CC BY
3Molecular Survey and Characterization of H5N8 Isolates
during 2016-2017 on Egypt
Mahmoud El-Saied Sedeik*, Nahed Ahmed Elshal, Ashraf Mahmoud Awad and Nehal Kandil
Department of Avian and Fish diseases, Alexandria University, Egypt *Corresponding author's Email: [email protected]
Received: 09 Nov 2018 Accepted: 03 Dec 2018
ABSTRACT
Avian influenza (AI) disease still threat poultry industry in Egypt causing great economic losses. In order to identify and characterize the agent of suggestive clinical cases of AI disease, 28 flocks showing clinical signs suspected to be due to AI infections have been investigated. By slide Hemagglutination (HA), the positive samples were 14/28 and concerning the results of real time- reverse transcriptase polymerase chain reaction (RRT-PCR), 2/14 samples were positive to AI H5, 7/14 to New castle disease virus (NDV), 1/14 to H9 and 4/14 co-infected (2 samples had NDV + AI H5 and others had NDV + AI H9). These positive PCR samples were subjected to further characterization by genotyping and sequencing analysis. The two isolated of H5 AI strain were classified to H5N8 which, related to Russian strains (clade 2.3.4.4) and the genetic analysis approved little relationship between these two H5N8 strain and the commercial AI vaccines with percent (80- 91.7%). So, the researchers should have more monitoring for these viral diseases with effective biosecurity and quarantine measures to minimize the disease occurrence.
Key words: Avian influenza, flocks, molecular, survey
JWPR
Journal of World's Poultry Research
2018, Scienceline Publication
J. World Poult. Res. 8(4): 127-133, December 25, 2018
Research Paper, PII: S2322455X1800018-8 License: CC BY 4.0
INTRODUCTION
Highly Pathogenic Avian Influenza (HPAI) of the subtype H5N1 is a contagious pathogen that causes severe respiratory disease with high mortality in poultry (Ali et al., 2015). Type A influenza belongs to the orthomyxoviridae virus family, is enveloped, and is pleomorphic with a size ranging from 80-120 nm (Spackman, 2008). According to Hemagglutinin (HA) and Neuraminidase (NA), there are 18 HA subtypes and 11 NA subtypes. Many different combinations of HA and NA proteins are possible (Tong et al., 2013). AI viruses are categorized as either Low Pathogenic (LP) or High Pathogenic (HP). HPAI viruses produce severe, systemic disease with high mortality in chickens and other gallinaceous poultry birds, but usually don't produce infection or possible mild disease in ducks. The newer H5 and the H7 HPAI viruses have shifted to increased virulence in chickens (Pantin-Jackwood and Swayne, 2009). HPAI H5N1 virus has been endemic in Egypt since 2006. The main symptoms were ecchymosis on the shanks and feet, cyanosis of the comb and wattles, subcutaneous edema of the head and neck for chickens,
and nervous signs (torticollis) for ducks. Within 48-72 hours of the onset of illness, the average mortality rates were 22.8-30 % and 28.5-40 % in vaccinated chickens and non-vaccinated ducks respectively (Hagag et al., 2015). A newly emerged H5N8 influenza virus was isolated from green-winged teal in Egypt during December 2016. Multiple peculiar mutations were characterized in the Egyptian H5N8 viruses (Kandiel et al., 2017). Although some of the commercial vaccines protected chickens from mortality by H5N8, they failed to prevent chickens from shedding of virus. Accordingly, so the updating and reinforcing of H5N8 prevention and control strategies in Egypt is very important (Kandiel et al., 2018). Influenza viruses are inherently unstable, as these viruses lack a genetic proof-reading mechanism, small errors that occur when the virus copies itself go undetected and uncorrected. Specific mutations and evolution in influenza viruses cannot be predicted (WHO, 2006). Viruses in vaccinated poultry populations displayed higher mutation rates at the immunogenic epitopes, promoting viral escape and reducing vaccine efficiency (Abdelwhab et al., 2016). The aim of this study is epidemiological survey of AI in commercial
BBBEBBiBH Sedeik M El-S, Elshal NA, Awad AM and Kandil N (2018). Molecular Survey and Characterization of H5N8 Isolates during 2016-2017 on Egypt. J. World Poult. Res., 8 (4): 127-133. http://iwpr.science-line.com
chicken flocks during 2016-2017 on El-Behera, El-Gharbia, Dimiatta governorates through Real Time Polymerase Chain Reaction (RT-PCR) and sequencing analysis to follow recent and current changes that occur on AI viruses.
MATERIAL AND METHODS
Chicken flocks
Twenty-eight broiler chicken flocks of different breeds and age ranged from (25-35 days) at El-Behera, El- Gharbia and Damietta governorates, Egypt during period from June 2016 to May 2017 showing high mortality rate with respiratory manifestations and cyanosis of comb and wattles and diarrhea, the course of disease ranged between 3-5 days. All flocks had history of non-vaccination against AI disease. Samples were taken from trachea, lung and liver of freshly slaughtered birds in each flock separately and transported to laboratory of poultry and fish disease department, faculty of veterinary medicine, Alexandria University, Egypt on ice box.
Virus isolation
The tissue was homogenized with three successive freezing and thawing forming tissue homogenate 10% with Phosphate Buffer Saline (PBS) and centrifuged at 3000 rpm for 15 min. Each sample was inoculated in five eggs with 0.1 ml of tissue homogenate per egg via allantoic sac route, two eggs inoculated with 0.1 ml PBS used as negative control. The fertile specific pathogen free Eggs (SPF ECEs) obtained from kom oshem, fayom, Egypt is used in present study. Inoculated eggs were incubated at 37°c for five days with daily candling for mortalities with discarding non- specific death at first 24 hours of inoculation (OIE, 2008). Dead embryos were examined for gross lesions and their allantoic fluids were harvested and tested by slide (HA) test (Charles, 1989) and the negative allantoic fluids were inoculated on SPF ECEs for two successive passages.
Real time-reverse transcription polymerase chain reaction (RRT-PCR)
Fourteen positive HA allantoic fluid samples were extracted by QIAamp viral RNA mini kits {cat.no .52904, (QIAGEN), Germany} as described by manufacturer manual of Qiagen RNA extraction kit. RRT-PCR was performed using primers of H5 (Londt et al., 2008), H9 (Ben Shabat et al., 2010), IB (Meir et al., 2010) and ND (Wise et al., 2004) as shown in table 1.
Sequencing and phylogenetic analysis
The positive samples for AI H5 by RT-PCR were subjected to nucleotide sequencing using primer according to Slomka et al. (2007) (Table 2) using 301bp on an Applied Bio systems 3130 automated DNA sequencer (ABI, 3130, USA using Bigdye Terminator V3.1 cycle sequencing kit (Perkin-Elmer, Foster city, CA) (cat-number 4336817) for performing gene sequencing using an Applied Biosystems 3130 genetic analyzer (HITACHI, Japan). QIA quick PCR product extraction kit (Qiagen Inc. Valencia CA), was used for purification of the PCR product on (1.5%) agarose gel directly. Using Centrisep (spin column, Cat number: CS-901) of 100 reactions according to the instruction of the manufacture for Purification of the sequence reaction. A comparative analysis of sequences was performed using the CLUSTAL W multiple sequence alignment program, version 1.83 of Meg Align module of laser gene DNA star software Pairwise, which was designed by Thompson et al. (1994) to determine nucleotide and amino acid sequence similarities and relationships. Phylogenetic analysis was done using maximum likelihood, neighbour joining and maximum parsimony in MEGA6 (Tamura et al., 2013).
Ethical approval
Direct collection of tissues and organs from freshly slaughtered birds was carried out in strict accordance with the recommendations of Alexandria university, Egypt for the care and use of laboratory animals. Also, slaughtered chickens were humanly handled.
RESULTS
Investigated chicken flocks
Twenty-eight chicken farms suffered from clinical signs and post mortem lesions suspected to be of AI disease were investigated in this study. The diagnosis of AI depends on observation of clinical signs like cyanosis at comb, wattles and legs and sever sinusitis and severe respiratory signs and swelling in the head and post mortem pathological lesions like, tracheitis, petechial hemorrhage on proventriculus, congestion of pectoral and thigh muscles and all internal organs as liver, kidney, spleen, heart, brain and thymus in addition to sever pancreatitis with necrosis.
Virus isolation
All samples were isolated in fertilized SPF ECEs at age 10 days and the embryos mortality began after 48
hours post incubation. The dead embryos characterized by sever hemorrhage in all the body. By slide (HA), the positive samples were (3/8) from Dimiatta (4/9) from Gharbia and (7/11) from El-Behera (Table 4).
Real time-reverse transcription polymerase chain reaction
Concerning the results of RRT-PCR, (2/14) samples were positive to AI H5 (7/14) to NDV, (1/14) to H9 and (4/14) co-infected (2 samples had ND +AI H5 and others had (ND +AI H9) (Table 4).
Sequencing and phylogenetic analysis of H5N8 HPAI isolates results
The phylogenetic tree of HA gene was revealed that the two analyzed isolates (H5) were H5N8 HPAI Influenza Avirus{A/chicken/Egypt/Alex-1/2017(H5N8)} {A/chicken/Egypt/Alex-2/2017(H5N8)} and clustered together and belonged to clade 2.3.4.4 viruses which circulating in Russia and the two isolates were closely
related to the first Egyptian isolates (EPIISL224580) which was named A/common coot/Egypt/CA285/2016 (EG-CA285) in Egypt which was isolated from El-fayoum (Figure 1). In addition, amino acid sequencing revealed that the arrangement (PLREKRRKR/GLF) was found in the two isolates and were compared with other H5N8 isolates and commercial AI vaccines on the gene bank and found that the two isolates located at one group with Russian strains (Table 3). These two isolates have sequence identity equal to 99%. But the similarities between two isolated samples and other H5N8 sample which recorded on gene bank ranged between (94.199.3%). The similarity between the two isolates and other isolate which isolated in Egypt (EPIISL) is 97.4 - 97.7 %, also percent of similarity between the two isolated samples and other vaccines for AI virus ranged from 8091.7 % (Figure 2). These two isolates of H5N8 were submitted on gene bank under accession numbers MF182406 and MF182407.
Table 1. Oligonucleotide primers which used in RRT/PCR for identifying the samples oligonucleotide primers and probes used were supplied from Metabion (Germany) these analyses were done by national laboratory for veterinary quality control on poultry production, animal health research institute, Giza, Egypt at 2017
Primer/ probe sequence 5'-3' References
Avian influenza (H5) H5LH1 (F)ACATATGACTAC CCACARTATTCAG H5 RH 1 (R)AGACCAGCTAYCATGATTGC H5 (PRO) [FAM] TCWACAGTGGCGAGT TCCCTAGCA[TAMRA] Londt et al., 2008
Avian influenza (H9) H9(F)GGAAGAATTAATTATTATTGGTCGGTAC H9(R)GCCACCTTTTCAGTCTGACATT H9 (PRO)[FAM]AACCAGGCCAGACATTGCGAGTAAGATCC[BHQ] BenShabat et al., 2010
Infectious Bronchitis (IB) AIBV-( F)ATGCTCAACCTTGTCCCTAGCA AIBV-(R)TCAAACTGCGGATCATCACGT AIBV-(PRO)[FAM]TTGGAAGTAGAGTGACGCCCAAACTTCA [TAMRA] Meir et al., 2010
New castle Disease Virus (NDV) M+4100 (F)AGTGATGTGCTCGGACCTTC M-4220 ( R)CCTGAGGAGAGGCATTTGCTA M+4169(PRO)[FAM]TTCTCTAGCAGTGGGACAGCCTGC [TAMRA]-3' Wise et al., 2004
F: forward of the primer, R: reverse of the primer, PRO: probe of the primer
Table 2. Primers (for sequencing) of H5 isolates, primers were supplied from Metabion (Germany), these analyses were done by national laboratory for veterinary quality control on poultry production, animal health research institute, Giza, Egypt at 2017_
Virus Primer/ probe Amplified product Reference
H5 sequence5'-3'H5-kha-1(F)CCTCCAGARTATGCM TAY AAA ATT GTC H5-kha-3 (R)TACCAACCGTCTACC ATKCCYTG 311 bp Slomka etal, 2007
F: forward, R: reverse
Table 3. Amino acid sequence of H5N8 avian influenza virus subtype isolates these analyses were done by national laboratory for veterinary quality control on poultry production, animal health research institute, Giza, Egypt at 2017_
Avianinfluenza virus Amino acid sequence Accession number
lnfluenzaAvirus{ A/chicken/Egypt/ Alex1/2017(H5N8)} PEYAYKlVKKGDSTIMKSEVEYGHCNTKCQTPVGAINSSMPFHNIHPLTIGECPKYVKS NKLVLATGLRNSPLÄEKffÄZÄGLTOAIAGFIEGGWQGMVDGW MF182406
lnfluenzaAvirus{ A/chickenEgypt/ Alex-2/2017(H5N8 PEYAYKlVKKGDSTIMKSEVEYGHCNTKCQTPVGAINSSMPFHNIHPLTIGECPKYVKS NKLVLATGLRNCPLÄEKRÄZÄGLFGAIAGFIEGGWQGMVDGWY MF18240
F: forward, R: reverse
Table 4. History of investigated flocks, results of slide heamagglutination polymerase chain reaction, this investigation was done at 2016-2017
test and real time reverse transcriptase
Number of flock Age of birds /days Breed of birds Total number of flocks Mortality % Location HA Slide test RRT-PCR
1 26 Cobb 7000 8 El-Behera + NDV
2 29 Cobb 10000 9 EL-Behera + NDV
3 28 Avian48 15000 12 El-Behera + H9+NDV
4 33 Ross 5000 10 El-Behera - -
5 25 Avian48 6000 9 El-Behera - -
6 31 Ross 5000 9 El-Behera - -
7 35 Cobb 7000 8 El-Behera - -
8 34 Cobb 15000 20 Damietta + H5
9 33 Cobb 15000 8 Damietta + NDV
10 27 Cobb 20000 8 Damietta + NDV
11 29 Cobb 15000 9 Damietta - -
12 34 Avian48 5000 10 Damietta - -
13 26 Avian48 5000 8 Damietta - -
14 28 Ross 7000 8 Damietta - -
15 25 Cobb 5000 10 Damietta - -
16 33 Ross 8000 8 El-Gharbia + H9
17 31 Ross 20000 20 El-Gharbia + H5+NDV
18 34 Avian48 15000 20 El- Gharbia + H5+NDV
19 25 Cobb 10000 10 El- Gharbia + NDV
20 27 Cobb 6000 8 El-Gharbia - -
21 35 Avian48 10000 10 El-Gharbia - -
22 28 Ross 5000 19 El-Gharbia - -
23 28 Avian48 8000 10 El-Gharbia - -
24 35 Cobb 6000 8 El-Gharbia - -
25 27 Cobb 20000 15 El-Behera + H5
26 31 Avian48 5000 10 El-Behera + NDV
27 33 Cobb 6000 9 El-Behera + NDV
28 28 Cobb 10000 13 El-Behera + H9+ND
HA: hemagglutination test, Virus, H9: avian influenza
RRT-PCR: real time reverse transcriptase polymerase chain reaction, H5: virus H9, +: positive, -: negative
avian influenza virus H5, NDV: Newcastle Disease
Figure 1. Phylogenetic tree for the two field isolates highly pathogenic H5N8 (•) and the first Egyptian isolate ( 1 H5N8 strain and commercial vaccines against avian influenza
1 ) (EPiiSL) with other
Percent Identity
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 99.3 99.0 99.3 99.0 987 98.7 984 98.4 98.4 98.0 98.4 980 98.0 98.0 97.4 97.7 96.4 96.4 95.8 95.1 95.1 95.4 990 98.4 91.1 89.1 89.8 89.8 79.4 1
2 0.7 99.0 98.7 98.4 98.0 98.0 97.7 97.7 97.7 974 97.7 974 97.4 97.4 97.4 97.1 95.8 95.8 95.8 95.1 95.1 95.4 98.4 97.7 91.7 89.8 90.4 90.4 80.0 2
3 1.0 1.0 ■ 98.4 98.0 97.7 97.7 97.4 97.4 97.4 97.1 97.4 97.1 97.1 97,1 97.1 96.7 95.4 95.4 94.8 94.1 94.1 95.1 98.0 97.4 90.8 88.8 89.4 89.4 80.6 3
4 0.7 1.3 1.7 H 99.0 98.7 987 99.0 98.4 98.4 98.0 98.4 98.0 98.0 98.0 97.4 97.7 964 96.4 95.8 94.4 94.4 954 99.0 99.0 91.1 89.1 89.8 89.8 79.4 4
5 1.0 1.7 2.0 1.0 H 99.7 99.7 98.0 99.3 99.3 99.0 99.3 99.0 990 99.0 984 98.7 97.4 97.4 96.7 95.4 95.4 96.4 100.0 980 92.1 90.1 90.8 90.8 78.9 5
6 1.3 2.0 2.3 1.3 0.3 H 99.3 97.7 99.0 99.0 98.7 99.0 98.7 98.7 98.7 98.0 98.4 97.1 97.1 96.4 95.1 95.1 96.1 99.7 97.7 91.7 89.8 91.1 90.4 79.4 6
7 1.3 2.0 2.3 1.3 0.3 0.7 ■ 97.7 99.0 99.0 98.7 99.0 98.7 98.7 98.7 98.0 984 97.1 97.1 96.4 95.1 95.1 96.1 997 97.7 917 89.8 90.4 90.4 78.9 7
8 1.7 2.3 2.7 1.0 2.0 2.3 2.3 ■ 97.4 97.4 97.1 97.4 971 97.1 971 96.4 96.7 95.4 95.4 94.8 93.5 93.5 94.4 980 99.3 90.8 88.8 89.4 894 78.3 8
9 1.7 2.3 2.7 1.7 0.7 1.0 1.0 2.7 ■ 99.3 99.7 99.3 99.0 99.7 99.7 99.0 98.7 97.4 97.4 96.7 95.4 95.4 96.4 99.3 97.4 92.1 90.1 90.8 90.8 78.9 9
10 1.7 2.3 2.7 1.7 0.7 1.0 1.0 2.7 o.7 \m 99.0 99.3 99.7 99.0 99.0 98.4 99.3 98.0 98.0 97,4 96.1 96.1 97.1 99.3 97.4 92.7 90.8 91.4 91.4 78.9 10
11 2.0 2.7 3.0 2.0 1.0 1.3 1.3 3.0 03 1.0 99.0 98.7 993 99.3 987 98.4 97.1 97,1 96.4 951 95.1 961 99.0 97.1 91.7 898 90.4 90.4 78.3 11
12 1.7 2.3 2.7 1.7 0.7 1.0 1.0 2.7 0.7 0.7 1.0 ■ 99.0 99 0 99.0 984 99.3 97.4 97.4 96.7 95.4 95.4 96.4 99.3 97.4 92.1 90.1 90.8 90.8 78.9 12
13 2.0 2.7 3.0 2.0 1.0 1.3 1.3 3.0 1.0 0.3 1.3 1.0 ■ 98.7 987 98.0 99.0 97.7 97.7 97.1 95.8 95.8 96.7 99.0 97.1 92.4 90.4 91.1 91.1 78.9 13
14 2.0 2.7 3.0 2.0 1.0 1.3 1.3 3.0 0.3 1.0 0.7 1.0 1.3 ■ 100.0 98.7 98.4 97.1 97.1 96.4 95.1 95.1 96.1 990 97.1 92.4 90.4 91.1 91.1 79.4 14
15 2.0 2.7 3.0 2.0 1.0 1.3 1.3 3.0 0.3 1.0 0.7 1.0 1.3 0.0 ■ 98.7 98.4 97.1 97.1 964 95.1 95.1 96.1 99.0 97.1 92.4 90.4 91.1 91.1 79.4 15
16 2.7 2.7 3.0 2.7 1.7 2.0 2.0 3.7 1.0 1.7 1.3 1.7 2.0 1.3 1.3 ■ 97.7 96.4 96.4 96.4 95.1 95.1 96.7 98.4 96.4 92.4 90.4 90.4 91.1 79.4 16
17 2.3 3.0 3.4 2.3 1.3 1.7 1.7 3.4 1.3 0.7 1.7 0.7 1.0 1.7 1.7 2.3 ■ 97.4 97.4 96.7 95.4 95.4 964 98.7 96.7 92.1 901 90.8 90.8 78.9 17
18 3.7 4.4 4.8 3.7 2.7 3.0 3.0 4.8 2.7 2.0 3.0 2.7 2.3 3.0 3.0 3.7 2.7 ■ 993 98.7 97.1 97.1 98 0 97.4 95.4 93.4 90.8 92.4 92.1 77.2 18
19 3.7 4.4 4.8 3.7 2.7 3.0 3.0 4.8 2.7 2.0 3.0 2.7 2.3 3.0 3.0 3.7 2.7 0.7 99.3 97.7 97.7 98.7 97.4 95.4 94.1 91.4 93.1 92.7 77.8 19
20 4.4 4.4 5.5 4.4 3.4 3.7 3.7 5.5 3.4 2.7 3.7 3.4 3.0 3.7 3.7 3.7 3.4 1.3 0.7 97.7 97.7 98.7 967 94.8 94.1 91.4 93.1 92.7 77.8 20
21 5.1 5.1 6.2 5.9 4.8 5.1 5.1 7.0 4.8 4.1 5.1 4.8 4.4 5.1 5.1 5.1 4.8 3.0 2.3 2.3 100.0 97.1 95.4 93.5 941 91.4 92.4 92.7 77.8 21
22 5.1 5.1 6.2 5.9 4.8 5.1 5.1 7.0 4.8 4.1 5.1 4.8 4.4 5.1 5.1 5.1 4.8 3.0 2.3 2.3 0.0 ■ 97.1 95.4 93.5 94.1 91.4 92.4 92.7 77.8 22
23 4.8 4.8 5.1 4.8 3.7 4.1 4.1 5.9 3.7 3.0 4.1 3.7 3.4 4.1 4.1 3.4 3.7 2.0 1.3 1.3 3.0 3.0 H 96.4 94.4 94.1 91.4 93.1 92.7 78.3 23
24 1.0 1.7 2.0 1.0 0.0 0.3 0.3 2.0 0.7 0.7 10 0.7 10 1.0 1.0 1.7 1.3 2.7 2.7 3.4 4,8 4.8 3.7 ■ 980 92.1 901 90.8 90.8 789 24
25 1.7 2.3 2.7 10 2.0 2.3 2.3 0.7 2.7 2.7 3.0 2.7 3.0 3.0 3.0 3.7 3.4 48 4.8 5.5 7.0 7.0 5.9 2.0 H 90.1 881 88.8 888 78.3 25
26 9.7 8.9 10.0 9.6 8.5 8.9 8.9 10.0 8.5 7.7 8.9 8.5 8.1 8.1 8.1 8.1 8.5 7.0 6.2 6.2 6.2 6.2 6.2 8.5 10.8 ■ 96.7 97.4 98.0 78.3 26
27 12.0 11.2 12.4 12.0 10.8 11.2 11.2 12.4 10.8 10.0 11.2 10.8 104 10.4 10.4 10.4 10.8 10.0 9.2 9.2 9.2 9.2 9.2 10.8 13.2 3.4 ■ 97.4 98.7 78.3 27
28 11.2 104 11.6 11.2 10.0 9.6 10.4 11.6 10.0 9.2 104 10.0 9.6 9.6 9.6 10.4 10.0 8.1 7.3 7.3 8.1 8.1 7.3 100 12.4 2.7 2.7 ■ 98.0 78.9 28
29 11.2 10.4 11.6 11.2 10.0 10.4 10.4 11.6 10.0 9.2 10.4 10.0 9.6 9.6 9.6 9.6 10.0 8.5 7.7 7.7 7.7 7.7 7.7 10.0 12.4 2.0 1.3 2.0 ■ 78.3 29
30 24.9 24.1 23.2 24.9 25.8 24,9 25.8 26.7 25.8 25.8 26.5 25.8 25.8 24.9 24.9 24.9 25.8 28.5 27.6 27.6 27.6 27.6 26.7 25.8 26.7 27.0 27.0 26.1 27.0 M 30
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
KY701529.1 (H5N8) Alex1-2017 • Alex2-2017 ■ KP732646.1 (H5N8) KU042770.1 (H5N8) KP732640.1 (H5N8) KP732637.1 (H5N8) KY621534.1 (H5N8) KT936716.1 (H5N8) KP414809.1 (H5N8) KJ476669.1 (H5N8) KJ413834,1 (H5N8) KT221066.2 (H5N8) KT936708.1 (H5N8) KT936697.1 (H5N8) KU042767.1 (H5N8) KT221082.1 (H5N8) KP732631.1 (H5N8) KP732630-1 (H5N8) KT383486.1 (H5N8) KX297875.1 (H5N8) KX297874.1 (H5N8) KM504101.1 (H5N8) KU042769.1(H5N8) EPIISL224580(H5N8 FJ445226.1 Vectormune CY099579 1 Hefluvacl CY099580.1 Mefluvac2 CY062601.1 EGYFLU AY497096.1 Volvac
Figure 2. Identity and diversity of amino acid sequence of isolated tow field H5N8 (•) high pathogenic avian influenza compared with other H5N8 viruses and some commercial avian influenza vaccine
DISCUSSION
Highly pathogenic avian influenza A (H5N8) viruses of clade 2.3.4.4 spread into West Africa in late 2016 during the autumn bird migration. Genetic characterization of the complete genome of these viruses detected in wild and domestic birds in Cameroon on January 2017 demonstrated the occurrence of multiple virus introductions (Wade et al., 2018). The first report of highly pathogenic H5N8 avian influenza detection in Egypt, made it the third country in the Middle East that report the new H5 clade, which has also spread to several European countries after it was first identified in Russian migratory birds (Cidrap, 2016). The clinical signs and post mortem lesions recorded in this study supported by Abou Rawash et al. (2012); Horimoto and kawaoka (2001); Wasito et al. (2016); ElBakrey et al. (2013); Twabela et al. (2018). All investigated flocks were not vaccinated against avian influenza virus, and that may contribute to high mortality percent in the flocks. All samples were inoculated in SPF-ECEs as AI was completely adapted in (ECEs) via allantoic sac inoculation route , and lead to death of the embryo with hemorrhagic lesions (Brauer and chen, 2015; Salaheldin et al., 2017). Molecular identification of AI was carried out by using real time RT /PCR as it consider a
sensitive method for accurate AI detection (Hanna et al., 2015; Bouwstra et al., 2015) and in present study, 4/28 samples were positive to H5 from which two samples were positive pure. Performing real time RT/PCR followed by sequencing and phylogenetic analysis is very important and valuable technique to know strains of AI (Salaheldin et al., 2018; Li et al., 2017; Bouwstra et al., 2015) Two PCR positive samples (pureH5)were sequenced. The partition of amino acids (PLREKRRKR/GLF) means that the two isolates are high pathogenic AI virus (Kandeil et al., 2017; Selim et al., 2017). EG-CA285 contain three amino acid assignment differences in the HA protein, namely R22K , E268G and D487Y which distinguished EG-CA285 from the recent HPAIV (H5N8) clade 2.3.4.4b strain isolated in Russia (A/great-crested-grebe/Uvs-Nuur-Lake/341/2016) and in the NA protein, they observed four substitution mutations (V8A, V31L, G126E,I407T) that distinguished the EG-CA285 from the subtype found in Russia (Selim et al., 2017). And Phylogenetic analysis explained that relation-ship between the first Egyptian H5N8 isolate (EPI ISL 224580), two H5N8isolates and other H5N8 isolates (Figure 1) so, the two isolates (Alex1, Alex2) are related to clade 2.3.4.4b.
A total 301 deduced amino acids sequences from a.a position 1 to 301 were analyzed. The two isolates had
some changes of amino acids like S71C, A176G, A211T and G225A in Alex1-Alex 2 respectively but this difference has very little effect on the percent of identity between the two isolates equal to 99%. Also identity percent between the two isolates and other commercial AI vaccines ranged from 80-91.7% which approve the little genetically relation-ship between the two isolates and commercial vaccines so chicken sera will be of little or no titer and this approved also by Kandeil et al. (2017) who stated that, chicken sera induced by commercial inactivated H5- vaccines showed no or very low reactivity with H5N8 viruses so, it should be depend on biosecurity in prevention programs against AI H5N8 and put all possible rules for protecting the poultry industry in Egypt. Egypt is consider the bridge between Europe, Asia and Africa where millions of migrating birds pass during their flights annually particularly in winter. Thus, Egypt is under huge pressure from migratory birds from the entire world and researchers must improve the criteria of deal with any spot of infection.
CONCLUSION
We concluded from present study many respiratory viral diseases threaten poultry industry in Egypt and new avian influenza H5N8 strain isolated from different area in Egypt in addition to high distribution of avian influenza H5N1, so this industry needs to more efforts by veterinary authorities to reduce these spreading in Egypt and protect the industry to keep away human from the zoonotic infections.
DECLARATIONS
Competing interests
The authors have no competing interests to declare.
Consent to publish
All authors gave their informed consent prior to their inclusion in the study.
Authors contributions.
All authors participated in making the design, performing the experiment, analyses of the data, and writing the paper.
REFERENCES
Abdelwhab EM , Hassan MK , AbdelMoneim AS, Naguib MM,
Mostafa A, sein ITM, Arafa A, Erfan AM, Kilany WH,
Agour MG et al. (2016). Introduction and enzootic of A/H5N1 in Egypt: Virus evolution, pathogenicity and vaccine efficacy ten years on, El sevier - Infection, Genetics and Evolution, 40 (80-90): DOI: 10.1016/j.meegid.2016.02.023.
Abou-Rawash AA, Abd EL-Hamed HS, Abd-Ellatieff HA and Elsamanoudy SM (2012). Recent Outbreaks of Highly Pathogenic Avian Influenza Virus in Chickens and Ducks in Egypt, International Journal of Biotechnological Engineering and Life Sciences, 6(5): 256-264.
Ali A, Elmowalid G, Abdel-Glil1 M, Sharafeldin T, Abdallah F, Mansour S, Nagy A, Ahmed B and Abdelmoneim M
(2015). Etiology and pathology of epidemic outbreaks of avian influenza H5N1 infection in Egyptian chicken farms, Journal of Veterinary Sciences, 18(4): 779-786. DOI: 10.1515/pjvs-2015-0101
Ben Shabat M, Meir R, Haddas R, Lapin E, Shkoda I, Raibstein I, Perk S and Davidson I(2010).Development of a realtime TaqMan RT-PCR assay for the detection of H9N2 avian influenza viruses Journal Virol Methods.168 (1-2):72-7. DOI: 10.1016/j.jviromet.2010.04.019.
Bouwstra R, Heutink R, Bossers A, Harders F, Koch G, and Elbers A (2015). Full-Genome Sequence of Influenza A (H5N8) Virus in Poultry Linked to Sequences of Strains from Asia, the Netherlands, 2014, Emerging Infectious Disease Journal, 21(5): 872-874.
DOI: 10.3201/eid2105.141839.
https://www.ncbi.nlm.nih.gov/pubmed/?term=Bouwstra %20R%5BAuthor%5D&cauthor=true&cauthor uid=258 97965
Brauer R and Chen P (2015). Influenza Virus Propagation in Embryonated Chicken Eggs). Journal of visualized experiments, 97(1-6): DOI: 10.3791/52421
Charles WB (1989). serological procedures. laboratory manual for the isolation and identification of avian pathogens. Third edition, American Association of Avian pathologists, Philadelphia, USA. pp:192-200.
CIDRAP (center for infectious disease research and policy)
(2016). H5N8 avian flu outbreak expands to Egypt.
ElBakrey RM, El Sisi MA, Mansour SMG, Ahmed HH, Rajput
M and Eid AAM (2015). Cleavage site stability of Egyptian highly pathogenic avian influenza viruses in backyard chickens during 2009-2011. Microbiology journal, immunology and infection, 48: 28-35. DOI: org/10.1016/j.jmii.2013.12.002
Hagag IT, Mansour SMG, Zhang Z, Ali AAH, Ismail EM, Salama AA and Cardona CJ (2015). Pathogenicity of Highly Pathogenic Avian Influenza Virus H5N1 in Naturally Infected Poultry in Egypt, Plos journal, 10(5):1-15. DOI: org/10.1371/journal.pone.0120061
Hanna A, Banks J, Marston DA, Ellis RJ, Brookes SM and Brown IH (2015). Genetic Characterization of Highly Pathogenic Avian Influenza (H5N8) Virus from Domestic Ducks, England, November 2014. Emerging Infectious Disease journal, 21(5): 879-882. DOI: 10.3201/eid2105.141954
Horimoto T and Kawaoka Y (2001). Pandemic threat posed by avian influenza A viruses Clinical Microbiology Review, 14 (1):129-49. DOI: 10.1128/CMR.14.1.129-149.2001
Kandeil A, Kayed A, Moatasim A,Webby RJ, McKenzie PM, Kayali G and Ali MA (2017). Genetic characterization of highly pathogenic avian influenza A H5N8 viruses isolated from wild birds in Egypt, Journal of General Virology, 98 (7): 1573-1586. D01:10.1099/jgv.0.000847
Kandeil A, Sabir JSM, Abdelaal A, Mattar EH, El-Taweel AN, Sabir MJ, Khalil AA, Webby R, Kayali G and Ali AM (2018). Efficacy of commercial vaccines against newly emerging avian influenza H5N8 virus in Egypt, Scientific Reports volume (8): 9697-9702. D0I:10.1038/s41598-018-28057-x
Li M, Liu H, Bi Y, Sun J, Wong G, Liu D, Li L, Liu J, Chen Q, Wang H et al. (2017). Highly Pathogenic Avian Influenza A(H5N8) Virus in Wild Migratory Birds, Qinghai Lake, China, Emerging Infectious Disease journal, 23(4): 637-641. DOI: 10.3201/eid2304.161866
Löndt BZ, Nunez N, Banks J, Nili H, Johnson LK and Alexander DJ (2008). Pathogenesis of highly pathogenic avian influenza A/turkey/Turkey/1/2005 H5N1 in Pekinducks (Anasplatyrhynchos) infected
experimentally. Avian Pathology, 37(6): 619-627. DOI: 10.1080/03079450802499126.
Meir R, Maharat O, Farnushi Y and Simanov L (2010). Development of a real-time TaqMan® RT-PCR assay for the detection of infectious bronchitis virus in chickens, and comparison of RT-PCR and virus isolation. Journal of Virological Methods, 163: 190-194. DOI: 10.1016/j.jviromet.2009.09.014.
OIE Manual (2008). Update on highly pathogenic avian influenza in animals (type H5 and H7): 465-476.
Pantin-Jackwood MJ and Swayne DE (2009). Pathogenesis and pathobiology of avian influenza virus infection in birds, Revue Scientific Technique. 28(1):113-36. PMID: 1961862
Salaheldin AH, Veits J, Abd El-Hamid HS, Harder CT, Devrishov D, Mettenleiter TC, Hafez HM and Abdelwhab EM (2017). Isolation and genetic characterization of a novel 2.2.1.2a H5N1 virus from a vaccinated meat-turkeys flock in Egypt Virology Journal, 14(48): 1-11. DOI.org/10.1186/s12985-017-0697-5
Salaheldin AH, Abd El-Hamid HS, Elbestawy AR, Veits J, Hafez HM, Mettenleiter TC and Abdelwhab EM (2018). Multiple Introductions of Influenza A (H5N8) Virus into Poultry, Egypt, 2017. Emerging infectious disease journal, 24 (5):943-946. DOI: 10.3201/eid2405.171935. https://www.ncbi.nlm.nih.gov/pubmed/?term=Li%20M% 5BAuthor%5D&cauthor=true&cauthor uid=26677838
Selim AA, Erfan AM, Hagag N, Zanaty A, Samir AH, Samy M, Abdelhalim A, Arafa ASA, Soliman MA, Shaheen M
et al. (2017). Highly Pathogenic Avian Influenza Virus (H5N8) Clade 2.3.4.4 Infection in Migratory Birds, Egypt, emerging infectious disease journal, 23(6): 10481051. DOI: 10.3201/eid2306.162056
Slomka MJ, Coward VJ, Banks J, Löndt BZ, Brown IH, Voermans J, Koch G, Handberg KJ, Jergensen PH, Pansart MC et al (2007). Identification of sensitive and specific avian influenza polymerase chain reaction methods through blind ring trials organized in the European Union, Avian Disease journal, 51(1):227-234. DOI: 10.1637/7674-063006R1.1
Spackman E(2008). A brief introduction to the avian influenza virus. Methods Molecular Biology journal. 436:1-6. DOI: 10.1007/978-1-59745-279-3_1
Tamura K, Stecher G, Peterson D, Filipski A and Kumar S (2013). MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology journal, (30): 2725-2729. DOI: 10.1093/molbev/mst197
Thompson JD, Higgins DG andGibson TJ (1994). Nucleic Acids Research, 22(22):4673-4680. PMID: 7984417
Tong S, Zhu X, Li Y, Shi M, Zhang J, Bourgeois M, Yang H, Chen X, Recuenco S, Gomez J et al. (2013). New World Bats Harbor Diverse Influenza A Viruses, PLoS Pathology, 9(10): 1-12. DOI .org /10.1371 /journal .ppat .1003657
Twabela AT, Tshilenge GM, Sakoda Y, Okamatsu M, Bushu E, Kone P, Wiersma L, Zamperin G, Drago A, Zecchin B, and Monne I (2018). Highly Pathogenic Avian Influenza A(H5N8) Virus, Democratic Republic of the Congo, 2017. Emerging infectious diseases, 24(7):1371:1374. DOI:10.3201/eid2407.172123
Wade A, Jumbo SD, Zecchin B, Fusaro A, Taiga T, Bianco A, Rodrigue PN, Salomoni A, Kameni JMF, Zamperin G et al. (2018). Highly Pathogenic Avian Influenza A(H5N8) Virus, Cameroon, 2017, Emerging Infectious Diseases, 24(7):1367-1370. Doi: 10.3201/eid2407.172120
Wasito R, Wuryastuti H, Pambudy R and Maes RK (2016). Clinical signs and pathologic lesions of highly pathogenic avian influenza in Indonesia: A threat to Indonesian poultry, Merit Research Journal of Microbiology and Biological Sciences, 4(1):18-21.
World health Organization (WHO) (2006). Avian influenza: significance of mutations in the H5N1 virus.
Wise MG, Suarez DL, Seal BS, Pedersen JC, Senne DA, King DJ, Kapczynski DR and Erica Spackman E (2004). Development of a Real-Time Reverse-Transcription PCR for Detection of Newcastle Disease Virus RNA in Clinical Samples, Journal of clinical microbiology, 42 (1):329-338. PMID: 14715773
