CC BY
75Russian Journal of Nematology, 2017, 25 (2), 77 - 84
Morphological and molecular identification of Globodera artemisiae (Eroshenko & Kazachenko,
1972) in Hungary
Agnes Feketene Palkovics1, Laszlo Krizbai1, Krisztina Markone Nagy2
and Miklos Bozso1
1Department of 1Plant Health and Molecular Biology Laboratory, National Food Chain Safety Office, Budaorsi ut. 141-145, 1118, Budapest, Hungary 2Fructika Ltd., Ady E. ut. 7, 4493, Tiszakanyar, Hungary e-mail: [email protected]
Accepted for publication 17 July 2017
Summary. The Plant Health and Molecular Biology Laboratory of the Hungarian National Food Chain Safety Office carries out permanent inspections to keep nurseries (grapes, fruits, berries) free of quarantine species of Globodera (Skarbilovich, 1959) Behrens, 1975. There are some non-virulent Globodera species in Europe, which show morphological characters very similar to species of potato cyst nematodes. One of them is Globodera artemisiae (Eroshenko & Kazachenko, 1972), known as a parasite of Artemisia spp. (Asteraceae). In 2012 G. artemisiae was found in field samples evaluated for phytosanitary regulation (pre-plant, vineyard) from Veszprém County (Hungary). Traditional identification of the species was confirmed by sequence analysis of three rDNA regions. Key words: cyst nematodes, distribution, molecular phylogeny, rDNA.
The genus Globodera (Skarbilovich, 1959) Behrens, 1975 includes 14 species, of which only two were reported from Hungary, the two potato cyst nematodes (PCN): Globodera rostochiensis (Wollenweber, 1923) Behrens, 1975 and G. pallida (Stone, 1973) Behrens, 1975. The European and Mediterranean Plant Protection Organization (EPPO) considers these two species as quarantine pests (EPPO A2 List), due to their worldwide economic impact. They cause major losses in potato yield. The type locality for G. artemisiae is Far East of Russia, Primorskij Kraj, Khasan district, with Artemisia rubripes (Eastern Asia wormwood) as the type host (Eroshenko & Kazachenko, 1972, 1983). Later the species was found as a parasite of A. vulgaris L. (mugwort) in Armenia (Pogosjan & Karapatjan, 1975), Germany (Sturhan, 1988; Sturhan & Krall, 1991), China (Chen et al., 1994), Sweden (Manduric & Andersson, 2004) and Poland (Dobosz et al., 2006). Due to the parasitism on Artemisiae species, this species does not qualify as a quarantine pest. G. artemisiae shows very similar morphological characters to PCN, and therefore the presence of this species complicates the work of the Phytosanitary service in Hungary. Inappropriate identification may lead to the disqualification of a
product or, on the contrary, may contribute to further spreading of quarantine species. Due to the very high morphological resemblance between species, it is recommended to confirm the traditional morphological diagnostics with molecular techniques.
Development of biochemical and molecular approaches in the diagnostics of nematodes is important for their identification (Esbenshade & Triantaphyllou, 1990; Payan & Dickson, 1990; Schots et al., 1990; Perera et al., 2009; Ahmed et al., 2015). An enormous progress in molecular diagnostics of nematodes has been seen over the last two decades, particularly in sequencing techniques.
These methods made possible the accumulation of a substantial amount of genetic data, especially in sequence divergences, use of which led to a reliable and easy identification of nematodes (Blok, 2005). Several studies have demonstrated that the tandemly repeating units of nuclear ribosomal RNA genes (18S, 5.8S and the 28S genes) and the non-coding internal transcribed spacers 1 and 2 fragments (ITS 1 and 2) constitute highly conserved but sufficiently divergent regions of the genome, which serve as useful tools for species and subspecies discrimination and help to evaluate relationships
among different groups of nematodes (Campbell et al., 1995; Ferris et al., 1995, 1999; Gasser & Hoste, 1995; Hoste et al., 1995; Orui, 1996; Thiery & Mugniery, 1996; Cherry et al., 1997; Fleming & Turner, 1998; Subbotin et al., 2000, 2001, 2004, 2008, 2011a, b; Spiridonov et al., 2004; Blok, 2005; Skantar et al., 2007; García et al., 2009; Madani et al., 2010; Handoo et al., 2012). The small subunit of the ribosomal RNA gene (also called 18S or SSU rRNA or barcode marker region) is one of the most appropriate molecular marker for species delimitation and inferring phylogenetic relationships between groups of nematodes (Floyd et al., 2002; Creer et al., 2010; Porazinska et al., 2010). The large subunit ribosomal rRNA gene (also called the 28S or LSU rDNA) is another universal genomic region with effective and well tested primers for a reliable amplification across most taxa (Blaxter, 2004). Compared to the SSU, the LSU region has been shown to provide better resolution among closely related taxa due to the higher degree of sequence divergence (Markmann & Tautz, 2005; Subbotin et al., 2006, 2008). Although it is more useful for detecting specific diagnostic signals, its use, as an identification marker, rather than the SSU rDNA, has been limited due to the considerably lower number of available sequences in public databases. These molecular methods offer a quick and reliable detection of quarantine nematode species for the control of pest movement within trade, where speed and accuracy of species identification is crucial (Powers, 2004; Gon?alves de Oliveira, 2011; http://www.q-bank.eu /Nematodes).
The main objective of this work is to describe in detail the morphological and molecular features of of the Hungarian population of G. artemisiae. We present the results of the estimated SSU, ITS1-5.8S-ITS2 and LSU rRNA sequence divergences between G. artemisiae populations and give the phylogenetic relationship between G. artemisiae and G. millefolii (Kirjanova & Krall, 1965) (the most closely related Globodera species), as well as other Globodera taxa using the Maximum Likelihood method, based on the original and GenBank sequences of examined ITS1-5.8S-ITS2 rDNA region.
MATERIAL AND METHODS
The population of G. artemisiae was collected from an agricultural field sampled for phytosanitary regulation (pre-plant, vineyard) from Veszprém County (Hungary) by taking soil samples according to an EPPO-recommended method (OEPP/EPPO, 1991).
Morphological and morphometric analysis.
Cysts were extracted using a Fenwick can (Fenwick, 1940). Juveniles were hatched from cysts that had been sieved from fresh soil and kept in water; they were fixed in 3% formaldehyde and processed to glycerin using the formalin-glycerin method (Hooper, 1970; Golden, 1990). Cysts were fixed for 12 h in 3% formaldehyde and processed to glycerin. Observations and measurements were made using Zeiss Axio Imager A1 microscope, equiped with differential interference contrast. In analysing the cysts, the number of cuticular ridges between vulva and anus, the distance from the anus to the nearest edge of the fenestra, and the length of the fenestra were determined. The two latter measures were used to calculate Granek's ratio. In the juveniles, stylet length and stylet knob shape were determined. Recent taxonomic keys were used for the identification of specimens (Brzeski, 1998; Subbotin et al., 2010).
Molecular identification. DNA isolation and purification. The genomic DNA of nematodes was isolated from a single cyst with High Pure PCR Template Preparation Kit (Roche) according to the recommended protocol of manufacturer.
PCR amplification, cloning and sequencing. Several sets of primers and the total DNA were used for amplification of fragments of the rRNA gene (18S rRNA, ITS1-5.8S-ITS2 region and D2-D3 expansion segments of 28S rRNA) (Table 1). The PCR mixture for ITS1-5.8S-ITS2 region contained 2 ^l of template DNA, 2.5 ^l of 10* Taq incubation buffer (Key buffer including 15 mM MgCl2, VWR® Taq DNA Polymerase Kit), 5 ^l of Q-solution (Qiagen), 0.5 ^l of dNTP mixture (2.5 mM each), 0.6 ^l of each primer (10 ^M), 0.2 ^l Taq polymerase (5 U ^l"1, VWR® Taq DNA Polymerase Kit) and double distilled water to a final volume of 25 ^l. The amplification profile for ITS1 consisted of a preheating step of 4 min at 94°C followed by 40 cycles of 94°C for 1 min, 55°C for 90 s and 72°C for 2 min, and a final extension at 72°C for 10 min.
The PCR mixture for 18S rRNA and D2-D3 fragment of the 28S rRNA gene contained 2 ^l of template DNA, 2.5 ^l of 10* Taq incubation buffer (Key buffer including 15 mM MgCfe, VWR® Taq DNA Polymerase Kit), 2 pl MgCfe (VWR® Taq DNA Polymerase Kit), 2 ^l of dNTPs mixture (2.5 mM each), 2 ^l of BSA (Promega), 0.5 ^l of each primer (10 ^M), 0.25 ^l Taq polymerase (5 U ^l"1, VWR® Taq DNA Polymerase Kit) and double distilled water to a final volume of 25 ^l. The 18S rRNA gene was amplified using a thermal profile of 94°C for 5 min followed by five cycles of 94°C for 30 s, 45°C for 45 s and 72°C for 1 min and additional
Table 1. Primers used in the present study.
Primer name Sequence (5'—3') Amplified region Source
988F (forward) CTCAAAGATTAAGCCATGC 18S rRNA Holterman et al. (2006)
1912R (reverse) TTTACGGTCAGAACTAGGG 18S rRNA Holterman et al. (2006)
TW81 (forward) GTTTCCGTAGGTGAACCTGC ITS1 Subbotin et al. (2001)
AB28 (reverse) ATATGCTTAAGTTCAGCGGGT ITS1 Subbotin et al. (2001)
D2A (forward) ACAAGTACCGTGAGGGAAAGTTG D2-D3 of 28S rRNA Rubtsova et al. (2001)
D3B (reverse) TCGGAAGGAACCAGCTACTA D2-D3 of 28S rRNA Rubtsova et al. (2001)
40 cycles at 94°C for 30 s, 54°C for 45 s and 72°C for 1 min and a final extension at 72°C for 5 min. The D2-D3 fragment of the 28S gene was amplified using a thermal profile of 2 min at 94°C followed by 45 cycles of 94°C for 30 s, 58°C for 1 min and 72°C for 1 min, and a final extension at 72°C for 10 min. Reaction was performed in a PTC-100® DNA thermal cycler (MJ Research). Products of amplification were analysed in 2% agarose gel with addition of ethidium bromide and visulalised under UV light. The PCR products were purified using the USB ExoSAP-IT® PCR Product Clean-Up reagent (Affymetrix).
Gel purified PCR products were ligated into vector of pGEM®-T Easy Vector System and transformed to Escherichia coli strain DH5a according to the manufacturer's instructions (Promega). Clones were verified using X-Gal + IPTG blue-white selection. For each gene two clones from examined samples were sequenced in both directions using vector universal primers (T7, SP6). Plasmid inserts were sequenced by capillary electrophoresis using a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) in a MegaBase™ 1000 Sequencing System (GE Healthcare). The sequences obtained were submitted to the GenBank.
Sequence analyses. The new sequences were assembled with Staden Package 2.0.0b9. The multiple sequence alignment for each gene was carried out by ClustalW (Larkin et al., 2007), with default parameters for corresponding gene sequences of G. atremisiae together with selected representatives and outgroup taxa (Punctodera punctata Thorne, 1928). Distance analysis between these examined groups (p-distance; number of base differences per sequence) was conducted in MEGA 7 software (Kumar et al., 2016). Gaps were treated as missing data.
Phylogenetic analysis. Our purpose was to use as many overlapping G. artemisiae and other Globodera sequences as possible for our analysis. Therefore, we carried out only the analysis of ITS1-5.8S-ITS2 region, because this seemed to be the most informative (in this case, we found 25 available overlapping sequences for this genus). The most appropriate model of nucleotide substitution was determined with MEGA 7 under the Bayesian Information Criterion (BIC). The Hasegawa-Kishino-Yano (HKY) model with gamma distribution (Hasegawa et al., 1985) was selected for our phylogenetic analysis. The phylogenetic tree was constructed with Maximum Likelihood (ML) method. To obtain an estimate of the support for each node, a bootstrap analysis using 1000 replicates was performed. Bootstrap support are given on appropriate clades for ML tree.
RESULTS
Morphological and morphometric analysis.
Cysts (n = 10): morphometric characteristics are given in Table 2. The bright brown cysts generally are not spherical but tended to be egg-like shape; some cysts have elongated, irregular shape.
Second-stage juveniles (n = 10): Morphometric characteristics are given in Table 2. The anterior faces of stylet knobs in the second-stage juvenile is sloped backward. The lips had four annules.
The Hungarian population of G. artemisiae morphologically and morphometrically is similar to the populations reported from Russia, Sweden, China and Germany (Manduric & Anderson, 2004).
Sequence and phylogenetic analysis. The distinctiveness of G. artemisiae was also examined using genetic data. DNA sequences were obtained for the rDNA PCR products amplified with primers TW81/AB28, 988F/1912R and D2A/D3B. One
overall consensus sequence was used for further phylogenetic comparison in case of every examined regions, since the sequences of clones for every situation were identical (GenBank accession numbers: KU845470-KU845472). Relationships among the species and populations inferred from the examined rDNA regions are shown in Fig. 1.
The alignment of the 18S were 971 positions in the final dataset. Based on results of our analysis, the sequence of Hungarian G. artemisiae population should be considered as a new haplotype. Pairwise distances between populations showed that the Hungarian population differs in six positions (0.6%) from the two other G. artemisiae populations (GenBank accession numbers of these sequences: FJ 040400; Poland, EU 855121) which are represented with a second, common haplotype.
The alignment of the ITS1-5.8S-ITS2 region contained 537 sites. In this situation the average intraspecific variations for the two closely related taxa studied were as follows: G. artemisiae (6 sequences), 1.4 base pairs (bp) or 0.3%; G. millefolii (7 sequences), 0.8 bp or 0.2%. The average genetic distances between main clades of the examined taxa were between 3.1-47.2 bp or 0.7-9.9%. In this case the subclades of each taxa also proved to be well separated. The Hungarian G. artemisiae population clustered in a common haplogroup with populations from Germany, Sweden, China, Japan and Poland (Fig. 1). The pairwise distances analysis suggested that all G. artemisiae populations have been characterised by its own, unique haplotype. Our examination showed that within this cluster the Hungarian population differs least in the number of base differences per sequence from the Polish populations (1 bp, 0.1%), a greater difference from Chinese (2 bp, 0.3%) or German populations (3 bp, 0.5%) and the most difference from the unique haplotypes of Sweden and Japan populations (5 bp, 0.9%). There was no difference between the sequence
of Chinese G. artemisiae population and sequence of G. hypolysi (Ogawa et al., 1983) from Japan.
The alignment of the D2 and D3 expansion segments of 28S were 663 positions in the final dataset. The results of pairwise distances analysis of this region supported our earlier results based on the 18S dataset. This analysis also confirmed, that the Hungarian and the Polish G. artemisiae population (GenBank accession number: EU 855121) are characterised by unique haplotypes and differ from each other in four positions (0.6%).
Our phylogenetic analysis showed, that the populations of the studied Globodera species formed well separated clades in all cases. Furthermore, alignment of the examined DNA regions using ML methods produced a tree of a similar topology that was also reported earlier (Subbotin et al., 2011a) (Fig. 1).
DISCUSSION
The correct and rapid identification of Globodera species is fundamental for control. Species can be distinguished by morphometrical differences and by their capacity to reproduce on various hosts, but this is time-consuming. Some of the diagnostic characters, such as cyst cone and J2 stylet characteristics, may overlap between various populations of the different species (Baldwin & Mundo-Ocampo, 1991). Besides morphometrical examination, sensitive, rapid and cost-effective molecular methods are gaining importance for identifying plant-parasitic nematodes. Various rRNA regions have frequently been shown to be useful markers for the diagnosis of Globodera species. In the present study the sequence analysis of 18S, ITS1-5.8S-ITS2 and D2-D3 of 28S rRNA loci allowed us to confirm the morphometrical species identification and suggested that the Hungarian G. artemisiae population had a unique haplotype in
Table 2. Morphometric characteristics of Globodera artemisiae from Hungary.
Life cycle stage Character Mean Range
Cysts length (|im) 474 467-481
wide (^m) 412 394-460
Granek's ratio 1.51 1.2-1.96
Second-stage juveniles length (|im) 468 458-479
stylet length (^m) 23 22.5-24
hyaline part (^m) 24 22.5-25
tail length (^m) 43.5 42.5-45
Fig. 1. Phylogenetic relationships of Globodera artemisiae and other Globodera taxa. The best likelihood phylogenetic tree was inferred from the ITS1-5.8S-ITS2 sequence (537 bp) alignment under the HKY+G model. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches. Sequences of G. artemisiae populations are indicated in bold. The scale bars represent the number of substitutions per site.
each and every case. We found that these haplotypes separated well from other haplotypes of most closely related European G. artemisiae populations. However, during the the examination of rRNA the intra-specific variation and non-homogenised paralogues of these molecular markers at different loci in a genome present some difficulties. Thus, it would be appropriate to use PCR-RFLP method or species-specific primers in Q-PCR reaction for molecular based species identification (Nowaczyk et al., 2008; Subbotin et al., 2011a).
REFERENCES
Ahmed, M., Sapp, M.T., Prior, T., Karssen, G. & Back, M. 2015. Nematode taxonomy: from morphology to metabarcoding. SOIL Discussion 2: 1175-1220.
Baldwin, J.G. & Mundo-Ocampo, M. 1991. Heteroderinae, cyst and non-cyst-forming nematodes. In: Manual of Agricultural Nematology (W.R. Nickle Ed.). pp. 275-362. New York, USA, Marcel Dekker Inc.
Blaxter, M.L. 2004. The promise of a DNA taxonomy. Philosophical Transactions of the Royal Society of London, Series B 359: 669-679.
Blok, V. 2005. Achievements in and future prospects for molecular diagnostics of plant-parasitic nematodes. Canadian Journal of Plant Pathology 27: 176-185.
Brzeski, M.W. 1998. Nematodes of Tylenchina in Poland and Temperate Europe. Poland, Muzeum i Instytutu Zoologii, Polska Akademia Nauk. 398 pp.
Campbell, A.J., Gasser, R.B. & Chilton, N.B. 1995. Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs. International Journal for Parasitology 25: 359-365.
Chen, P.S., Zheng, P.S. & Ma, C.Z. 1994. A new record of the genus Globodera (G. artemisiae) from Beijing, China. Scientia Agricultura Sinica 27: 89.
Cherry, T., Szalanski, A., Todd, T. & Powers, T. 1997. The internal transcribed spacer region of Belonolaimus (Nemata: Belonolaimidae). Journal of Nematology 29: 23-29.
Creer, S., Fonseca, V., Porazinska, D., Giblin-Davis, R., Sung, W., Power, D., Packer, M., Carvalho, G., Blaxter, M. & Lambshead, P. 2010. Ultrasequencing of the meiofaunal biosphere: practice, pitfalls and promises. Molecular Ecology 19: 4-20.
Dobosz, R., Obr^palska-St^plowska, A. & Kornobis, S. 2006. Globodera artemisiae (Eroshenko et Kazachenko, 1972) (Nematoda: Heteroderidae) from Poland. Journal of Plant Protection Research 46: 403-407.
Eroshenko, A.S. & Kazachenko, I.P. 1972. [Heterodera artemisiae sp. n. (Nematoda: Heteroderidae), a new species of cyst-forming nematodes from the Primorje Territory]. Parazitologiya 6: 166-170 (in Russian).
Eroshenko, A.S. & Kazachenko, I.P. 1983. [Description of male of Globodera artemisiae (Nematoda, Heteroderidae) from a typical habitat]. Parazitologiya 17: 415-417 (in Russian).
Esbenshade, P. & Triantaphyllou, A. 1990. Isozyme phenotypes for the identification of Meloidogyne species. Journal of Nematology 22: 10-15.
Fenwick, D.W. 1940. Methods for the recovery and counting of cysts of Heterodera schachtii from soil. Journal of Helminthology 18: 155-172.
Ferris, V.R., Miller, L.I., Faghihi, J. & Ferris, J.M. 1995. Ribosomal DNA comparisons of Globodera from two continents. Journal of Nematology 27: 273-283.
Ferris, V.R., Krall, E., Faghihi, J. & Ferris, J.M. 1999. Phylogenetic relationships of Globodera millefolii, G. artemisiae, and Cactodera salina based on ITS region of ribosomal DNA. Journal of Nematology 31: 498-507.
Fleming, C.C. & Turner, S.J. 1998. Diagnostics of cyst nematodes: use of the polymerase chain reaction to
determine species and estimate population levels. Aspects of Applied Biology 52: 375-382.
Floyd, R., Abebe, E., Papert, A. & Blaxter, M. 2002. Molecular barcodes for soil nematode identification. Molecular Ecology 11: 839-850.
GarcIa, D., GarcIa, C., Montero, Z., Salazar, L., Brenes, A. & Gomez-AlpIzar, L. 2009. Morphological and molecular identification of potato cyst-forming nematode Globodera pallida in soil samples from Costa Rica. Revista Latinoamericana de la Papa 15: 38-45.
Gasser, R. & Hoste, H. 1995. Genetic markers for closely-related parasitic nematodes. Molecular and Cellular Probes 9: 315-319.
Golden, A.M. 1990. Preparation and mounting nematodes for microscopic observations. In: Laboratory Manual for Plant Nematology (B.M. Zuckerman, W.F. Mai & M.B. Harrison Eds). pp. 197-205. Amherst, USA, University of Massachusetts Agricultural Experiment Station.
Gonqalves De Oliveira, C.M. 2011. Morphological and molecular diagnostics for plant-parasitic nematodes: working together to get the identification done. Tropical Plant Pathology 36: 065-073.
Handoo, Z.A., Carta, L.K., Skantar, A.M. & Chitwood, D.J. 2012. Description of Globodera ellingtonae n. sp. (Nematoda: Heteroderidae) from Oregon. Journal of Nematology 44: 40-57.
Hasegawa, M., Kishino, H. & Yano, T. 1985. Dating of human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22: 160-174.
HOLTERMAN, M., VAN DER WURFF, A., VAN DEN ELSEN, S., VAN MEGEN, H., Bongers, T., Holovachov, O., Bakker, J. & Helder, J. 2006. Phylum-wide analysis of SSU rDNA reveals deep phylogenetic relationships among nematodes and accelerated evolution towards crown clades. Molecular Biology and Evolution 23: 1792-1800.
Hooper, D.J. 1970. Handling, fixing, staining and mounting nematodes. In: Laboratory Methods for Work with Plant and Soil Nematodes (J.F. Southey Ed.). pp. 39-54. London, UK, Ministry of Agriculture, Fisheries and Food.
Hoste, H., Chilton, N.B., Gasser, R.B. & Beveridge, I. 1995. Differences in the second internal transcribed spacer (ribosomal DNA) between five species of Trichostrongylus (Nematoda: Trichostrongylidae). International Journal for Parasitology 25: 75-80.
Kumar, S., Stecher, G. & Tamura, K. 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33: 1870-1874.
Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H.,
Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J. & Higgins, D.G. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947-2948.
Madani, M., Subbotin, S.A., Ward, L.J., Li, X. & De Boer, S.H. 2010. Molecular characterization of Canadian populations of potato cyst nematodes, Globodera rostochiensis and G. pallida using ribosomal nuclear RNA and cytochrome b genes. Canadian Journal of Plant Pathology 32: 252-263.
Manduric, S. & Andersson, S. 2004. The identity of a Swedish Globodera (Nematoda: Heteroderidae) population, following comparisons with known populations of G. artemisiae (Eroshenko and Kazachenko,1972) Behrens, 1975. Russian Journal of Nematology 12: 39-44.
Markmann, M. & Tautz, D. 2005. Reverse taxonomy: an approach towards determining the diversity of meiobenthic organisms based on ribosomal RNA signature sequences. Philosophical Transactions of the Royal Society of London, Series B 360: 1917-1924.
Nowaczyk, K., Dobosz, R., Kornobis, S. & Obr^palska-St^plowska, A. 2008. TaqMan realtime PCR-based approach for differentiation between Globodera rostochiensis (golden nematode) and Globodera artemisiae species. Parasitology Research 103: 577-581.
OEPP/EPPO. 1991. Recommendations made by EPPO Council in 1990: general scheme for the production of certified pathogen-tested vegetatively propagated ornamental plants. Bulletin OEPP/EPPO Bulletin 21: 1-757.
Ogawa, Y., Oshima, Y. & Ichinohe, M. 1983. Globodera hypoysi n. sp., a mugwort cyst nematode from Japan. Japanese Journal of Nematology 12: 41-46.
Orui, Y. 1996. Discrimination of the main Pratylenchus species (Nematoda: Pratylenchidae) in Japan by PCR-RFLP analysis. Applied Entomology and Zoology 31: 505-514.
Payan, L. & Dickson, D. 1990. Comparison of populations
of Pratylenchus brachyurus based on isozyme phenotypes. Journal of Nematology 22: 538-545.
Perera, M.R., Taylor, S.P., Vanstone, V.A. & Jones, M.G. 2009. Protein biomarkers to distinguish oat and lucerne races of the stem nematode, Ditylenchus dipsaci, with quarantine significance for Western Australia. Nematology 11: 555-563.
Pogosjan, Z.E. & Karapetjan, D.A. 1975. [Description of the male of Heterodera artemisiae from the Armenian SSR (Nematoda, Heteroderidae)]. Doklady Akademii Nauk Armjanskoi SSR 61: 306-311 (in Russian).
PORAZINSKA, D.L., Giblin-Davis, R.M., SUNG, W. & Thomas, W.K. 2010. Linking operational clustered taxonomic units (oCTus) from parallel ultra
sequencing (PUS) to nematode species. Zootaxa 2427: 55-63.
Powers, T. 2004. Nematode molecular diagnostics: from bands to barcodes. Annual Review of Phytopathology 42: 367-383.
Rubtsova, T.V., Subbotin, S.a., Brown, D.J.F. & Moens, M. 2001. Description of Longidorus sturhani sp. n. (Nematoda: Longidoridae) and molecular characterisation of several longidorid species from Western Europe. Russian Journal of Nematology 9: 127-136.
Schots, A., Gommers, F.J., Bakker, J. & Egberts, E. 1990. Serological differentiation of plant-parasitic nematode species with polyclonal and monoclonal antibodies. Journal of Nematology 22: 16-23.
Skantar, A.M., Handoo, Z.A., Carta, L.K. & Chitwood, D.J. 2007. Morphological and molecular identification of Globodera pallida associated with Potato in Idaho. Journal of Nematology 39: 133-144.
Spiridonov, S.E., Reid, A.P., Podrucka, K., Subbotin, S.A. & Moens, M. 2004. Phylogenetic relationships within the genus Steinernema (Nematoda: Rabditida) as inferred from analyses of sequences of the ITS1-5.8S-ITS2 region of rDNA and morphological features. Nematology 6: 547-566.
Sturhan, D. 1988. Erstnachweis des beifusszystennematoden (Globodera artemisiae). Gesunde Pflanzen 40: 205-206.
Sturhan, D. & Krall, E. 1991. Weitere nachweise von Globodera artemisiae in Deutschland. Nachrichtenblatt des Deutschen
Pflanzenschutzdienstes (Braunschweig) 43: 86.
Subbotin, S.a., Halford, P.D., Warry, A. & Perry, R.N. 2000. Variations in ribosomal DNA sequences and phylogeny of Globodera parasitising solanaceous plants. Nematology 2: 591-604.
Subbotin, S.a., Vierstraete, A., De Ley, P., Rower, J., Waeyenberge, L., Moens, M. & Vanfleteren, J.R. 2001. Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA. Molecular Phylogenetics and Evolution 21: 1-16.
Subbotin, S.a., Krall, E.L., Riley, I., Chizhov, V.N., Staelens, A., De Loose, M. & Moens, M. 2004. Evolution of the gall-forming plant parasitic nematodes (Tylenchida: Anguinidae) and their relationships with hosts as inferred from internal Transcribed Spacer sequences of nuclear ribosomal DNA. Molecular Phylogenetics and Evolution 30: 226-235.
Subbotin, S.a., Sturhan, D., Chizhov, V.N., Vovlas, N. & Baldwin, J.G. 2006. Phylogenetic analysis of Tylenchida Thorne, 1949 as inferred from D2 and D3
expansion fragments of the 28S rRNA gene sequences. Nematology 8: 455-474.
Subbotin, S.A., Ragsdale, E.J., Mullens, T., Roberts, P.A., Mundo-Ocampo, M. & Baldwin, J.G. 2008. A phylogenetic framework for root lesion nematodes of the genus Pratylenchus (Nematoda): evidence from 18S and D2-D3 expansion segments of 28S ribosomal RNA genes and morphological characters. Molecular Phylogenetics and Evolution 48: 491-505.
Subbotin, S.A., Mundo-Ocampo, M. & Baldwin, G.B. 2010. Systematics of Cyst Nematodes (Nematoda: Heteroderinae). Nematology Monographs & Perspectives, Volume 8A (D.J. Hunt & R.N. Perry Series Eds).The Netherlands, Brill. 351 pp.
Subbotin, S.A., Cid Del Prado Vera, I., Mundo-Ocampo, M. & Baldwin, J.G. 2011a. Identification, phylogeny and phylogeography of circumfenestrate
cyst nematodes (Nematoda: Heteroderidae) as inferred from analysis of ITS-rDNA. Nematology 13: 805-824.
Subbotin, S.A., Inserra, R.N., Marais, M., Mullin, P., Powers, T., Roberts, P.A., Van Den Berg, E., Yeates, G.W. & BALDWIN, J.G. 2011b. Diversity and phylogenetic relationships within the spiral nematodes of Helicotylenchus Steiner, 1945 (Tylenchida: Hoplolaimidae) as inferred from analysis of the D2-D3 expansion segments of 28S rRNA gene sequences. Nematology 13: 333-345.
Thiery, M. & Mugniery, D. 1996. Interspecific rDNA restriction fragment length polymorphism in Globodera species, parasites of Solanaceous plants. Fundamental and Applied Nematology 19: 471-480.
URL: http://www.q-bank.eu/Nematodes/ (accessed: February 10, 2016).
Á.F. Palkovics, L. Krizbai, K.M. Nagy and M. Bozsó. Морфологическое и молекулярное определение Globodera artemisiae (Eroshenko & Kazachenko, 1972) из Венгрии. Резюме. Лаборатория фитосанитарного контроля и лаборатория молекулярной биологии Венгерской Национальной службы пищевой безопасности проводят постоянные инспекции для выявления карантинных видов рода Globodera (Skarbilovich, 1959) Behrens, 1975 в местах выращивания винограда, фруктов и ягод. В Европе встречаются некоторые не-вирулентные виды глободер, морфологические особенности которых сходны с таковыми картофельной цистообразующей нематоды. Одним из таких видов является Globodera artemisiae (Eroshenko & Kazachenko, 1972), который, как известно, паразитирует на Artemisia spp. (Asteraceae). В 2012 вид G. artemisiae был обнаружен в образцах, собранных в рамках фитосанитарной проверки на территории, подготавливаемой к высадке саженцев винограда, в районе Веспрем близ озера Балатон (Венгрия). Определение этого вида традиционными морфологическими методами было подтверждено анализом трех локусов ДНК.
