CC BY
23
© Коллектив авторов, 2022
Шиловский И.П.1, Барвинская Е.Д.1, Никольский А. А.1, Никонова А.А.1' 2, Смирнов В.В.1, 3, Ковчина В.И.1, Вишнякова Л.И.1, Юмашев К.В.1, 4, Каганова М.М.1 4, Русак Т.Е.3, Митин А.Н.1, Комогорова В.В.1, Литвина М.М.1, Шарова Н.И.1, Кудлай Д. А.1' 3, Хаитов М.Р.1' 5
Модель респираторно-синцитиальной вирусной инфекции у мышей, имитирующая основные проявления патологии человека
1 Федеральное государственное бюджетное учреждение «Государственный научный центр «Институт иммунологии» Федерального медико-биологического агентства, 115522, г. Москва, Российская Федерация
2 Федеральное государственное бюджетное научное учреждение «Научно-исследовательский институт вакцин и сывороток им. И.И. Мечникова» Министерства науки и высшего образования Российской Федерации, 105064, г. Москва, Российская Федерация
3 Федеральное государственное автономное образовательное учреждение высшего образования «Первый Московский государственный медицинский университет имени И.М. Сеченова» Министерства здравоохранения Российской Федерации (Сеченовский Университет), 119991, г. Москва, Российская Федерация
4 Федеральное государственное бюджетное образовательное учреждение высшего образования «Московская государственная академия ветеринарной медицины и биотехнологии - МВА имени К. И. Скрябина» Министерства сельского хозяйства Российской Федерации, 109472, г. Москва, Российская Федерация
5 Федеральное государственное автономное образовательное учреждение высшего образования «Российский национальный исследовательский медицинский университет имени Н.И. Пирогова» Министерства здравоохранения Российской Федерации, 117997, г. Москва, Российская Федерация
Резюме
Введение. Респираторно-синцитиальный вирус человека (RSV) - одна из распространенных причин воспаления нижних дыхательных путей у детей и лиц пожилого возраста. Заболевание, вызванное RSV-инфекцией, является серьезной проблемой здравоохранения и характеризуется высокой распространенностью и смертностью, особенно среди детей. На сегодняшний день на фармацевтическом рынке отсутствуют зарегистрированные вакцины, а также доступные препараты для профилактики и лечения данной патологии. Одним из основных препятствий в разработке новых подходов к терапии RSV-инфекции является отсутствие универсальной модели на животных, которая бы воспроизводила основные проявления этой патологии человека.
Цель исследования - с использованием очищенного и концентрированного вируса создать модель RSV-инфекции на лабораторных мышах линии BALB/c, имитирующую основные проявления патологии человека.
Материал и методы. Мышей разделяли на 4 группы (n = 10). Животных 1-й группы (RSV hd) заражали интраназально очищенным штаммом RSV A2 в высокой дозе 5 • 106 БОЕ/мышь в объеме 50 мкл фосфатно-солевого буфера. Мыши 2-й группы (RSV 1d) получали неочищенный вирус в низкой дозе 105 БОЕ/мышь. Мышей 3-й группы (RSV-UV) инфицировали высокой дозой вируса (5 • 106 БОЕ/мышь), но инактивированного ультрафиолетовым излучением. Животных 4-й группы (Intact) не подвергали манипуляциям. Измеряли следующие показатели: гиперреактивность дыхательных путей, состав клеток в образцах бронхоальвеолярного лаважа (БАЛ), тяжесть воспаления и уровни провоспалительных цитокинов в легких. Контроль массы тела животных проводили ежедневно. В отдельных экспериментах мыши, инфицированные высокой дозой (5 • 106 БОЕ/мышь) очищенного RSV, получали перорально рибавирин, 2 раза в день, в дозе 85 мг/кг, в течение 5 дней.
Результаты. После заражения животных высокой дозой вирус детектировался в дыхательных путях в течение 5 дней. Кроме того, регистрировали потерю веса на 12 % на 3-й день, что свидетельствует об успешном инфицировании. Кроме того, представленный протокол позволяет индуцировать важные проявления патологии человека: гиперреактивность дыхательных путей, метаплазию бокаловидных клеток эпителия бронхов и воспаление легких, выражающееся в инфильтрации респираторного тракта провоспалительными клетками. Экспрессия генов провоспалительных цитокинов (Ifng и Tbet) у инфицированных мышей была увеличена по сравнению с интактными. При этом экспрессия генов ТЪ2-цитокинов (Il4, Il13 и Gata3) существенно не изменилась после заражения. Эти данные свидетельствуют
Для корреспонденции
Барвинская Екатерина Драгановна -младший научный сотрудник лаборатории противовирусного иммунитета
ФГБУ «ГНЦ Институт иммунологии» ФМБА России, Москва, Российская Федерация E-mail: [email protected] https://orcid.org/0000-0002-9407-7054
о способности продуктивно реплицироваться в дыхательных путях, вызывать воспаление в ткани легких и поляризовать иммунный ответ в сторону ТЫ-типа. Также мы исследовали влияние рибавирина на репликацию ЯЕУ в текущей модели и оценили корреляцию между вирусной нагрузкой и выраженностью признаков патологии. Пероральное введение рибавирина существенно снижало вирусную нагрузку в легких, что приводило к уменьшению числа провоспалительных клеток в БАЛ и уменьшению гиперреактивности дыхательных путей. Таким образом, данная модель чувствительна к известным противовирусным препаратам и может быть полезна для тестирования новых средств против
Заключение. Мы описали экспериментальную модель Я^У-инфекции у мышей, в которой воссозданы основные проявления патологии человека. Эту модель можно использовать для тестирования новых препаратов против этого патогена, а также для изучения иммунопатогенеза Я^У-инфекции.
Ключевые слова: респираторно-синцитиальный вирус человека; модель на мышах; моделирование патологии человека
Статья получена: 10.06.2022. Принята в печать: 11.07.2022.
Для цитирования: Шиловский И.П., Барвинская Е.Д., Никольский А. А., Никонова А.А., Смирнов В.В., Ков-чина В.И., Вишнякова Л.И., Юмашев К.В., Каганова М.М., Русак Т.Е., Митин А.Н., Комогорова В.В., Литвина М.М., Шарова Н.И., Кудлай Д.А., Хаитов М.Р. Модель респираторно-синцитиальной вирусной инфекции у мышей, имитирующая основные проявления патологии человека. Иммунология. 2022; 43 (4): 423-439. Б01: https://doi.org/10.33029/0206-4952-2022-43-4-423-439 (англ.)
Финансирование. Исследование выполнено при финансовой поддержке Российского научного фонда в рамках научного проекта № 22-25-00182.
Конфликт интересов. Авторы заявляют об отсутствии конфликта интересов.
Вклад авторов. Концепция и дизайн исследования - Шиловский И.П., Смирнов В.В., Хаитов М.Р., Митин А.Н.; сбор и обработка материала - Барвинская Е.Д., Никольский А.А., Ковчина В.И., Вишнякова Л.И., Юмашев К.В., Каганова М.М., Русак Т.Е., Комогорова В.В., Литвина М.М., Шарова Н.И.; статистическая обработка - Барвинская Е.Д., Юмашев К.В.; написание текста - Барвинская Е.Д., Шиловский И.П.; редактирование - Каганова М.М., Кудлай Д. А., Никонова А.А.
Shilovskiy I.P.1, Barvinskaia E.D.1, Nikolskii A.A.1, Nikonova A.A.1, 2,
Smirnov V.V.1' 3, Kovchina V.I.1, Vishnyakova L.I.1, Yumashev K.V.1' 4,
Kaganova M.M.1 4, Rusak T.E.3, Mitin A.N.1, Komogorova V.V.1,
Litvina M.M.1, Sharova N.I.1, Kudlay D.A.1 3, Khaitov M.R.1 5
Mouse model of respiratory syncytial virus infection mimicking acute human pathology
1 National Research Center - Institute of Immunology of the Federal Medico-Biological Agency, 115522, Moscow, Russian Federation
2 I. Mechnikov Research Institute of Vaccines and Sera of the Ministry of Science and Higher Education of the Russian Federation, 105064, Moscow, Russian Federation
3 I.M. Sechenov First Moscow State Medical University of the Ministry of Health of the Russian Federation (Sechenov University), 119991, Moscow, Russian Federation
4 Moscow state Academy of Veterinary Medicine and Biotechnology - MVA named after K.I. Skryabin of the Ministry of Agriculture of the Russian Federation, 109472, Moscow, Russian Federation
5 N.I. Pirogov Russian National Research Medical University of the Ministry of Health of the Russian Federation, 117997, Moscow, Russian Federation
Abstract
Introduction. Human respiratory syncytial virus (RSV) is one of the common causes of lower respiratory tract inflammation in children and elderly persons. RSV infection being a serious public health problem is characterized by high morbidity and mortality, especially in children. There are no licensed vaccines and inexpensive medications for RSV prevention and treatment. The lack of universal animal model which mimics all aspects of human pathology is one of the main obstacles to develop new therapy approaches.
The aim of the study was to develop the model of RSV infection using BALB/c mice and purified and concentrated virus, which allows reproducing the main features of human pathology.
For correspondence
Ekaterina D. Barvinskaia -Junior Researcher of the Antiviral Immunity Laboratory, NRC Institute of Immunology FMBA of Russia, Moscow, Russian Federation E-mail: [email protected] https://orcid.org/0000-0002-9407-7054
Material and methods. Mice were divided into 4 groups (n = 10). Animals of the 1st group (RSV hd) were intranasally infected with purified RSV strain A2 at a high dose of 5 • 106 pfu/ mouse in a volume of 50 mcl of phosphate buffered saline. The 2nd group (RSV ld) received non-purified virus at low dose 105 pfu/mouse. Мice of the 3rd group (RSV-UV) were treated with the same dose (5 • 106 pfu/mouse) and volume (50 mcl) of the UV-inactivated RSV. Animals of the 4th group (Intact) were left untreated. The following indicators were measured: the airway hyperreactivity, cell composition in broncho-alveolar lavage (BAL) samples, the severity of inflammation and levels of pro-inflammatory cytokines in lungs. The body weight of the animals was monitored daily throughout the experiment. In separate experiments mice infected with high dose (5 • 106 pfu/mouse) of purified RSV received ribavirin orally twice a day in dose 85 mg/kg for 5 days.
Results. The virus was detected in the respiratory tract of animals for 5 days after the infection. Additionaly, a 12% body weight loss was observed on day 3, indicating successful infection. Presented protocol allows to induce many manifestations of the human pathology such as: increased airway hyperreactivity (AHR), mucus secreting goblet cell metaplasia in the bronchial epithelium and lung inflammation associated with the proinflammatory cell infiltration. Proinflammatory cytokine genes (Ifng and Tbet) expression was increased compared to intact mice. At the same time, the expression of Th2 cytokines gens (Il4, Il13 and Gata3) didn't change significantly after infection with RSV These data indicate the ability of RSV productively replicate in the respiratory tract, induce pulmonary inflammation and shift the immune response toward Th1-type. We also investigated the effect of ribavirin treatment on the replication of RSV in the current model and how it correlated with lung inflammation and airway hyperreactivity. In the experiment, oral daily administration of ribavirin significantly reduced viral load in lungs and lymphocytes number in the BAL. In addition, improvement in airway hyperreactivity was observed after ribavirin-mediated suppression of RSV replication. Thus, this model is sensitive to known antiviral drugs and may be useful for testing new drugs against RSV
Conclusion. We described the experimental model of RSV infection in mice. This model mimics the main features of human pathology. The described model can be useful for the testing of novel anti-RSV drugs and further understanding of RSV infection immunopathogenesis.
Keywords: human respiratory syncytial virus; murine models; human pathology modeling
Received: 10.06.2022. Accepted: 11.07.2022.
For citation: Shilovskiy I.P., Barvinskaia E.D., Nikolskii A.A., Nikonova A.A., Smirnov V.V., Kovchina V.I., Vishnya-kova L.I., Yumashev K.V, Kaganova M.M., Rusak T.E., Mitin A.N., Komogorova V.V., Litvina M.M., Sharova N.I., Kudlay D.A., Khaitov M.R. Mouse model of respiratory syncytial virus infection mimicking acute human pathology. Immunologiya. 2022; 2022; 43 (4): 423-39. DOI: https://doi.org/10.33029/0206-4952-2022-43-4-423-439
Funding. The study was supported by Russian Science Foundation grant No. 22-25-00182.
Conflict of interests. The authors declare no conflict of interests.
Authors contribution. Study conception and design - Shilovskiy I.P., Smirnov V.V., Khaitov M.R., Mitin A.N.; material collection and processing - Barvinskaia E.D., Nikolskii A.A., Kovchina V.I., Vishnyakova L.I., Yumashev K.V., Kaganova M.M., Rusak T.E., Komogorova V.V., Litvina M.M., Sharova N.I.; statistical processing - Barvinskaia E.D., Yumashev K.V.; manuscript preparation - Barvinskaia E.D., Shilovskiy I.P.; editing - Kaganova M.M., Kudlay D.A., Nikonova A.A.
Introduction
The Human orthopneumovirus (formerly human respiratory syncytial virus - RSV) belongs to order Mononega-virales, family Pneumoviridae, genus Orthopneumovirus. RSV - the most common pathogen causing a serious illness of the upper and lower airways. Especially this pathogen is dangerous for newborns, young children, elderly people, immunocompromised hosts and also for patients suffering from inflammatory diseases of the respiratory tract [1], such as bronchial asthma and chronic obstructive pulmonary disease [2]. According to epidemiological studies RSV is
identified in up to 80 % of children hospitalized with respiratory infections [3]. This pathogen causes life-threatening complications, such as bronchiolitis and pneumonia with mortality about 200,000 individuals annually [4]. Direct economic loss from the RSV infection (in USA) reaches up to 1,15 billion dollars [5].
Currently, there is no licensed vaccine for RSV prevention [6]. The pharmacotherapy with ribavirin is accompanied by side effects [7]. The monoclonal antibody-based drugs demonstrated promising results in clinical trials, however, their wide use is limited by high cost [8]. New ap-
proaches for RSV treatment are still under development [912]. The study of pharmacological activity of novel drugs using animal models is the mandatory stage in preclinical trials. Therefore, the development of animal models of RSV infection mimicking human pathology is important aspect in the implementation of new therapies in clinical practice.
According to the last data RSV affects an upper respiratory tract by direct contact of the aerosol particles containing the pathogen. Initial stage of RSV replication occurs in nasopharynx with an incubation period for 4-5 days. Then the pathogen can affect lower airways. Therefore, the severity of RSV infection varies from common cold to bronchio-litis associated with airway obstruction, hypoxia and pneumonia. Airway obstruction is observed in up to 24 % cases of RSV infection [13]. As it was established in a histologic study of lung tissues of patients who died after RSV infection, the virus is mainly replicates in a ciliated epithelium of the respiratory tract and alveolar pneumocyte of I and II types [14]. Pathological changes in lungs were characterized by peribronchial and perivascular infiltration of mono-nuclear cells, occlusion of bronchial lumen with infiltrating cells (lymphocytes, macrophages, and neutrophils), pneumonia features, epithelial cells necrosis, mucus hypersecretion and desquamating of epithelial layer. As it was shown previously RSV infection leads to the lung infiltration of the monocytes, CD3+CD4+CD8- and CD3+CD4CD8+ T-cells populations [14]. At the same time CD4+ and CD8+ lymphocytes were rare in lungs at fatal RSV infections [15]. The analysis of bronchoalveolar lavage (BAL) samples from children with RSV-induced bronchiolitis showed the presence of neutrophils and increased level of proinflammatory cytokines and chemokines, such as TNFa, IL-6, IL-1a, IL-8, MIP-1a, MCP-1, RANTES [16], IFN-y, IL-4, IL-5, IL-10, IL-9 and IL-17 [17]. Most likely the activation of these inflammatory factors contributes the RSV pathogenesis.
Development of the new approaches for prevention and therapy of RSV infection is impossible without the establishment of functional models in laboratory animals. There are described animal models of RSV infection in mice, rats, calves, sheep, etc. [18, 19]. Listed species are semi-permissive for RSV, i. e. the virus is poorly replicated in the respiratory tracts of these animals and induce weak features of the pathology. The chimpanzee is the only natural host for RSV. However, the broad use of these non-human primates in experiments is limited by significant expenses. Therefore, the use of the rodents (mice and rats) for RSV modelling is essential for a preclinical study of new antiviral drugs and vaccines [18, 19].
Although rats are more sensitive to RSV than mice, the development of clinically significant manifestations of the RSV infection often are not observed in rats [20]. Therefore, mice are the most common animal model used in RSV studies. Intranasal administration of the virus in doses 105-106 pfu (plaque forming unit) induce the features of the infection characterized by weight loss, infiltration of mononuclear cells into lung, airway mucus hypersecretion, airway obstruction and activation of proinflammatory cytokines in mice [18, 19].
Currently there are no available mouse models, which simultaneously reproduce the majority of main features of human RSV pathology [18, 19]. It could be result from the use of non-purified RSV in the majority of animal studies [21-24]. Administration of unpurified virus could induce immune responses in mice to non-viral components, that interfere RSV infection [18, 19]. Recent study of E.A. van Erp et al. shown that intranasal administration route of the sucrose-purified RSV A2 induces robust pathology and pulmonary inflammation [25]. In the current study we confirm these findings with additional data.
The aim of the study was to develop a comprehensive mouse model of RSV infection. To induce the pathology BALB/c mice were infected with high doses of purified and concentrated RSV strain A2. Such approach allows to evaluate the replication of RSV, airway hyperreactivity, histopathological alterations in the lungs and the gene expression of proinflammatory cytokines. Additionally, utilization of the purified virus allows to exclude influence of the medium components and factors secreted from the cells used for virus propagation on the immune system of the animals that make this model more suitable to study of molecular mechanisms of RSV infection.
Material and methods
Сell culture, virus. RSV strain A2 were grown in HEp-2 cells (epidermoid carcinoma of the human larynx, RRID: CVCL_1906). The Eagle-MEM medium (PanEco, Russia) supplemented with 25 mM HEPES (PanEco, Russia), 300 mg/l L-glutamine (PanEco, Russia), 5 % fetal bovine serum (FBS) (Biosera, Philippines) and 50 mcg/ml genta-micin (Gibco, USA) was used for HEp-2 cells cell growth. For virus propagation we used the same media with reduced (2 %) amount of FBS.
Infected cells were harvested after 72 hours and RSV was concentrated and purified as described previously [26]. Viral titers were assessed by PFU assay using MA-104 cell line. Non-purified non-concentrated virus had titer 2,5 • 106 pfu/ml. Purified and concentrated virus had titer 1 • 109 pfu/ml. RSV strain A2 was provided by I.I. Mech-nikov RIVS of the MSHE of Russia.
Mice. Female BALB/c mice 6-8-week-old, weighed 18-20 g were purchased from M.M. Shemyakin and Yu.A. Ovchinnikov Institute of the Bioorganic Chemistry of RAS, MSHE of Russia. Animals were fed with standard laboratory food for rodents (Delta Feeds, Russia) with free access to water. Animal experiments were carried out in accordance with the International Guiding Principles for Biomedical Research Involving Animals as issued by the Council for the International Organizations of Medical Sciences and were approved by local Ethic Committee of the NRC Institute of Immunology FMBA of Russia.
Design of the in vivo experiments. Mice were divided into four groups (n = 10). Animals of the 1st group (RSV hd) were intranasally infected with purified RSV strain A2 at a high dose of 5 • 106 pfu/mouse in a volume of 50 mcl of phosphate buffered saline (PBS) (PanEco, Russia). The
Primers and probes
Gene Primer/probe Sequence
*RSV F GAAGCATTAATGACCAATGA
Z (ROX) GCTATGGCAAGACTCAGGAATGAG (RTQ2)
R CATCTGATGTGTCTTTTGC
Actb F CTTTGCAGCTCCTTCGTTG
Z (ROX) GCCCTAGGCACCAGGGTGTGATG (RTQ2)
R CACATAGGAGTCCTTCTGAC
Tbet F CCCAACTGTCAACTGCTTG
Z (ROX) AGCCGTTTCTACCCCGACCTTCCAG (RTQ2)
R GCCAGTAAGGCTGTGAGATC
Gata3 F CTTATCAAGCCCAAGCG
Z (ROX) CAGCAAGGAGAGCAGGGACATCCT (RTQ2)
R CATTAGCGTTCCTCCTCC
Ifng F AAATCCTGCAGAGCCAGATTAT
Z (ROX)ACGCTTATGTTGTTGCTGATGGCC (RTQ2)
R GCTGTTGCTGAAGAAGGTAGTA
Il4 F GAGAGTGAGCTCGTCTGTAGG
Z (ROX) ATGCCTGGATTCATCGATAAGCTGCA (RTQ2)
R TCAGTGATGTGGACTTGGAC
Il5 F TACTGTGGAAATGCTATTCCA
Z (ROX) CCGCCAAAAAGAGAAGTGTGGC (RTQ2)
R GTAATCCAGGAACTGCCTC
Il13 F GTGCCAAGATCTGTGTCTCTC
Z (ROX) CTGAGCAACATCACACAAGACCAGACTC (RTQ2)
R TCCACACTCCATACCATGC
Il17a F GTCTTTAACTCCCTTGGCG
Z ROX GTCACCCTGGACTCTCCACCGC (RTQ2)
R GATCACAGAGGGATATCTATCAG
Il17f F CACGTGAATTCCAGAACC
Z (ROX) CAGTGCAGACACTCAGGCTGCATC (RTQ2)
R ACGGAGTTCATGGTGCT
*Primers for virus genomic RNA.
2nd group (RSV ld) received non-purified virus at low dose 105 pfu/mouse. Мice of the 3rd group (RSV-UV) were treated with the same dose (5 • 106 pfu/mouse) and volume (50 mcl) of the UV-inactivated RSV Animals of the 4th group (Intact) were left untreated. On day 5 after infection airway hyperreactivity was measured. On day 6 after infection mice were euthanized and BAL (bronchoalveolar lavage) samples were collected for subsequent differential staining and calculation of cell composition. The left lung was fixed in 10 % formalin (Carl Roth, Germany) followed by the production of histological sections and the assessment of severity of inflammatory features. We excised the right lobe of the lung from each mouse and analyze by quantitative realtime PCR. Throughout the whole period of the experiment, body weight of animals was monitored daily.
In separate experiments mice infected with high dose (5 • 106 pfu/mouse) of purified RSV received orally ribavirin twice a day in dose 85 mg/kg for 5 days.
Airway hyperreactivity. Airway hyperreactivity (AHR) was measured on day 5 after the infection by noninvasive method using FinePointe NAM plethysmograph (Buxco, USA).AHRwas evaluatedas specific airway resistance (sRaw) after inhalation of increasing concentrations of methacholine
(Sigma-Aldrich, USA): 6.25; 12.5; and 25 mg/ml. Additionally, peak expiratory flow (PEF) and respiratory rate (F) were measured. The method was described in details by M. Khaitov et al. [27].
Collection of bronchoalveolar lavage fluid. To collect BAL the trachea was cannulated, and lungs were lavaged 2 times with 0.5 ml complete RPMI-1640 media. Each BAL sample was centrifuged for 10 min at 400g. Cell pellets were resuspended in 0.05 ml of PBS. Then BAL cell smears were fixed with methanol for 15 minutes and stained with azure-eosin (GEMSTANDART-P, Russia). To evaluate the cells composition of BAL at least 300 cells per slide at magnification in 400 times was counted. The supernatants were transferred to a separate tube and stored at -20 °C until analysis.
Histological examination of lung tissue. The left lung removed and fixed with 4 % paraformaldehyde and then embedded in paraffin. Lung sections were cut and stained with hematoxylin-eosin (H&E) (for identification of the eosinophils, neutrophils, and lymphocytes) with alcian blue (for visualization of the mucin positive goblet cells). Cell composition of peribronchial infiltrates was assessed by differential cell count (eosinophils, neutrophils, lymphocytes,
э
125 100
! 75
à
& 50 25 0
Э
% 110
100
90
80
Relative body weight
1 2 3 4 5 6
Day
■#■ RSV hd £RSV ld <>RSV-UV # Intact
Viral load in BAL
Э
Viral load in lung tissue
20 000 000
15 000 000
f val 10 000 000
&
О
5 000 000
RSV-hd RSV-ld RSV-UV Intact
RSV-hd RSV-ld RSV-UV Intact
0
Fig. 1. Dynamics of body weight and the RSV load in the lung tissue
A - the dynamics of body weight relative to the day of infection (day 1). The body weight of each mouse at day 1 was accepted as 100 %. The data presented as mean ± SE, n = 10.
B - the number of vRNA copies in the lung homogenates. Lungs were homogenized for the subsequent purification of total RNA followed by cDNA synthesis and quantitative PCR analysis using primer pair and probe specific to RSV genome. The data presented as mean ± SE of number of vRNA copies in 1 mcg of total RNA, n = 10.
C - viral load in BAL samples. BAL samples were titrated in MA-104 cell monolayer and incubated for 5 days followed by counting the number of plaques by light microscopy. The data presented as mean ± SE of plaques in 1 ml of BAL. n = 10.
x - statistically significant differences vs «RSV-UV» group; # - statistically significant differences vs «RSV-ld» group; * - statistically significant differences vs «Intact» group; the Mann-Whitney U-test was used.
and macrophages) in 5 fields of view. To assess the thickness of bronchial walls Altami Studio software (Altami, Russia) was used; 5 bronchi were analyzed in every lung section at 400* magnification. Goblet cells were quantified as the percentage of total cells of bronchial epithelium at 400* magnification; 5 bronchi were analyzed for every lung section.
Flow cytometry analysis. Lungs were taken and digested by the solution of 2 mg/ml of collagenase from Clostridium histolyticum Type IA (Sigma, USA) and 1 mg/ml DNase I (Invitrogen) in 3 ml of PBS supplemented with 2 % FBS. Then lung homogenates were passed through the cell strainer with 70 ^m pore diameter to obtain single cell suspension. Next, cells were stained with fluorophore labeled antibodies: Alexa Fluor647 Anti-Mouse Siglec-F (BD Biosciences, USA), Anti-Mouse CD45 FITC, Anti-mouse CD19 APC-eFluor-780, CD3e PE-Cyanine7, Anti-Mouse Ly-6G (Gr-1) PerCP-eFluor-710, Anti-CD324 eFluor-660 (eBioscience, USA) for 30 minutes at 4 °C and analyzed using FACSDiva (BD Biosciences, USA) and FlowJo software (BD Biosciences, USA). At least 2 • 105 CD45+-cells per sample were analyzed.
Evaluation of viral load in lung tissue. The viral load in the lungs was evaluated by two methods: quantitative RT-PCR and titration of BAL supernatants in cell culture.
Total RNA was isolated from lung tissue using RNeasy Mini Kit (Qiagen, Germany) in accordance with the manufacturer's recommendations. The concentration of purified RNA was measured by NanoDrop2000 spectrophotometer (Thermo Fisher Scientific, USA). Then cDNA was synthetized using random hexamer primers and RT-1 kit (Synthol, Russia). The cDNAs were amplified using iCycler iQ5 Real-time PCR Detection System (BioRad, United States) and the specific pair of primers and probes (presented in the table). The viral load was expressed as the number of copies of viral RNA in 1 mcg of total RNA.
Additionally, viral load was determined by BAL samples titration in MA-104 cells. MA-104 cells were seeded in a 96-well plate (SPL Lifesciences, Korea) in amount of 2 • 104 cells/well in a volume of 100 mcl/well of complete Eagle medium. After overnight incubation complete medium was removed and cell were washed with 100 mcl/well serumfree Eagle medium followed by BAL samples inoculation.
Каганова М.М., Русак Т.Е., Митин А.Н., Комогорова В.В., Литвина М.М., Шарова Н.И., Кудлай Д. А., Хаитов М.Р. 429 Модель респираторно-синцитиальной вирусной инфекции у мышей, имитирующая основные проявления патологии человека
Samples were incubated for 4 h to allow viable virus to attach the cells. Unbound virus was removed from the wells and plates were incubated for 5 days at 37 °C and 5 % CO2 atmosphere followed by the calculation of the number of plaques by light microscopy. The viral load was expressed as the number of plaque forming units in 1 ml (pfu/ml) of BAL.
Quantification of cytokines gene expression in BAL cells. Total RNA was isolated from BAL cells followed by cDNA synthesis as described above. In order to measure cytokine mRNA expression, the cDNAs were amplified via RT-PCR and specific primer pair and probe (presented in the table).
Statistical data analysis. Data were expressed as mean ± SE (standard error). Data were analyzed by nonparametric Mann-Whitney U-test using the Statistica 8.0 software (StatSoft Inc., USA). Data were accepted as significantly different whenp < 0.05.
Results
Dynamics of body weight. Mice were inoculated in-tranasally with low and high doses (105 and 5 • 106 pfu/ mouse) of RSV A2 in total volume 50 mcl of PBS. Significant gradual weight loss by 12 % up to day 3 after the infection with high dose of purified and concentrates virus have been registered. Infection with lower dose of stock virus led to weaker weight loss by 3 % at day 2. At the same time, mice treated with UV-inactivated virus and uninfected mice gained the body weight by 2-3 % without interruption throughout the observed period for 6 days (Fig. 1A).
The viral load in the lung tissue. Viral load in lungs was assessed on day 6 after the infection by two methods. The number of viral RNA copies (vRNA) in lung tissue ho-mogenates was assessed by quantitative RT-PCR. In group treated with high dose of RSV 12,5 ± 2,7 • 106 copies of vRNA per 1 mcg of total RNA were detected, that was 3 and 10 times more than in group treated with low dose of the virus or UV-inactivated RSV. vRNA in the lungs of intact mice was not detected (Fig. 1Q.
Viable virus in BAL samples was determined by titration in MA-104 cell culture. It is known that RSV induce fusion of cell membranes and form a syncytium which can be identified using a light microscope as plaques. At least 65 ± 20 pfu/ml were detected in 1 ml of BAL samples of mice infected with RSV at high dose. After the infection with low dose of the virus 13 ± 3 pfu/ml was detected. At the same time, only sporadic syncytia were observed BAL samples from mice infected with UV-inactivated virus (~3 ± 2 pfu/ml). Viable virus was not observed in BAL from intact mice (Fig. №).
Airway hyperreactivity. Airway hyperreactivity in response to methacholine was measured at day 5 after infection and expressed as specific airway resistance (sRaw, cmH2O • s/ml). Animals infected with high dose RSV demonstrated significantly increased airway resistance by 36 % in comparison with mice treated with UV-inactivated virus and intact mice. Animals infected with low dose of
6
1 5
*
О 4
и
а ,
о 3
0
sRaw
0.00 6.25 12.50 25.00
Conc. Mch, mg/ml 4 RSV hd RSV ld ф RSV-UV ■§■ Intact
PEF
3
id 0 2 hJ
2 -
Э
300
1 250
"B
I200
0.00 6.25 12.50 25.00
Conc. Mch, mg/ml 4- RSV hd RSV ld <> RSV-UV ■#■ Intact
F
150
0.00 6.25 12.50 25.00
Conc. Mch, mg/ml 4- RSV hd £RSV ld RSV-UV ■§■ Intact
Fig. 2. Changes in the lung function after RSV A2 infection Lung function was measured as specific resistance of airways (sRaw) (A), peak expiratory flow (PEF) (B), and respiratory rate (C) in response to aerosolic methacholine (Mch). The data presented as mean ± SE, n = 10.
x - statistically significant differences vs «RSV-UV» group; # -statistically significant differences vs «RSV-ld» group; * - statistically significant differences vs «Intact» group; the Mann-Whitney U-test was used.
the virus did not develop statistically significant AHR and demonstrated only tendency to increase in sRaw by 17 % compared to intact mice (Fig. 2A). Additional measurements of peak expiratory flow (PEF) and respiratory rate (F) were performed. PEF and F in animals infected with high dose of RSV were substantially decreased by 33 % and 17 %, respectively, compared to mice treated with UV-inactivated virus (Fig. 2B, C). Infection with low dose of the virus resulted to non-significant reduction of these parameters; 11 % for PEF and 7 %, respectively.
Cell composition of BAL and peribronchial lung infiltrates. On day 6 after infection cell composition of the BAL samples was analyzed. The total cell number after high and low dose RSV infection was significantly increased up to 102 000 ± 8700 and 90 250 ± 5650 cells/ml, com-
2
3
150 000
100 000
о
50 000
э
о
150 125 1ОО 75 5О 25 О
Total cells
э
NS
1
* _ III
150 000
l100 000
О
50 000
RSV- RSV- RSV- Intact hd ld UV
Total cells
э
о
2О 15 1О
RSV- RSV- RSV- Intact hd ld UV
Macrophages
NS
* x
I I
T i
1 "
150 000
100 000 -
О
RSV- RSV- RSV- Intact hd ld UV
Macrophages
э
5
RSV- RSV- RSV- Intact hd ld UV
150 125 100
Cells 75
5О 25 О
Lymphocytes
50 000
RSV- RSV- RSV- Intact hd ld UV
Lymphocytes
RSV- RSV- RSV- Intact hd ld UV
Fig. 3. Cell composition of BAL samples and peribronchial lung infiltrates
Total cells (A), macrophages (B) and lymphocytes (C) in BAL samples were calculated by light microscopy. Data presented as the mean ± SE of the cell number, n = 10.
Total cells (D), macrophages (E) and lymphocytes (F) in peribronchial lung infiltrated were counted in 5 fields of view by light microscopy. Data presented as the mean ± SE of the cell number, n = 10.
x - statistically significant differences vs «RSV-UV» group; # - statistically significant differences vs «RSV-ld» group; * - statistically significant differences vs «Intact» group; the Mann-Whitney U-test was used.
pared to mice treated with UV-inactivated virus (68 000 ± 15 300 cells/ml) and intact animals (71 150 ± 8400 cells/ml) (Fig. 3A). Similarly, the number of macrophages was also increased in BAL of the infected mice; 88 400 ± 7100 and 82 300 ± 4900 cells/ml vs 57 500 ± 13 700 cell/ml and 59 300 ± 6600 cells/ml in groups RSV-UV and Intact, respectively (Fig. 3B). The most substantial augmentation (in 18 times) was detected for lymphocyte count; the number of lymphocytes reached 20 177 ± 5058 cell/ml (about 20 % of total cells) after RSV infection with high dose. Low dose infection resulted also to increased lymphocyte number, but less potent; 9550 ± 1200 cells/ml, that was about 11 % of total cells. At the same time, BAL samples from mice treated with UV-inactivated virus contained 1150 ± 250 cell/ml lymphocytes, that did not exceed 3 % of total cells and was comparable to intact group (1130 ± 400 cell/ml) (Fig. 3C). Proinflammatory cells neutrophils and eosinophils were not found by light microscopy. Only sporadic neutrophils (mean 250 cells per ml) in BAL from RSV infected mice were observed.
The left lobes of lung were fixed in paraformaldehyde and used to prepare stained sections for histopathological examination. The microscopic analysis confirmed predominant peribronchial lymphocyte infiltration of the lungs after RSV infection at high and low doses (Fig. 3F). About 48 ± 2 and 62 ± 3 lymphocytes per 5 fields of view
were detected in the lungs of intact and UV-RSV treated mice. However, after the infection with high and low doses of RSV the number of lymphocytes reached 94 ± 5 and 73 ± 4 cell per 5 fields of view (Fig. 3F). There were no differences in macrophage infiltration between mice infected with both doses of the virus (Fig. 3E). At the same time the number of lymphocytes was substantially increased after high dose RSV infection, compared to low dose infection (Fig 3F). The lack of neutrophils and eosinophils in the lungs was also confirmed.
Histopathological alterations in the lung tissues. The histological analysis of H&E stained lung sections allow assess not only cellular composition of infiltrates (Fig. 3D-F), but also development of such inflammatory features as hy-perplasia and metaplasia of the respiratory epithelium and hypertrophy of smooth muscles. The performed analysis revealed the development of negative morphological changes in lungs. Substantial thickening of airway walls after the infection with high dose RSV took p^e. Low dose RSV infection only slightly increased thickness of bronchial walls (Fig. 4A).
Additional method of staining of the lung sections with alcian blue confirmed the revealed hyperplasia of bronchial epithelium after RSV infection with both doses. The proportion of mucus secreting goblet cells in the airway epithelium was significantly increased in mice infected with
О
О
О
О
Thickness of bronchial walls
20 mcm
RSV-hd
RSV-ld
RSV-UV
Intact
Fig. 4. The effect RSV on pulmonary inflammation and airway remodeling in mice
A. Thickness of bronchial airways presented as mean ± SE, n = 10.
x - statistically significant differences vs «RSV-UV» group; * - statistically significant differences vs «Intact» group; the Mann-Whitney U-test was used.
B. Microphotographs of the lung sections stained with hematoxylin-eosin (H&E) showed peribronchial lymphocyte infiltrates (1) after RSV infection. Magnification x400.
the virus and reached 46 ± 5 % of total epithelium cells for high dose and 29 ± 4 % for low dose RSV infection. Mice treated with UV-inactivated virus also developed goblet cells (21 ±3 %), but intact animals not (0 %) (Fig. 5A, B).
Pulmonary cytokine response. The expression of genes encoding Th1-, Th2-, and Th17-cytokines in BAL cells was evaluated by quantitative PCR-analysis. As the most substantial inflammatory features exhibited mice infected with high dose of the virus, therefore analysis of gene expression was performed for this group only, compared to intact one. The genes encoded cytokine IFN-y and transcription factor T-bet were selected as Th1-immune response markers; IL-4 and IL-13 cytokines and transcription factor GATA3 as Th2-markers; IL-17A and IL-17F are produced mainly by Th17-cells. The infection with viable virus in maximal dose substantially induced Th1-immune response; Ifng and Tbet genes expression was increased in 1.9 and 3.3 times, respectively, compared to intact mice (Fig. 6A, G). At the same time, the expression of Th2-markers (Il4, Il13 and Gata3 genes) and Th17-associated cytokines did not change significantly (Fig. 6B, C, D, E, H). Additionally, the expression of proinflammatory cytokine TNFa in BAL cells was assessed. RSV infection
significantly elevated the mRNA expression of Tnfa (almost in 4 times), compared to intact animals (Fig. 6F). Taken together these data suggested the activation of Th1-, but not Th2- or Th17-immune response.
Ribavirin reduces RSV replication, pulmonary inflammation and improves lung function. It is known that ribavirin reduces replication a number of viruses including RSV [28]. We investigated the effect of ribavirin treatment on the replication of RSV in the current model and how it correlated with lung inflammation and airway hyperreactivity. In the current experiment oral daily administration of ribavirin in dose 85 mg/kg substantially decreases viral load in lungs. vRNA copy number was decreased 3 times in lung homogenates and plaque number was reduced in 6 times in BAL after the treatment, compared to untreated mice (Fig. 7A, B). Such decrease in RSV load after ribavirin treatment did not result in significant reduction of total cell infiltration in BAL (Fig. 7C). Macrophage infiltration was not changed substantially, as well (Fig. 7D). At the same time lymphocyte number in BAL substantially decreased in 7.6 times; from 19 000 ± 7000 to 2500 ± 700 cells/ml (Fig. 7E). Improvement in airway hyperreactivity was observed after ribavirin-mediated suppression of RSV replication (Fig. 7F).
Number of goblet cells in the bronchial epitelium
0.02
¡* x
_J_1
RSV-hd RSV-ld RSV-UV Intact
Fig. 5. The effect RSV on goblet cell metaplasia of bronchial epithelium
A - the proportion of goblet cells in the bronchial epithelium presented as mean ± SE, n = 10.
x - statistically significant differences vs «RSV-UV» group; * - statistically significant differences vs «Intact» group; the Mann-Whitney U-test was used.
B - microphotographs of the lung sections stained with alcian blue demonstrated the increased number of the goblet cells in the bronchial epithelium (1) after RSV infection.
_
10 mcm HI 'ЗД-*
RSV-ld
RSV-UV
_
10 mcm
Intact
RSV-hd Intact
RSV-hd Intact
RSV-hd Intact
RSV-hd Intact
6 5
CU
й 4
RSV-hd Intact
RSV-hd Intact
RSV-hd Intact Tnfa
RSV-hd Intact
Fig. 6. mRNA expression of cytokines and transcription factors after RSV infection
The relative gene expression of cytokines: Ifng (A), Il4 (B), Il13 (C), Il17a (D), Il17f (E), Tnfa (F), and transcription factors Tbet (G) and Gata3 (H) in BAL cells. The data presented as the mean ± SE. The level of gene expression in BAL cells from intact mice accepted as 1, n = 10. NS - statistically non-significant differences vs «Intact» group; the Mann-Whitney U-test was used.
Э
äi > 11
p
o C
15 000 000
10 000 000
5 000 000
Viral load in lung tissue
Э
400 000 300 000
C
p = 0.02
1
I
RSV+PBS RSV+Rib
Intact
Total cells
Э
200 000 -
100 000 -
400 000 300 000
200 000 -
C
100 000 -
RSV+ RSV+ Intact PBS Rib
Э
m6
в
a 4
О.ОО
Э
Viral load in BAL
100
50
p = 0.003
1
Macrophages
C
20 000
10 000 -
RSV+ RSV+ Intact PBS Rib
sRaw
6.25 12.5О
Conc. Mch, mg/ml
25.ОО
RSV+PBS RSV+Rib
30 000
Intact
Lymphocytes
RSV+ RSV+ Intact PBS Rib
RSV+PBS RSV+Rib Intact
Fig. 7. The effect of ribavirin treatment of viral load and inflammation in lungs
Viral load in lungs was measured as the number of vRNA copies in the lung homogenates (A) and number of plaques in BAL (B). Total cells (C), macrophages (D) and lymphocytes (E) in BAL were calculated by light microscopy. Lung function was measured as specific resistance of airways - sRaw (F). The data presented as mean ± SE, n = 10.
x - statistically significant differences vs «RSV+PBS» group; the Mann-Whitney U-test was used.
О
О
О
О
О
7
5
3
Discussion
Modelling of RSV pathology was carried out by many groups using different species such as non-human primates, rabbits, rodent etc. (see reviews [18, 19]). Despite chimpanzee is the only natural host for this pathogen, use of semi-permissive mice has many advantages. The use of mice is economically justified, because they do not require specialized housing and there are many commercial reagents, including monoclonal antibodies, that allows to study molecular and cellular mechanisms of pathogenesis in these animals.
The majority of published studies described the use of 3 laboratory RSV strains: A2, line 19 and long to infect mice. However, in several studies animals were infected with clinical isolates obtained from patients. The main disadvan-
tage of isolates is they induce differential pathogenesis in mice and some isolates do not produce any features of the pathology. Stokes et al. utilized 6 clinical RSV isolates to infect mice, however, only 2 variants induced symptoms of the pathology, such as decrease of body weight, development of AHR and mucus hypersecretion [22]. In the Stokes's study laboratory strain RSV A2 had significantly higher viral load than isolates and localization in the alveolar regions [22], that is consistent with natural localization of the virus in human airways [14]. While RSV from clinical samples was predominantly replicating in the bronchiolar epithelium of mice [22]. Therefore, in this study to induction of features of RSV pathology we used BALB/c mice and RSV strain A2.
Despite RSV A2 replicated in the airways of mice more intensively in comparison with clinical isolates and other
common laboratory strains line 19 and long, its use for infection of mice relates to some shortcomings. Many authors [22, 23] suggested that RSV A2 does not induce in mice such significant pathological manifestations as mucus hy-perproduction and AHR. In the current study we infected mice with non-concentrated and non-purified RSV strain A2 in low dose 105 pfu/mouse and concentrated and purified virus in higher dose 5 • 106 pfu/mouse, that in 10-100 times higher than dose used in the majority of other similar studies [22, 23]. The infection of mice with high dose induced listed above important features of the pathology. We observed significant worsening in the lung function; increased resistance of the airways by 36 % (Fig. 2A) and decrease in the peak of expiratory flow and respiratory rate by 33 and 17 %, respectively (Fig. 2B, C). At the same time, low dose infection did not result in significant loss of lung functionality. Our data coincide with results of H.S. Jafri et. al., who infected BALB/c mice with high dose of RSV at 107 pfu [24]. Infected animals developed AHR peaked at day 5 and continued up to 42 days. The author showed that AHR correlated with mucus hypersecretion, but not with viral load. In our experiments we observed significant increase in the proportion of mucus secreting goblet cells in the bronchial epithelium of mice infected high dose RSV (Fig. 5), that can explain AHR development. Another mechanism of AHR induction is upregulation of IL-13 expression, because knockout of this gene abolished mucus hypersecretion and AHR [22, 29]. At the same time in our experiments we did not detect upregulation of IL-13 expression. Probably, in the current model RSV infection induced mucus hypersecretion and AHR through IL-13-independent mechanisms (see the discussion below).
RSV A2 infection of mice lead to significant weight loss peaked on days 4-5 (Fig. 1A), that indicate the productive viral replication [24, 30]. To quantify virus replication in the respiratory tract of animals qPCR analysis is often used [27]. Additionally, to detect the virus in BAL samples and lungs homogenates titration method followed by plaque assay is applied [31]. In some experiments semi-quantitative immunohistochemical method is used to assess the viral load in whole lung preparations [22]. In the current study we quantified RSV replication in the mouse respiratory tract at day 6 after the infection by two methods. qPCR analysis identified increased number of vRNA copies in the lung homogenates of mice infected with both doses of the virus, while high dose resulted in higher viral load. vRNA was also detected in mice treated with UV-inactivated virus, that can be explained by the fact that qPCR is extremely sensitive method, which able to detect a few DNA molecules. Considering that the mice infected with two doses of live RSV increased number of vRNA copies in 3 and 10 times compared to animals received inactivated RSV indicate the productive virus replication in the airways (Fig. 1B) Additionally, we quantified the amount of viable RSV in the respiratory tract. In order to do that BAL samples were titrated on the MA-104 cell monolayer followed by plaque counting. Significant amount of viable virus was observed up to day 6 after the infection with RSV doses (Fig. 1C).
To inoculate RSV at high dose virus was purified from the culture medium and concentrated by sucrose density gradient centrifugation. The majority of authors did not purified the virus before inoculation to mice [21, 23, 24]. Administration of such crude virus to animal could cause immune-mediated responses to non-viral components like compounds of the medium and factors produced by cells, that misrepresents the native response of the host to RSV infection [18, 19].
RSV infection of humans leads to the infiltration of lungs with macrophages, neutrophils and lymphocytes [14, 32]. In our experiments we also observed significant amounts of lymphocytes and macrophages in the lungs, while neutrophils were not detected in BAL samples or peribronchial infiltrates of the lung tissue sections (Fig. 3). In order to identify neutrophils in the lungs we performed additional experiments and applied flow cytometry method which is more accurate compared to the light microscopy. Female BALB/c mice were infected with high dose purified and concentrated RSV A2 as described in materials and methods section followed by collagenase/DNAse digestion of the lungs to obtain single cell suspension. Flow cytometry analysis revealed substantial increase in the total cell number (Fig. 8A) and significant 2-fold increase in the number of neutrophils (cell population with CD45+/Ly6G+-pheno-type) (Fig. 8E) after RSV infection. Additionally, we quantified other types of leucocytes (CD45+-cells) such as T cells (CD45+/CD3+), B cells (CD45+/CD19+) and eosinophils (CD45+/Siglec-F+). Along with the increase in the number of neutrophils, RSV induced statistically significant lung infiltration with leukocytes, T and B cells, but not eosinophils (Fig. 8). At the same time, we observed the trend (p = 0.12) to decrease by 20 % the number of epithelial cells (CD45-/ CD324+) after infection (Fig. 8G), indicating the bronchio-lar epithelial necrosis, that corresponds to RSV pathogenesis in human [14].
It is known that RSV infection activates in the human lungs the expression of proinflammatory cytokines such as TNFa, IL-4, IL-5, IL-13, IL-17A, IL-17F, IFN-y etc. leading the exaggerated inflammation (see overview [17]). It is interesting to note that some authors observed simultaneous activation of both Th1- (IFN-y) and Th2-cytokines (IL-4, IL-5, IL-13) in response to the RSV [33], in spite of the fact that IFN-y acts as antagonist of IL-4 and vice versa [34]. However, the recent studies showed predominant activation of Th1-immune response [35]. In our experiments we also detected considerable upregulation of Th1, but not Th2-immune response in lungs after the infection, that was expressed in the increased level of Th1-cytokine IFN-y and Th1-transcription factor T-bet in BAL cells (Fig. 6). The expression of proinflammatory cytokine TNFa was also 3 times increased (Fig. 6F) that coincident to clinical observations in human [36, 37]. However, we did not detect the activation of Il4, Il13, Il17a and Il17f genes expression in BAL cells (Fig 6B-E). Cytokines IL-17A and IL-17F are involved in the neutrophil-mediated inflammation [38]. The lack of upregulation of these cytokines in BAL cells may explain the absence of neutrophils in the BAL samples. The
Э
JE
О
э
э
JE
"(3 о
12 500 000 10 000 000 7 500 000 5 000 000 2 500 000 0
2 500 000 2 000 000 1 500 000 1 000 000 500 000 0
Total cells
60 000 000
40 000 000
20 000 000 -
RSV
T-cells CD45+/CD3+
Intact
RSV Intact Neutrophils
CD45+/Ly6G+
RSV
Intact
Э
Э
40 000 000
30 000 000
C
Э
Э
el C
10 000 000 0
10 000 000
7 500 000 5 000 000 2 500 000 0
500 000 400 000 300 000 200 000 100 000 0
C
3 000 000
2 000 000 -
1 000 000 -
Epithelial cells CD457CD324+
RSV
Intact
Leucocytes CD45+
20 000 000
RSV
B-cells CD45+/CD19+
Intact
RSV Intact Eosinophils
CD45+/Siglec-F+
RSV
Intact
Fig. 8. Cell populations in lung homogenates after RSV infection evaluated by flow cytometry
The figure represents mean ± SE of the number of total cells (A), of leucocytes (B), T cells (C), B cells (D), neutrophils (E), eosinophils (F) and epithelial cells (G) in the lung tissue homogenates, n = 7.
On day 6 after the infection lungs were digested in 3 ml of collagenase/DNAse cocktail to produce single cell suspension followed by flow cytometry analysis.
# - statistically significant differences vs «Intact» group; the Mann-Whitney U-test was used.
0
0
increased number of this cells in whole lung homogenates (Fig. 8E) could relate to activation of other inflammatory factors independent of the activity of Th17-cytokines.
N.W. Lukacs et al. showed that RSV strain A2 unlike other laboratory strains (long and line 19) did not lead to the development of mucus hypersecretion and AHR. The
inability of A2 strain to induce these important features of RSV pathology the authors explained by the failure of A2 strain to activate IL-13, which is involved in the mucus hypersecretion and AHR development [29]. Nevertheless, in our study purified and concentrated RSV A2 significantly increased AHR (Fig. 2), the proportion of mucous secre-
ting goblet cells in the bronchial epithelium (Fig. 5) without activation of IL-13 expression (Fig. 6C). The development of these features could be due to significant TNFa activation (Fig. 6F). This cytokine like IL-13 is able to activate mucus hypersecretion by bronchial epithelium [39] leading to mechanical resistance of the airflow [24].
It is known that ribavirin could be used as anti-RSV drug, but not for routine use [28, 40]. Longitude administration of this compound has not obvious efficacy [41] and associated with adverse effects [7]. Ribavirin reduces virus replication therefore it is often use as a control compound in animal studies [42, 43].
Bannister et al. demonstrated substantial decrease in the viral load in lungs after oral treatment of mice with 100 mg/kg per day. qPCR method showed the 3 times decrease of vRNA copy number, while live virus was reduced more than 10 times in ribavirin treated animals. However, influence of ribavirin on lung inflammation and airway resistance was not assessed in this study. In our model we gained similar results; ribavirin substantially 3 times decreased vRNA copy number (Fig. 7A) and live virus in BAL in 6 times (Fig. 7B). Additionally, we showed that suppression of RSV replication resulted in reduction of lung inflammation (Fig. 7C-E) and improvement of lung function (Fig. 7F).
In the study of Du et al. [42] ribavirin treatment at dose 46 mg/kg per day for 6 days resulted in the reduction of pulmonary inflammation, while influence on airway hyper-reactivity was not studied by the authors. In our model we showed not only attenuation of inflammation (Fig. 7C-E), but also reduction of airway resistance after ribavirin treatment (Fig. 7F).
■ References
1. Shi T., Denouel A., Tietjen A.K., Campbell I., Moran E., Li X., Campbell H., et al. Global disease burden estimates of respiratory syncytial virus-associated acute respiratory infection in older adults in 2015: a systematic review and meta-analysis. J. Infect. Dis. 2019; 222 (7): 57783. DOI: https://doi.org/10.1093/infdis/jiz059
2. Allakhverdiyeva L.I., Humbatova U.M. Immune disturbances in children with virus-induced bronchial asthma. Immunologiya. 2013; 34 (4): 217-20. (in Russian)
3. Troeger C., Blacker B., Ibrahim A. Khalil, Puja C. Rao, Cao J., Zimsen R.M.S., et al. Estimates of the global, regional, and national morbidity, mortality, and aetiologies of lower respiratory infections in 195 countries, 1990-2016: a systematic analysis for the Global Burden of Disease Study 2016. Lancet Infect. Dis. 2018; 18 (11): 1191-210. DOI: https://doi.org/10.1016/S1473-3099(18)30310-4
4. Geoghegan S., Erviti A., Caballero M.T., Vallone F., Zanone S.M., Losada J.V., et al. Mortality due to respiratory syncytial virus burden and risk factors. Am. J. Respir. Crit. Care Med. 2017; 195 (1): 96-103. DOI: https://doi.org/10.1164/rccm.201603-06580C
5. Halasa N.B., Williams J.V., Wilson G.J., Walsh W.F., Schaffner W., Wright P.F. Medical and economic impact of a respiratory syncytial virus outbreak in a neonatal intensive care unit. Pediatr. Infect. Dis. J. 2005; 24 (12): 1040-4. DOI: https://doi.org/10.1097/01. inf.0000190027.59795.ac
6. Muralidharan A., Li C., Wang L., Li X. Immunopathogenesis associated with formaldehyde-inactivated RSV vaccine in preclinical and clinical studies. Expert Rev. Vaccines. 2017; 16 (4): 351-60. DOI: https://doi.or g/10.1080/14760584.2017.1260452
7. Janai H.K., Marks M.I., Zaleska M., Stutman H.R. Ribavirin: adverse drug reactions, 1986 to 1988. Pediatr. Infect. Dis. J. 1990; 9 (3): 209-211
Another study showed that RSV infected BALB/c mice demonstrated the reduction of viral load, but not pulmonary inflammation after ribavirin treatment [43]. This discrepancy could be explained by the differences in the age of mice. There is a study demonstrating that older mice prone to develop more severe lung pathology [44]. In the study of J.J. Xu et al. [43] young 3-week-old mice were used, at the same time in our experiments 6-8-week-old animals were infected.
The obtained data demonstrate that developed mouse model of RSV infection is sensitive to known antiviral treatment, that allow to test new drugs. Despite the differences in the innate and adaptive immunity of mice and humans [45], which complicates the interpretation the results of vaccine efficacy studies, the use of mouse models as a first step for testing anti-RSV activity of drugs based on monoclonal antibodies [46], siRNA molecules [27, 31], peptides [10] and other inhibitors is justified.
Conclusion
In this study we described experimental model of RSV infection in mice. The infection with sucrose-purified RSV A2 allowed to induce in animals the most important manifestations of the human pathology such as: AHR, metaplasia of mucus secreting cells in the bronchial epithelium and lung inflammation. Moreover, we showed the ability of RSV productively replicate in the respiratory tract and shift the immune response toward Th1-type. The described model is sensitive to known antiviral treatment with riba-virin and could be useful for the testing of novel anti-RSV drugs, and to further understanding of immune mechanisms of the pathology.
8. Wang D., Cummins C., Bayliss S., Sandercock J., Burls A. Immu-noprophylaxis against respiratory syncytial virus (RSV) with palivizumab in children: a systematic review and economic evaluation. Health Tech-nol. Assess. (Rockv.). 2008; 12 (36): 1-86. DOI: https://doi.org/10.3310/ hta12360
9. Khaitov M.R., Litvin L.S., Shilovsky I.P., Bashkatova Yu.N., Fai-zuloev E.B., Zverev V.V. RNA interference. New approaches to the development of antiviral agents. Immunologiya. 2010; 31: 69-76. (in Russian)
10. Shilovskiy I.P., Andreev S.M., Kozhikhova K.V., Nikolskii A.A., Khaitov M.R. prospects for the use of peptides against respiratory syncytial virus. Mol. Biol. 2019; 53, (4): 484-500. DOI: https://doi.org/10.1134/ S002689841904013X
11. Pinegin B.V., Pashchenkov M.V. Immunostimulators of mura-mylpeptide nature in the treatment and prevention of infectious-inflammatory processes. Immunologiya. 2019; 40 (3): 65-71. DOI: https://doi. org/10.24411/0206-4952-2019-13007 (in Russian)
12. Budikhina A.S. The role of antimicrobial peptides in the pathology of diseases of the upper respiratory tract. Immunologiya. 2017; 38 (4): 234-8. DOI: https://doi.org/10.18821/0206-4952-2017-38-4-234-238. (in Russian)
13. Ralston S., Hill V. Incidence of apnea in infants hospitalized with respiratory syncytial virus bronchiolitis: a systematic review. J. Pediatr. 2009; 155 (5): 728-33. DOI: https://doi.org/10.1016/jjpeds.2009.04.063
14. Johnson J.E., Gonzales R.A., Olson S.J., Wright P.F., Graham B.S. The histopathology of fatal untreated human respiratory syncytial virus infection. Mod. Pathol. 2007; 20 (1): 108-19. DOI: https://doi.org/10.1038/ modpathol.3800725
15. Welliver T.P., Garofalo R.P., Hosakote Y., Hintz K.H., Avendano L., Sanchez K., et al. Severe human lower respiratory tract illness caused by respiratory syncytial virus and influenza virus is characterized by the ab-
sence of pulmonary cytotoxic lymphocyte responses. J. Infect. Dis. 2007; 195 (8): 1126-36. DOI: https://doi.org/10.1086/512615
16. Plekhova N.G. Kodrashova N.M., Geltser B.I., Kotelnikov V.N. Cellular and molecular factors of innate defense and its role in the pathogenesis of pneumonia. Immunologiya. 2017; 38 (2): 124-9. DOI: https:// doi.org/10.18821/0206-4952-2017-38-2 (in Russian)
17. Russell C.D., Unger S.A., Walton M., Schwarze J. The human immune response to respiratory syncytial virus infection. Clin. Microbiol. Rev. 2017; 30 (2): 481-502. DOI: https://doi.org/10.1128/CMR.00090-16
18. Taylor G. Animal models of respiratory syncytial virus infection. Vaccine. 2017; 35; (3): 469-80. DOI: https://doi.org/10.1016/j.vac-cine.2016.11.054
19. Altamirano-Lagos M.J., Fabián E.D., Miguel A.M., et al. Current animal models for understanding the pathology caused by the respiratory syncytial virus. Front. Microbiol. 2019; 10: 873. DOI: https://doi. org/10.3389/fmicb.2019.00873
20. Green M.G., Huey D., Niewiesk S. The cotton rat (Sigmodon hispidus) as an animal model for respiratory tract infections with human pathogens. Lab. Anim. 2013; 42 (5): 170-6. DOI: https://doi.org/10.1038/ laban.188
21. Moore M.L., Chi M.H., Luongo C., Lukacs N.W., Polosukhin V.V., Huckabee M.M., et al. A chimeric A2 strain of respiratory syncy-tial virus (RSV) with the fusion protein of RSV strain line 19 exhibits enhanced viral load, mucus, and airway dysfunction. J. Virol. 2009; 83 (9): 4185-94. DOI: https://doi.org/10.1128/JVI.01853-08
22. Stokes K.L., Chi M.H., Sakamoto K., Newcomb D.C., Currier M.G., Huckabee M.M., Stokes K.L., et al. Differential pathoge-nesis of respiratory syncytial virus clinical isolates in BALB/c mice. J. Virol. 2011; 85 (12): 5782-93. DOI: https://doi.org/10.1128/JVI.01693-10
23. Hashimoto K., Durbin J.E., Zhou W., Collins R.D., Ho S.B., Kolls J.K., et al. Respiratory syncytial virus infection in the absence of STAT1 results in airway dysfunction, airway mucus, and augmented IL-17 levels. J. Allergy Clin. Immunol. 2005; 116 (3): 550-7. DOI: https://doi. org/10.1016/j.jaci.2005.03.051
24. Jafri H.S., Chavez-Bueno S., Mejias A., Gomez A.M., Rios A.M., Nassi S.S., et al. Respiratory syncytial virus induces pneumonia, cytokine response, airway obstruction, and chronic inflammatory infiltrates associated with long-term airway hyperresponsiveness in mice. J. Infect. Dis. 2004; 189 (10): 1856-65. DOI: https://doi.org/10.1086/386372
25. van Erp E.A., LakerveldA.J., Mulder H.L., Luytjes W., Ferwerda G., van Kasteren P.B., et al. Pathogenesis of respiratory syncytial virus infection in BALB/c mice differs between intratracheal and intranasal inoculation. Viruses. 2019; 11 (6): 508. DOI: https://doi.org/10.3390/v11060508
26. Ueba O. Respiratory syncytial virus concentration and purification of the infectious virus. Acta Med. Okayama. 1978; 32 (4): 265-72.
27. Khaitov M.R., Shilovskiy I.P., Nikonova A.A., Shershakova N.N., Kamyshnikov O.Y., Babakhin A.A., et al. Small interfering RNAs targeted to interleukin-4 and respiratory syncytial virus reduce airway inflammation in a mouse model of virus-induced asthma exacerbation. Hum. Gene Ther. 2014; 25 (7): 642-50. DOI: https://doi.org/10.1089/hum.2013.142
28. Marcelin J.R., Wilson J.W., Razonable R.R. Oral ribavirin therapy for respiratory syncytial virus infections in moderately to severely immu-nocompromised patients. Transpl. Infect. Dis. 2014; 16 (2): 242-50. DOI: https://doi.org/10.1111/tid.12194
29. Lukacs N.W., Moore M.L., Rudd B.D., Berlin A.A., Collins R.D., Olson S.J., et al. Differential immune responses and pulmonary patho-physiology are induced by two different strains of respiratory syncytial virus. Am. J. Pathol. 2006; 69 (3): 977-86. DOI: https://doi.org/10.2353/ ajpath.2006.051055
30. Rameix-Welti M.A., Goffic R.L., Hervé P.L., Sourimant J., Ré-mot A., Riffaultet S., et al. Visualizing the replication of respiratory syn-cytial virus in cells and in living mice. Nat. Commun. 2014; 5: 5104. DOI: https://doi.org/10.1038/ncomms6104
31. Bitko V., Musiyenko A., Shulyayeva O., Bariket S., et al. Inhibition of respiratory viruses by nasally administered siRNA. Nat. Med. 2005; 11 (1): 50-5. DOI: https://doi.org/10.1038/nm1164
32. Smith P.K. Wang S.Z., Dowling K.D., Forsyth K.D. Leucocyte populations in respiratory syncytial virus-induced bronchiolitis. J. Paediatr. Child Health. 2001; 37 (2): 146-51. DOI: https://doi.org/10.1046/j.1440-1754.2001.00618.x
33. Tripp R.A., Moore D., Barskey A., Jones L., Moscatiello C., Keyserling H., et al. Peripheral blood mononuclear cells from infants hospitalized because of respiratory syncytial virus infection express T helper-1 and T helper-2 cytokines and CC chemokine messenger RNA. J. Infect. Dis. 2002; 185 (10): 1388-94. DOI: https://doi.org/10.1086/340505
34. Elser B., Lohoff M., Kock S., Giaisi M., Kirchhoff S., Krammer P.H., et al. IFN-y represses IL-4 expression via IRF-1 and IRF-2. Immunity. 2002; 17 (6): 703-12. DOI: https://doi.org/10.1016/s1074-7613(02)00471-5
35. Geevarghese B., Weinberg A. Cell-mediated immune responses to respiratory syncytial virus infection: magnitude, kinetics, and correlates with morbidity and age. Hum. Vaccines Immunother. 2014; 10 (4): 104756. DOI: https://doi.org/10.4161/hv.27908
36. Rosenberg H.F., Domachowske J.B. Inflammatory responses to respiratory syncytial virus (RSV) infection and the development of im-munomodulatory pharmacotherapeutics. Curr. Med. Chem. 2012; 19 (10): 1424-31. DOI: https://doi.org/10.2174/092986712799828346
37. Puthothu B., Bierbaum S., Kopp M.V., Forster J., Heinze J., Weckmannet M., et al. Association of TNF-a with severe respiratory syncytial virus infection and bronchial asthma. Pediatr. Allergy Immunol. 2009; 20 (2): 157-63. DOI: https://doi.org/10.1111/j.1399-3038.2008.00751.x
38. Monin L., Gaffen S.L. Interleukin 17 family cytokines: Signaling mechanisms, biological activities, and therapeutic implications. Cold Spring Harb. Perspect. Biol. 2018; 10 (4): a028522. DOI: https://doi. org/10.1101/cshperspect.a028522
39. Lora J.M., Zhang D.M.,Liao S.M., BurwellT., KingA.M., BarkerP.A., et al. Tumor necrosis factor-a triggers mucus production in airway epithelium through an IkB kinase ß-dependent mechanism. J. Biol. Chem. 2005; 280 (43): 36 510-7. DOI: https://doi.org/10.1074/jbc.M507977200
40. Homaira N., Rawlinson W., Snelling T.L., Jaffe A. Effectiveness of palivizumab in preventing RSV hospitalization in high risk children: a real-world perspective. Int. J. Pediatr. 2014; 2014; 571609. DOI: https:// doi.org/10.1155/2014/571609
41. Wright M., Piedimonte G. Respiratory syncytial virus prevention and therapy: Past, present, and future. Pediatr. Pulmonol. 2011; 46 (4): 324-47. DOI: https://doi.org/10.1002/ppul.21377
42. Du L.N., Xie T., Xu J.Y., Kang A., Di L.Q., Shan J.J., et al. A me-tabolomics approach to studying the effects of Jinxin oral liquid on RSV-infected mice using UPLC/LTQ-Orbitrap mass spectrometry. J. Ethnophar-macol. 2015; 174: 25-36. DOI: https://doi.org/10.1016/jjep.2015.07.040
43. Xu J.J., Liu Z., Tang W., Wang G.C., Chung H.Y., Liu Q.Y., et al. Tangeretin from Citrus reticulate inhibits respiratory syncytial virus replication and associated inflammation in vivo. J. Agric. Food Chem. 2015; 63 (43): 9520-7. DOI: https://doi.org/10.1021/acs.jafc.5b03482
44. Mosquera R.A., Stark J.M., Atkins C.L., Colasurdo G.N., Chevalier J., Samuels C.L., et al. Functional and immune response to respiratory syncytial virus infection in aged BALB/c mice: a search for genes determining disease severity. Exp. Lung Res. 2014; 40 (1): 40-9. DOI: https:// doi.org/10.3109/01902148.2013.859334
45. Zschaler J., Schlorke D., Arnhold J. Differences in innate immune response between man and mouse. Crit. Rev. Immunol. 2014; 34 (5): 43354. DOI: https://doi.org/10.1615/CritRevImmunol.2014011600
46. Mejias A., Chavez-Bueno S., Rios A.M., Aten M.F., Raynor B., Peromingo E., et al. Comparative effects of two neutralizing anti-respiratory syncytial virus (RSV) monoclonal antibodies in the RSV murine model: time versus potency. Antimicrob. Agents Chemother. 2005; 49 (11): 4700-7. DOI: https://doi.org/10.1128/AAC.49.11.4700-4707.2005
Authors' information
Igor P. Shilovskiy - Dr.Sci, PhD, Deputy Director on Science and Innovation, NRC Institute of Immunology FMBA of Russia, Moscow, Russian Federation E-mail: [email protected] https://orcid.org/0000-0001-5343-4230
Ekaterina D. Barvinskaia - Junior Researcher of the Antiviral Immunity Lab., NRC Institute of Immunology FMBA of Russia, Moscow, Russian Federation E-mail: [email protected] https://orcid.org/0000-0002-9407-7054
Aleksandr A. Nikolskii - Junior Researcher of the Antiviral Immunity Lab., NRC Institute of Immunology FMBA of Russia, Moscow, Russian Federation E-mail: [email protected] https://orcid.org/0000-0002-4169-0760
Aleksandra A. Nikonova - PhD, Head of Molecular Biotechnology Lab. of I.I. Mechnikov RIVS of the MSHE of Russia; Junior Researcher of the Personalized Medicine and Molecular Immunology Lab., NRC Institute of Immunology FMBA of Russia, Moscow, Russian Federation E-mail: [email protected] https://orcid.org/0000-0001-9610-0935
Valeriy V. Smirnov - PhD, Head of the Research and Production Complex, NRC Institute of Immunology FMBA of Russia; Associate Prof. of the Pharmaceutical and Toxicological Chemistry A.P. Arzamastseva Chair, I.M. Sechenov 1st MSMU of the MOH of Russia (Sechenov University), Moscow, Russian Federation E-mail: [email protected] https://orcid.org/0000-0002-8232-6682
Valeriia I. Kovchina - Junior Researcher of the Antiviral Immunity Lab., NRC Institute of Immunology FMBA of Russia, Moscow, Russian Federation E-mail: [email protected] https://orcid.org/0000-0003-3134-5776
Lyudmila I. Vishniakova - Junior Researcher of the Antiviral Immunity Lab., NRC Institute of Immunology FMBA of Russia, Moscow, Russian Federation E-mail: [email protected] https://orcid.org/0000-0002-3555-3268
Kirill V. Yumashev - Student, Moscow SAVMB; Lab. Assistant of the Antiviral Immunity Lab., NRC Institute of Immunology FMBA of Russia, Moscow, Russian Federation E-mail: [email protected] https://orcid.org/0000-0003-1544-0597
Mariya M. Kaganova - Student, Moscow SAVMB; Lab. Assistant of the Antiviral Immunity Lab., NRC Institute of Immunology FMBA of Russia, Moscow, Russian Federation E-mail: [email protected] https://orcid.org/0000-0002-2596-5779
Tatyana E. Rusak - Student, I.M. Sechenov First MSMU of the MOH of Russia (Sechenov University), Lab. Assistant of the Antiviral Immunity Lab., NRC Institute of Immunology FMBA of Russia, Moscow, Russian Federation E-mail: [email protected] https://orcid.org/0000-0003-2671-4063
Aleksandr N. Mitin - PhD, Head of the Lymphocyte Differentiation Lab., NRC Institute of Immunology FMBA of Russia, Moscow, Russian Federation E-mail: [email protected] http://orcid.org/0000-0003-1333-0757
Victoriia V. Komogorova - PhD, Researcher of the Lymphocyte Differentiation Lab., NRC Institute of Immunology FMBA of Russia, Moscow, Russian Federation E-mail: [email protected] http://orcid.org/0000-0002-3460-7981
Marina M. Litvina - PhD, Researcher of the Lymphocyte Differentiation Lab., NRC Institute of Immunology FMBA of Russia, Moscow, Russian Federation E-mail: [email protected] http://orcid.org/0000-0003-3766-9843
Nina I. Sharova - PhD, Leader Researcher of the Lymphocyte Differentiation Lab., NRC Institute of Immunology FMBA of Russia, Moscow, Russian Federation E-mail: [email protected] http://orcid.org/0000-0002-6774-961X
Dmitry A. Kudlay - Corr. Member of RAS, MD, PhD, Leader Researcher of the Personalized Medicine and Molecular Immunology Lab., NRC Institute of Immunology FMBA of Russia; Prof. of the Pharmacology Chair, Institute of Pharmacy, I.M. Sechenov 1st MSMU of the MOH of Russia (Sechenov University), Moscow, Russian Federation E-mail: [email protected] https://orcid.org/0000-0003-1878-4467
Musa R. Khaitov - Corr. Member of RAS, MD, PhD, Prof., Director, NRC Institute of Immunology FMBA of Russia; Head of the Immunology Chair, MBF of N.I. Pirogov RNRMU of the MOH of Russia, Moscow, Russian Federation E-mail: [email protected] https://orcid.org/0000-0003-4961-9640
