsyankina 2022; Spasov et al. 2022).
Considering that NHE-1 is widely expressed in various tissues including the retina and has a wide range of actions, the study of compounds of this type in neuroprotection in glaucoma is very promising.
The aim of the study was to study the pharmacological activity of the NHE-1 inhibitor, compound RU-1355, in an experimental model of primary open-angle glaucoma (POAG).
Materials and Methods
Animals
Ethical principles for experiments on laboratory rats were observed in accordance with the European Convention for the Protection of Vertebrate Animals Used for Experimental and Other Scientific Purposes, ETS No. 123. Animals were obtained from the nursery of the Research Institute of Pharmacology of Living Systems, Russia. Experimental studies were carried out on male rats (6 groups, 10 animals in each group); for the experiment, there were selected animals weighing 180-220 g. All manipulations on rats were carried out under general anesthesia with intraperitoneal injection of chloral hydrate solution. The experiments were approved by the Local Ethics Committee of Belgorod State National Research University, Belgorod, Russia (Minutes No. 08/19 of March 12, 2019).
Design of the Experiment
The following groups were included in the experiment: 1) intact group; 2) group with a model of primary open-angle glaucoma (POAG); 3) negative control group; 4) group with POAG correction with NHE-1 inhibitor, RU-1355, compound at a dose of 1.12 mg/kg; 5) group with POAG correction with zoniporide at a dose of 1.0 mg/kg (Sigma Aldrich, USA); 6) group with POAG correction with timolol, 0.5% eye drops (Pharmaceutical Manufacturer "Renewal", Russia) at a dose of 0.009 mL/ kg instillation.
The study compounds were administered daily at the same time in the morning for 10 days. In the correction groups of RU-1355 at a dose of 1.12 mg/kg and zoniporide at a dose of 1.0 mg/kg, the compounds were administered intraperitoneally. In the group with timolol, eye drops 0.5%, instillation (inst.) of 0.002 mL was carried out, which corresponds to the conversion of doses
from humans to rats. The test compounds were administered from the 63rd day of the study once a day of the study once a day for 10 days daily.
Experimental glaucoma was modeled in rats for 9 weeks by introducing a 1% solution of hyaluronic acid (Sigma Aldrich, USA) in a volume of 25 цЬ into the anterior chamber of the eye (Moreno et al. 2005; Kalatanova et al. 2021). General anesthesia (chloral hydrate at a dose of 300 mg/kg) with continuous monitoring of the depth of anesthesia was used to carry out all painful and animal-immobilizing manipulations.
The IOP level was determined on the 0th, 63rd and 73rd days of the experiment. On the 73rd day of the experiment after recording control parameters (IOP, ophthalmoscopy, electroretinography (ERG)), the animals were euthanized in a CO2 chamber, followed by retinal sampling to determine gene expression.
Intraocular pressure
The IOP level in laboratory animals was determined using an Icare® TONOVET tonometer (Finland) (Dolzhikov et al. 2020).
Ophthalmoscopy
Ophthalmoscopy to study the fundus of laboratory rats was performed using a V78C lens, Volk Optical (USA). A detailed description was provided earlier (Pobeda et al. 2021). For further statistical processing, the degree of changes in the fundus was assessed in points (Table 1), the points were summed for each criterion for the animal and the data in the group were calculated as the average of all animals in the group.
Electroretinography
The electrophysiological study was performed after a 30-minute dark adaptation on the software and hardware complex of Biopac System, Inc. (USA) according to the previously described method (Shchurovskaya et al. 2021).
Table 1. The scale of evaluation of the ocular fundus during ophthalmoscopy on the POAG model
Parameter
Assigned point
2
General view of the retina
Pink, uniform in all parts
The retina is pale; there are almost white areas of ischemia
The retina is pale, with white areas of ischemia, thinned; there are areas of retinal hemorrhages
ONH
ONH excavation
Pale pink, clear borders
There is no excavation or it takes no more than 10% of the diameter of ONH
Pale, pale gray, clear borders
Excavation is extended, but does not reach the edge of the disc
Gray, clear borders
The excavation reaches the edge of the disk or total
Neuroretinal belt
Course of vessels through excavation
Uniform throughout
Smooth course
Local or general slight thinning
Slight bending of the vessel at the site of ONH excavation
Marked thinning
Sharp bending of a vessel at the site of excavation or slight bending of 2 or more vessels
Arteries
Veins
Smooth course, not convoluted, uniform caliber, in a 2:3 ratio with the veins
Smooth course, not convoluted, uniform caliber, in a 2:3 ratio with the arteries
Narrowed, smooth course, uniform caliber
Convoluted, expanded, uniform caliber
Filamentous, convoluted, uneven caliber
Sharply convoluted, dilated, microaneurysms, small hemorrhages along the veins, uneven caliber
0
1
Quantitative PCR
Quantitative polymerase chain reaction was carried out according to the standard procedure described earlier (Pobeda et al. 2022). Primers were selected using the Primer-BLAST resource (NCBI, USA) (Table 2).
Table 2. List of primers
The most significant decrease was achieved in the group with the comparison drug timolol; with its use IOP decreased by 35.6% of the values in the group with the model, which is explained by its pharmacodynamic effect.
Gene
ACTB F ACTB R Opal F Opal R BDNF F BDNF R NF-kB p65 F NF-kB p65 R Bax F Bax R Bcl-2 F Bcl-2 R Caspase 3 F Caspase 3 R
Primer sequence (5W3')
GACATCCGTAAAGACCTCTATGCC ATAGAGCCACCAATCCACACAGAG ACACCAGGTGACCACGAGAA AGGCGGGGGTAGTTGTTCTT TTGATGAGACCGGGTTCCCT ACTCAGGGTCCACACAAAGC TTCCCTGAAGTGGAGCTAGGA CATGTCGAGGAAGACACTGGA
TCACGTGACCGGGGCG TGATCTGTTCAGAGCTGGTGG GGTGAACTGGGGGAGGATTG AGAGCGATGTTGTCCACCAG GAGCTTGGAACGCGAAGAAA GAGTCCATCGACTTGCTTCCA
Annealing temperature (°C)
59
6l
60
61.3
6l
6l
60.4
Statistical data processing
The obtained results were subjected to statistical processing using Microsoft Excel 2016 and Statistica 10 (StatSoft, USA). For quantitative indicators, standard descriptive statistics were calculated: the average and the standard error of the average. For intergroup comparisons of average quantitative indicators of independent groups, Student's t-test or U-test (Mann-Whitney test) was used depending on the type of distribution of indicators (normal/abnormal). Using statistical procedures, the differences were considered statistically significant at values of p<0.05 (Pobeda et al. 2023).
Results and Discussion
Results of IOP level examination
The IOP level was calculated in each group, the values of which are presented in Fig. 1.
Modeling glaucoma on the 63rd day of the study, an increase in IOP by 2.3-2.5 times was observed in groups with pathology modeling in comparison with the group of intact animals (p<0.05).
On day 73 of the study, a slight decrease in IOP was observed in the group with the introduction of Na+/H+-exchanger isoform-1 inhibitors, compared with the group with the model. This is probably due to the effect of Na+/ H+ exchanger inhibitors on the production of aqueous humor (Naumenko et al. 2021; Spasov et al. 2021).
Figure 1. The results of determining the IOP level on the POAG model. (A) 0 day of the experiment, (B) 63 day of the experiment, (C) 73 day of the experiment. Note: * - p<0.05 in comparison with intact group; # - p<0.05 in comparison with POAG group; y - p<0.05 in comparison with negative control group; x - p<0.05 in comparison with zoniporide group; z - p<0.05 in comparison with timolol group.
Results of ophthalmoscopic examination
An example of an ophthalmoscopic picture of the fundus of an intact animal is shown in Figure 2a. The ophthalmoscopic picture of the fundus of the animals was characterized by uniform pink-yellow coloring of the retina in all areas. ONH is clearly visible, pink, lies in the plane of the retina. Veins and arteries are of uniform caliber, not convoluted; their ratio is 3:2.
Pallor of the retina with areas of retinal hemorrhages and thinning were observed in the group with glaucoma modeling (Fig. 2b). The optic disc was pale and often turned gray. There was an increase in the excavation of
Figure 2. Ophthalmoscopic picture of the fundus in rats on the 73rd day of the experiment: (a) an animal of the intact group; (b) an animal of the POAG group; (c) animal of the negative control group; (d) animal with correction of RU-1355 at a dose of 1.12 mg/kg; (e) animal with correction of zoniporide at a dose of 1 mg/kg; (f) animal with correction of timolol at a dose of 0.009 mL/kg.
the optic disc and thinning of the neuroretinal belt. The caliber and course of veins and arteries changed as well as and their bending through excavation increased. Hemorrhages were observed along the course of the veins.
The ophthalmoscopic picture of the fundus in the negative control group did not differ from the intact animals group (Fig. 2c).
An improvement in the ophthalmoscopic picture of the fundus in the group with the introduction of RU-1355 (Fig. 2d) was observed due to the general appearance of the retina, a decrease in the pallor of the fundus, the degree of grayness of ONH and a significant improvement in the vascular component; the caliber of the vessels was uniform throughout; the ratio of veins and arteries was approaching normal, and vascular tortuosity remained.
In the group with the introduction of zoniporide, the pallor of the retina remained, the optic nerve disk retained a grayish color, and changes in the caliber and course of the veins and arteries remained (Fig. 2e).
In the group with the treatment regimen of timolol administration, the ophthalmoscopic picture of the fundus did not improve significantly, the pallor of the retina remained, the optic nerve disc acquired a grayish color, and changes in the caliber and course of the veins and arteries persisted (Fig. 2f).
The results of ophthalmoscopic fundus evaluation in each group are presented in Fig. 3.
In the group with pathology modeling, the index of the ophthalmoscopic picture of the fundus was 10.0±0.4, which significantly differed from those in the intact animals group and the negative control group (p<0.05). Thus, in animals with increased IOP, the changes
observed on the fundus are close to the same changes as in people suffering from POAG.
The introduction of RU-1355 improved the fundus picture. The index in the group was 18.0% lower than in the group with the pathology model and was significantly different from those in the group with the pathology model, the intact animals group and the negative control group (p<0.05).
In the group with zoniporide introduction, the index was comparable to the values in the timolol group, 9.1±0.4 and 9.3±0.4 points, respectively, which significantly differed from the indices in the intact animals group and the negative control group (p<0.05).
Figure 3. Results of ophthalmoscopic evaluation of the ocular fundus during correction of retinal damage with Na+/H+-exchanger isoform-1 inhibitor on the POAG model. Note: * - p<0.05 in comparison with intact group; # - p<0.05 in comparison with POAG group; y - p<0.05 in comparison with negative control group; x - p<0.05 in comparison with zoniporide group; z - p<0.05 in comparison with timolol group.
Results of ERG examination
The a-wave and b-wave amplitudes were determined in each group (Fig. 4).
In the intact animals group, the amplitude of the a-wave of ERG was 116.0±6.7 (iV and the b-wave was 205.4±8.8 ^V.
On the 73rd day of the study, the a-wave amplitude in the group with the model decreased by 29.9% compared to that in the intact group; this index was significantly different (p<0.05). The b-wave amplitude decreased by 35.8% compared to that in the intact group and the index was significantly different (p<0.05).
Figure 4. Results of an electrophysiological study for the correction of retinal damage with Na+/H+-exchanger isoform-1 inhibitor on a POAG model (M±m; n=10), ^V. Note: * - p<0.05 in comparison with intact group; # - p<0.05 in comparison with POAG group; y - p<0.05 in comparison with negative control group; x - p<0.05 in comparison with zoniporide group; z - p<0.05 in comparison with timolol group.
The introduction of the RU-1355 compound provided an increase in the a-wave amplitude relative to the group with the pathology model by 18.1%, while this index was significantly different from that in the intact animals group (p<0.05) and not statistically significantly different from those in the group with pathology model and the negative control group. The b-wave amplitude increased by 39.0% relative to the group with the model and was statistically significantly different from those of the intact group, the group with the pathology model and timolol group (p<0.05).
In the group of animals administered with zoniporide, the a-wave amplitude increased by 10.5% and the b-wave amplitude increased by 27.2% relative
to the group with the pathology model; these indexes were significantly different from those in the intact animals group and the negative control group (p<0.05); the a-wave amplitude was also significantly different from that in the group with the pathology model (p<0.05).
In the group of animals administered with timolol, the a-wave amplitude increased by 6.6% and the b-wave amplitude by 17.1% relative to the group with the pathology model; these indexes were significantly different from those in the intact animals group and the negative control group (p<0.05), but not significantly different from that in the group with the pathology model (p>0.05).
Results of evaluation changes in gene expression
The choice in determining the expression of a particular gene was determined by its participation in the implementation of apoptosis or a possible role in neuroprotection.
The results of the determination of gene expression are presented in Fig. 5.
The administration of the substance RU-1355 relative to the group with pathology modeling resulted in: a decrease in the expression level of the Caspase 3 gene by 42.2% (p<0.05); a decrease in the expression of the NF-kB p65 gene by 43.9%, which was significantly different from those in both the group with the pathology model and the intact animals group (p<0.05); an increase in the expression of the Opa1 gene by 28.6%, which was significantly different from those in both the group with the pathology model and the intact animals group (p<0.05); the level of expression of the BDNF gene increased 2.8 times, which was significantly different from that in the group with the pathology model (p<0.05); the expression level of the Bax gene was 24.6% lower, which was significantly different from that in the group with the pathology model (p<0.05); the expression level of the Bcl-2 gene increased by 83.7%, which was significantly different from those in the group with the pathology model, the intact animals group and the negative control (p<0.05).
Conclusion
The above results show that the presented model of POAG is accompanied by a high level of IOP, which leads to characteristic ophthalmoscopic, electrophysiological changes in the retina with subsequent changes in gene expression.
The most pronounced neuroprotective results were observed in the group with the correction by using RU-1355. This was expressed by a decrease in ophthalmoscopic manifestations, the greatest preservation of b-wave amplitude and changes in gene expression. Compared to the group with the pathology model, there was a decrease in the expression of the Caspase 3, NF-kB p65, Bax genes and an increase in the expression of the Opa1, BDNF, Bcl-2 genes. The most pronounced effect was observed on the expression level of BDNF, Bcl-2, Caspase 3 and NF-kB p65, which indicates that the compound has the possibility to influence the slowdown of the apoptosis process through an increase in the neurotrophic factor and the anti-apoptotic factor Bcl-2.
Figure 5. Effect of Na+/H+-exchanger isoform-1 inhibitor, RU-1355 on gene expression in the retina during POAG modeling. Note: * - p<0.05 in comparison with intact group; # - p<0.05 in comparison with POAG group; y - p<0.05 in comparison with negative control group.
Conflict of interests
The authors declare no conflict of interests.
Acknowledgments
The authors have no support to report.
Funding
RU-1355 was synthesized with financial support by the Ministry of Science and Higher Education of the Russian Federation, grant FENW-2023-0011.
References
Baudouin C, Kolko M, Melik-Parsadaniantz S, Messmer EM (2021) Inflammation in glaucoma: from the back to the front of the eye, and beyond. Progress in Retinal and Eye Research 83: 100916. https:// doi.org/10.1016/j.preteyeres.2020.100916 [PubMed] Beykin G, Norcia AM, Srinivasan VJ, Dubra A, Goldberg JL (2021) Discovery and clinical translation of novel glaucoma biomarkers. Progress in Retinal and Eye Research 80: 100875. https://doi.org/ 10.1016/j.preteyeres.2020.100875 [PubMed] [PMC] Boia R, Ruzafa N, Aires ID, Pereiro X, Ambrosio AF, Vecino E, Santiago AR (2020) Neuroprotective strategies for retinal ganglion cell degeneration: current status and challenges ahead. International Journal of Molecular Sciences 21(7): 2262. https://doi.org/10.3390/ ijms21072262 [PubMed] [PMC]
Dolzhikov AA, Shevchenko OA, Pobeda AS, Peresypkina AA, Dolzhikova IN, Zhunusov NS, Lugovskoy SS (2020) Review of a new concept of glaucoma pathogenesis based on the glymphatic theory of cerebrospinal fluid circulation. Research Results in Pharmacology 6(3): 1-7. https://doi.org/10.3897/ rrpharmacology. 6.53634
Downs JC (2015) Optic nerve head biomechanics in aging and disease. Experimental Eye Research 133: 19-29. https://doi.org/ 10.1016/j.exer.2015.02.011 [PubMed] [PMC] Fan J, Dawson TM, Dawson VL (2017) Cell death mechanisms of neurodegeneration. Advances in Neurobiology 15: 403-425. https:// doi.org/10.1007/978-3-319-57193-5_16 [PubMed] Kalatanova AV, Pobeda AS, Abasheva DA, Dolzhikov AA, Peresypkina AA, Pokrovskii MV (2021) Electroretinography in evaluation of neuroprotective effect in an experimental model of glaucoma. Bulletin of Ophthalmology [Vestnik Oftalmologii] 137(3): 86-92. https://doi.org/10.17116/oftalma202113703186 [PubMed] [in Russian]
Monteiro MC, Coleman MD, Hill EJ, Prediger RD, Maia CS (2017) Neuroprotection in neurodegenerative disease: from basic science to clinical applications. Oxidative Medicine and Cellular Longevity: 2949102. https://doi.org/10.1155/2017/2949102 [PubMed] [PMC] ' Moreno MC, Marcos HJ, Oscar Croxatto J, Sande PH, Campanelli J, Jaliffa CO, Benozzi J, Rosenstein RE (2005) A new experimental model of glaucoma in rats through intracameral injections of hyaluronic acid. Experimental Eye Research 81(1): 71-80. https:// doi.org/10.1016/j.exer.2005.01.008 [PubMed] Naumenko LV, Taran AS, Sokolova EV, Govorova YuA, Ozerov AA (2021) Effect of quinazoline derivatives - Na+/H+ exchanger inhibitors on intraocular pressure. Bulletin of Medical Science [Byulleten' Medicinskoj Nauki] 3(23): 79-82. https://doi.org/ 10.31684/254184752021379 [in Russian]
Ovsyankina NV (2022) The effect of new 4,6-diphenylpyrimidine derivatives on the sodium-hydrogen exchange of rabbit platelets in vitro. Mechnikov Readings-2022: Materials of the 95th All-Russian Scientific and Practical Student Conference with International Participation, Saint-Petersburg. Vol. Part II: 224-225. [in Russian]
Perfilova VN, Gurova NA, Popova TA, Vishnevskaja VV, Ozerov AA, Kustova MV, Ovsjankina NV (2019) Effect of NHE-1 inhibitors zoniporide and VMA-1321 on the level of lipid peroxidation products and enzymes of the antioxidant system in the heart mitochondria of animals with chronic heart failure. Bulletin of Volgograd State Medical University [Vestnik Volgogradskogo Gosudarstvennogo Meditsinskogo Universiteta] 3(71): 62-65. https://doi.org/10.19163/1994-9480-2019-3(71)-62-65 [in Russian]
Pitts KM, Neeson CE, Hall NE, Lin JB, Falah HK, Wang SL, Lo KT, Song CE, Margeta MA, Sola-Del Valle DA (2022) Neurodegeneration markers galectin-3 and apolipoprotein e are elevated in the aqueous humor of eyes with glaucoma. Translational Vision Science & Technology 1(11): 1. https://doi.org/10.1167/ tvst.11.11.1 [PubMed] [PMC]
Pobeda AS, Kalatanova AV, Abashev DA, Dolzhikov AA, Solovev NV, Shchurovskaya KV, Chernyaeva SS, Kolesnik IM (2021) Study to elucidate the pharmacological activity of retinalamin in a rat model of ischemic retinopathy. Research Results in Pharmacology 7(2): 39-48. https://doi.org/10.3897/rrpharmacology7.67390 Pobeda AS, Soloviev NV, Chernyaeva SS, Efimenko SV (2022) Changes in gene expression in the retina during intravitreal injection of NMQ4. Russian National Ophthalmological Forum 2: 432-433. [in Russian]
Pobeda AS, Soloviev NV, Pokrovskii MV, Skachilova SYa, Efimenko SV, Simakina EA, Bashuk VV, Proskurina OV, Dolzhikov AA, Nesterova NI (2023) The effect of new 3-hydroxypyridine derivatives on NMDA-induced retinal neurodegeneration. Experimental and Clinical Pharmacology 86(3): 11-16. https://doi.org/10.30906/0869-2092-2023-86-3-11-16 [in Russian]
Qu J, Wang D, Grosskreutz CL (2010) Mechanisms of retinal ganglion cell injury and defense in glaucoma. Experimental Eye Research 91(1): 48-53. https://doi.org/10.1016/j.exer.2011.07.014 [PubMed] [PMC]
Shchurovskaya KV, Pobeda AS, Pokrovskii MV, Solovev NV, Kulikovskaya VA, Peresypkina AA, Shutov VI, Puchenkova OA, Shabalin AA (2021) Protective effect of asialized erythropoietin in modelling of retinal ischemia-reperfusion. Journal of Research in Medical And Dental Science 9(8): 286-290.
Spasov A, Ozerov A, Vassiliev P, Kosolapov V, Gurova N, Kucheryavenko A, Naumenko L, Babkov D, Sirotenko V, Taran A, Litvinov R, Borisov A, Klochkov V, Merezhkina D, Miroshnikov M, Uskov G, Ovsyankina N (2021) Synthesis and multifaceted pharmacological activity of novel quinazoline NHE-1 inhibitors. Scientific Reports 11: 24380. https://doi.org/10.1038/ s41598-021-03722-w [PubMed] [PMC]
Spasov AA, Muravyeva VYu, Gurova NA, Ovsyankina NV (2022) Neurotropic effects of sodium-hydrogen exchanger isoform 1 inhibitors. Medicinal Bulletin [Meditsinskii Vestnik] 23(1): 30-37. [in Russian]
Author Contributions
■ Anna S. Pobeda, PhD in Biological Sciences, Associate Professor of Department of Pharmacology and Clinical Pharmacology; e-mail: pobeda@bsu.edu.ru; ORCID ID: https://orcid.org/0000-0002-0541-8946. The author took part in conceptualization and direction development of the research, generation of key aims and objectives conducting experimental work, analysing the material, writing, and editing the text of the article.
■ Alexander A. Spasov, Doctor Habil. of Medical Sciences, Full Professor, Member of the Russian Academy of Sciences, Head of the Department of Pharmacology and Bioinformatics; e-mail: aspasov@mail.ru; ORCID ID: https://orcid.org/0000-0002-7185-4826. The author consulted on the research idea, concept, and design of the study.
■ Olga N. Zhukovskaya, PhD in Chemical Sciences, Researcher in the Laboratory of Organic Synthesis; e-mail: zhukowskaia.ol@yandex.ru; ORCID ID: https://orcid.org/0000-0003-0865-6656. The author took part in synthesis of the substances and consulted on the research idea.
■ Kristina V. Shchurovskaya, MD, ophthalmologist; e-mail: kristinka-i@yandex.ru. The author took part in conducting experimental work and analysing the material.
■ Nikolai V. Solovev, MD, ophthalmologist; e-mail: morkovkapro@mail.ru. The author took part in conducting experimental work and analysing the material.
Valentina A. Kulikovskaya, MD, ophthalmologist; e-mail: Valentina.kulikovskaya@gmail.com. The author took part in conducting experimental work and analysing the material.
Vladimir M. Pokrovsky, junior researcher of the Scientific Research Institute of Pharmacology of Living Systems; e-mail: vmpokrovsky@yandex.ru; ORCID ID: https://orcid.org/0000-0003-3138-2075. The author took part in the experimental work, analysis of the material and editing the manuscript.
Evgeny A. Patrakhanov, junior researcher of the Research Institute of Pharmacology of Living Systems; email: pateval7@gmail.com; ORCID ID https://orcid.org/0000-0002-8415-4562. The author took part in the experimental work, analysis of the material, and editing the manuscript.
■ Anastasia V. Turpakova, 4th-year student at the Medical Institute; e-mail: 1516173@bsu.edu.ru. The author took part in conducting experimental work.
■ Anna I. Ustinova, 6th- year student at the Medical Institute; e-mail: 1303025@bsu.edu.ru. The author took part in conducting experimental work.
