CC BY
12
Mitochondrial and Nuclear DNA in Patients with Severe Polytrauma
M. Sh. Khubutia1, A. K. Shabanov1, M. V. Skulachev2, G. V. Bulava1, I. M. Savchenko3, O. A. Grebenchikov4, A. A. Sergeev1, D. B. Zorov3, R. A. Zinovkin3
1 N. V. Sklifosovsky Research Institute of Emergency Care, Moscow 2 Mitoengineering Research Institute, M. V. Lomonosov Moscow State University
3 A. N. Belozersky Research Institute of Physicochemical Biology, M. V. Lomonosov Moscow State University
4 V. A. Negovsky Research Institute of General Reanimatology, Russian Academy of Medical Sciences, Moscow
The components of mitochondria from the cells damaged by injury are a key component for the development of systemic inflammatory response syndrome (SIRS) under aseptic conditions. At the same time, there is a significant increase in the plasma level of mitochondrial DNA (mtDNA), which may be a prognostic marker for infectious complications in patients with severe polytrauma. Objective: to study the time course of changes in the serum levels of mtDNA and nuclear DNA (nDNA) in healthy individuals and patients with polytrauma and to reveal its possible association with the development of infectious pulmonary complications and with mortality. Subjects and methods. Seven healthy volunteers and 25 polytrauma with polytrauma of a mean injury severity score (ISS) of 40.2±9.2. Sixteen (64%) patients developed purulent tracheobronchitis and pneumonia; 5 (20%) patients died. The amount of mtDNA and nDNA was determined within the first at 12 and 24 hours, then on days 3 and 5—7 after injury by the authors' modified procedure using as the exogenous control of a circular DNA molecule. The content of mtDNA and nDNA was expressed as absolute values, by taking the arithmetic mean values as 100% for the volunteers. Results. There was a more than 2.5-fold increase in mtDNA levels in dead patients as compared to survivors (p<0.05); the differences in nDMA levels were insignificant (p=0.1). Within the first 12 hours, the mean mtDNA level in patients with pneumonia was 34 times greater than the reference values and continued to rise in the following 12 hours whereas in those without pneumonia, it was only 17 times higher with its further decrease in the comparable time periods. In the first 12 hours, nDNA was increased in both groups, but 24 hours after injury it was 2555 times more than the reference value only in patients with pneumonia whereas it was decreased 3-fold in those without this condition. Conclusion. This paper is the first to describe the time course of changes in the amount of mtDNA and nDNA with the new modification of using an external control DNA molecule in the serum of patients with polytrauma who developed infectious pulmonary complications and in patients without the latter. The findings point to the fact that it is advisable to measure mtDNA and nDNA in patients with polytrauma within the first 24 hours of hospital admission for the prediction of the development of infectious bronchopulmonary complications and for timely etiotropic therapy and that it is promising to conduct further investigations in this area. Key words: polytrauma, infectious complications, pneumonia, mitochondrial DNA, nuclear DNA, PAMS, DAMPs, CCBO, predictor, mortality, injury severity score, mechanical ventilation.
Infectious pulmonary complications that occur in polytrauma patients at early stages, are one of the major problems of modern medicine that results in the increasing the duration and cost of treatment of this category of patients in intensive care units (ICU), and are accompanied by a high mortality rate [1—3]. They take the first place among the polytrauma patients in the structure of all infectious complications they display [4] and occur in 25— 65% of patients on average. Moreover, these complications are the primary cause of death in 50—70% of all deceased patients [5—7]. Despite significant progress achieved in diagnostics and treatment of polytrauma, this problem currently remains unsolved since many aspects have not been yet expanded upon: issues of prediction, early detection of the disease, pathogenesis and treatment of infectious complications in ICU.
Previously, bacterial infiltration from the ischemic intestinal tract into the blood flow considered as a cause of systemic inflammatory response syndrome (SIRS), but, later this hypothesis was reconsidered [8]. Patients normally die as a result of multiple organ failure primarily due to insufficient tissue blood supply, resultant oxidative stress and developing the inflammatory reactions after all.
Correspondence to:
Aslan Kurbanovich Shabanov E-mail: aslan [email protected]
the inflammatory immune responses are carried out mainly by the innate immune system and are regulated by the neuroendocrine system [9, 10]. Such response starts from recognition of elements from microbes or damaged cells by some receptors presented in immunocompetent and other cells carrying structures generating a response on an antigen invasion. Consequently, specific signaling pathways are engaged to activate transcription factors and regulate gene expressionwhich invoke production of inflammatory signals. In addition, in blood plasma the complement system is activated which in concert with other systems enhance the inflammatory response. First initiating phase of inflammatory response induced by infection or tissue damage, associated with trauma is recognition of so called danger signals. There are two types of these signals — ones are those that are induced outside of the system and they include exogenous pathogens (pathogen-associated molecular patterns, PAMPs) while another are those that are represented by endogenous molecules aroused from the damaged host tissue (damage-associated molecular patterns, DAMPs) [11]. PAMPs are represented by lipopolisacharide of the outer membrane of gram-negative bacteria, their peptido-glycans and DNA, viral nucleic acids mannans of the yeast cell wall. PAPMs are specifically recognized and each binds to a proper receptor, in particular, to toll-like and nod-like receptors starting an inflammatory response. Besides these two, RAGE (receptors for advanced glyca-
tion final products) can also bind DAMPs (especially associated with infection and oxidative stress) and regulate immune and inflammatory responses [12]. DAMPs released as a result of tissue damage include endogenous equivalents of PAMPs. They are represented by heat shock proteins, nucleosomes, interleukins, and proteins of a class S100. In addition, since recently DAMPs started to include mitochondrial elements.
Mitochondrias are essential cellular components of humans and animals, providing energy for cells and participating in numerous other processes. In terms of evolution, mitochondria has an origin of an ancient gram-negative bacteria that came into symbiosis with eukaryotes cell, that's why few mitochondrial elements including mito-chondrial DNA (mtDNA) and some proteins in many aspects in many features resemble bacterial ancestor and contrary to the common rule of banning the reaction to the host organism elements activated inflammatory response In recent experiments it has been found that mitochondri-al components from cells damaged in the injury were able to activate named receptors and fire an inflammatory response. The response proceeded under sterile conditions, although resembled bacterial sepsis which implied that these mitochondrial components were the key elements of
SIRS under aseptic conditions, and mtDNA level significantly increases in the plasma of trauma patients [13—15].
It should be noted that the mtDNA level also increases in the blood plasma in some mitochondrial pathologies as well as in patients who take reverse transcriptase inhibitors during antiretroviral therapy [16]. Furthermore, the level of free circulating mtDNA can be increased in case of certain malignant neoplasms, e.g. solid tumors [17].
Hauser and coauthors were succeeded in identification of two mitochondrial components which could activate receptorscapable to recognize PAMP or DAMP: proteins with N-formylmethionine at the N-terminus, typical for bacterial proteins and mitochondrial DNA [13, 14]. Therefore the increase of the mtDNA concentration in the blood of patients with an injury might serve as a potential marker to predict consequences of injury. Moreover, it was shown that free circulating nucleic acids can be identified in the plasma of patients with an injury while the mtDNA level correlates with the severity of injuries and mortality [18].
For the first time, the increase in the number of extracellular DNA copies in the serum of patients with injuries of mild and moderate severity was described by Lo and coauthors in 2000 [19]. The main idea which explains the appearance of extracellular DNA in the blood of patients
Table 1
Characteristics of patients
Patients, n (%)
Total 25
Deceased 5
Mortality rate 20%
Gender
Male 75%
Female 25%
Age 42,6±17,4 years
Period of stay in Intensive Care Unit
Average stay 8,3
Kind of injury
Traffic accident 44%
Fall from height 36%
Train injury 8%
Home accident 4%
Work-connected injury 4%
Injury under unclear circumstances 4%
Tracheostomy
Tracheostomy performed 11 (44%)
Without tracheostomy 14 (56%)
Mechanical ventilation (MV)
No MV 2
1 day 5
2 days 4
3 days 3
Over 3 days 11
ISS scale, <30 2 (8%)
ISS scale, >30 23 (92%)
Nosocomial pneumonia 16 (64%)
Without pneumonia 9 (36%)
Specimen collection, hrs after injury
Up to 12 hours 16
12—24 hours 12
3rd day 15
5—7th day 12
Table 2
Sequences of primers for real-time PCR and basic characteristics of PCR products
Primer's name Nucleotide sequence of primers, from 5'to 3' Specificity PCR product length, bp
hMT3459F ACGCCATAAAACTCTTCACCAAAG Human mtDNA 110
hMT3569R GGGTTCATAGTAGAAGAGCGATGG
FWD(+) GCCAGGGTTTTCCCAGTCACGA Control DNA 275
REV(-) GAGCGGATAACAATTTCACACAGG
hID1F TCTTAACTGTTCCATTTTCCGTATCTG Human nDNA 87
hIDIR TCTTGGCGACTGGCTGAAAC
Table 3
Real-time PCR protocol
Period
Time
Temperature, X
Cycles number
Initiation period Denaturation Annealing Elongation
Melting profile
3 min 95 1
1 min 94 45
20 sec 58
20 sec 72
1 min 58
10 sec Starting from 58°C every 10 sec the temperature increment by 0.5°C 74
with an injury is a release of DNA molecules from damaged tissues directly to the blood flow, although the defects of the extracellular DNA degradation processes are also possible. Typically, one cell contains 100—1000 mtDNA copies, that is why the circulated mtDNA level might possess better potential as an injury predictive marker compared to nuclear DNA (nDNA). Existing methods of quantitative analysis of mtDNA in the blood either suppose to use nDNA as a reference point to determine the normal range, or use direct methods of real-time determination of concentration by PCR. However, nDNA fundamentally differs from mtDNA in molecular weight, base composition and conformation. This means that nDNA might serve as a better endogenic control in detecting mtDNA required for accurate quantitative measurement [20]. In this paper, the extracellular mtDNA and nDNA were quantitatively determined in sera of polytrauma patients. In addition, to exclude the use of expensive fluorescent probes the PCR-conditions were optimized with the aid of internal DNA control.
The objective of the study is to study the levels of mtDNA and nDNA in serum in healthy people and in patients with severe trauma over time as well as to detect a possible association between the circulating DNA levels and infectious pulmonary complications and mortality.
Materials and methods
The blood of 25 patients with severe polytrauma who received medical treatment in the Intensive Care Unit of Sklifosovsky Research Institute for Emergency Medicine in 2012—2013 including the blood of 7 healthy volunteers among hospital physicians. Within different time interval after the injury (first 12 hours, 12—24 hours, 3rd and 5—7th day) in patients with severe polytrauma the levels of mitochondrial and nuclear DNA in the blood serum were determined.
The study exluded patients with combined injury and patients of age over 70 years. The severity of injury was evaluated under Injury Severity Score (ISS), due to localization thereof: head, chest, abdomen, back bone, pelvis and extremities [21]. The average score as per ISS was 40,2±9,2. Gender, age, aspiration of
blood and gastric contents, tracheostomy, ventilation period and average permanence in the hospital were considered (Table 1).The course of injury was complicated by purulent tracheobronchitis and pneumonia in 14 patients (56%).
Two groups of patients were formed: survived (average ISS = 38±6) and deceased (average ISS = 49±12). The average values of mtDNA and nDNA were determined in each group within first 12 hours after injury.
As to the development of infectious pulmonary complications, two groups of patients were formed: group I — 9 pneumonia-free patients and group II — 16 patients with pneumonia diagnosed on days 3—7 after the admission. The diagnosis of nosocomial pneumonia was made based on occurrence of new focal infiltrative changes on the chest X-ray in combination with two patterns of following: fever, purulent sputum and (or) leukocytosis, bacteria in aspirate from tracheobronchial tree or blood as determined by generally accepted standards [22].
The results obtained were processed by methods of statistics (SPSS 11.5). To characterize random variables, averages of random variables (M), (standard error of the mean (m) and Pearson correlation coefficients were calculated When calculating the data non-parametric criterium Mann-Whitney U-test, Moses test for extreme reactions, and median test were used [23, 24].
Purification and quantity determination of mtDNA and nDNA.
Sample preparation. Prior to DNA purification, 10 ^l of 1.7 ng/^l concentration sample DNA of pBlueScriptSKII(-) plasmid was added to each 0.4 ml sample of the patient's serum, as an internal control of efficiency of the purification and further evaluation of the mtDNA level. Purification of the total DNA from the patients' blood serum was carried out with the use of DNeasy Blood&Tissue kit (QIAGEN, USA) under the manufacturer's protocol. The volume of the DNA purified was 100 ^l.
Real-time PCR. The primer pairs used in the study are listed in Table 2.
The real-time quantitative PCR was carried out in the BioRad iCycler amplifier with the mixture made up as follows: 5 ^l of the DNA sample; 10 ^l of the mixture B Eva Green (Syntol); 0.5 ^l 10 ^M of mixture of each of specific primers (sequences are given below); 9.5 ^l of deionized water. Each DNA sample was used as a template in three identical PCR reactions. The conditions of PCR are given in Table 3.
Data processing. Real-time PCR allows to compare the quantities of nucleic acids provided that the efficiency of reaction and the given level of threshold fluorescence are the same for each of reactions under comparison.The threshold cycle (C(T)) means
Table 4
Levels (M±m) of mtDNA and nDNA in serum in deceased and survived patients 12 hours post-trauma
Survived patients Deceased patients
mtDNA (%) nDNA (%) mtDNA (%) nDNA (%)
2060±1003* 24349±8258 4976±2271* 176611±161315
Note. * — P<0.05, Mann-Whitney U-test. Survived patients-ISS 38±6; deceased patients-ISS 49±12.
Table 5
Levels (M±m) of mtDNA and nDNA over time in groups with and without pneumonia
Time periods after injury Pneumonia («=16) No pneumonia («=9)
mtDNA (%) nDNA(%) mtDNA (%) nDNA(%)
< 12 hours 3433±1507 88226±64298 1715±395 19395±5698
12-24 hours 4850±1952*# 255522±140035 756±213*# 4438±1084
3rd day 1028±463 7435±3000 536±151 25259±11141
5-7th day 431±140# 11290±7416** 357±166# 5664±1278**
Note. * — differences between groups, mtDNA (P<0.05, median test); # — intragroup differences, mtDNA (P<0.05, Moses test); ** — intergroup difference, nDNA (P<0.05, Moses test).
Fig. 1. Dynamics of mtDNA content in patients with and without pneumonia
Here and in Figure 2: Ordinate: mtDNA (% to the control values). Absciss: time after the injury. * — differences between groups ,mtDNA (P<0.05, median test); # — intragroup differences, mtDNA (P<0.05, Moses test).
such a cycle n, in which some given level of reporter fluorescence is achieved — threshold fluorescence PC(T)=const.
In processing the values obtained the method of direct data comparison was used: in case of equal efficiency of reaction E (E — amplification efficiency) in samples 1 and 2 under comparison, the relative concentration of substrate R will amount to: R = P1/P2 = E-(C(T)rC(T)2) = e -Acm
The PCR reaction efficiency was estimated with the use of dilution of control molecules in the ranging from 1pg/ml to 10 Mg/ml. The results of the amplification data were normalized using control plasmid DNA added to the probes. The reactions carried out with the primers (Table 3) proceeded with similar efficiency close to 100%. That's why the following formula was used for further calculations: R = P1/P2 = 2 -(C(T)i-C(T)2)
The mtDNA and nuclear DNA levels were expressed in relative values taking arithmetic mean values R for healthy volunteers as 100%.
Results and discussion
The analysis of correlations between the ISS scores and mtDNA levels showed that there was a valid ISS cor-
relation (r=0.809, P<0.05) with measurements performed at the end of the first day of trauma. Significant correlation between ISS and the levels of nDNA was determined after 12 hours post injury (/=0.697). Twelve hours after the injury levels of mtDNA and nDNA in both groups of deceased and survived patients with severe polytrauma were significantly increased compared to the control (Table 4).
Despite the fact that the differences in the groups between the nDNA values were not significant (P=0.1), the level of mtDNA level was higher in deceased vs. survived patients (P<0.05).
Further, the comparative analysis of the mtDNA and nDNA levels in polytrauma patients depending on whether the further course of injury was complicated by pneumonia or not, was performed. It showed significant variations in both quantitative indices and trends thereof within 5 days. Specifically, within first 12 hours in both groups a significant increase in mtDNA serum content was observed compared to values in control group. However, the level of mtDNA in patients with nosocomial pneumonia developed in the unit exceeded the normal value more than 30 times. Moreover, during further 12 hours mtDNA levels increased about 50 times, whereis pneumonia-free patients showed only 17-fold increase followed by a more than two-fold decrease of mtDNA content in the next 12 hours. After 3 days, the differences between the groups were minimal (Table 5 and Figure 1), though both groups exhibited elevated level of mtDNA.
Significant differences in amount and kinetics of nDNA changes were also identified in patients depending on development of nosocomial pneumonia. In patients with
pneumonia, the nDNA levels exceeded the normal range of values about 900 times and 3000 times in 12 hours and 24 hours, respectively. In patients without pneumonia level of nDNA was about 200 times higher within 12 hours after injury with the following 4-fold decrease during next 12 hours (Table 5 and Figure 2).
It is known that mtDNA can serve as DAMP when it is accumulated in relatively increased amount in systemic circulation in a cell-free form [13, 14]. Previously published papers, reported the increase of the levels of mtDNA in injured patienrs [18, 25]. However, the pathogenic role and clinical impact of DAMPs in severe polytrauma as well as in the development of infectious pulmonary complications and critical illness without infection still remains unclear. This study for the first time described the dynamics of the extracellular DNA levels in the serum in patients with severe polytrauma and with/without pulmonary infection.
Several studies have demonstrated accumulation of typical mitochondria-derived products, formylated proteins and mtDNA, in blood early after the injury [11, 12]. We suggest that ischemia-reperfusion injury of organs and tissues in polytrauma causes severe oxidative stress and subsequent apoptotic or necrotic cell death accompanied by the release of cellular content, including mitochondrial matrix components (formylated proteins and mtDNA) into the blood. Massive release of these molecules intocircula-tion activates the innate immunity system, which in turn initiates the onset of SIRS during the first hours after injury. There is evidence that endogenous danger signals (DAMP) and exogenous structures (PAMP) cause different types of immune responses [26]. Hyperactivation of immune reactions caused by DAMPs probably prevents the immune system from reacting adequately to pathogenic microorganisms, thereby contributing to further development of infectious pulmonary complications. High concentrations of mtDNA found during the first 12—24 hours after the injury in patients who further developed infectious pulmonary complications indirectly confirm this hypothesis, though does not prove it.
We applied a new modification of the method of quantitative determination of mtDNA using DNA molecule as an intrinsic control, which significantly increased the method accuracy, and also eliminated the use of expensive PCR fluorescent probes thus leading to cost reduction
Fig. 2. Dynamics of nDNA in patients with and without pneumonia
* — P<0.05, Moses test
of the test. Compared to the previous papers, there are some differences in patients category used for the study: we analyzed patients with severe polytrauma (average ISS = 40,2±9,2) In addition, Futhermore, in this study for the first time the concentration of mtDNA was determined in serum and not in plasma from trauma patients as shown in earlier studies
Conclusion
The performed statistical analysis demonstrates significant correlation between the ISS-based severity of injury and the levels of mitochondrial DNA in patients with polytrauma within 24 hours (r=0.809, P<0.05).
Over two-fold increase in the mtDNA and nDNA levels was observed in the group of the deceased patients during first 12 hours after injury vs. group of the survived patients; moreover, the differences between these groups inf mtDNA level were significant (Mann-Whitney U-test, P<0.05).
Significant increase in the levels of mtDNA and nDNA during the first day after injury between patients who further developed nosocomial pneumonia and patients without infectious complications denotes the potential for further research in this area.
This paper demonstrates the reasons for monitoring mitochondrial and nuclear DNA content in the blood of patients with severe polytrauma early after the admission at the intensive care unit. Further study of dynamics of mtDNA and nDNA content in blood in extended groups of patients with severe polytrauma and correlations with clinical, biochemical and immune system parameters is warranted.
References
1. Burzhunova M.G., Guseva O.G., Rybakov V.Yu, Krichevsky L.A., Kozlov I.A. Informativnost natriiureticheskogo peptida B-tipa u kar-diokhirurgicheskikh bolnykh s giperkreatininemiei. [The informative value of N-terminal pro-type B natriuretic peptide in cardiac surgical
patients with hypercreatininemia]. Obshchaya Reanimatologiya. 2011; 7 (6): 40—45. [In Russ.] 2. Moroz V.V, Perepelitsa SA, Golubev AM, Golubev M.A. Tsitokiny -markery immunoreaktivnosti u nedonoshennykh novorozhdennykh. [Cytokines are markers of immune responsiveness in premature neonates]. Obshchaya Reanimatologiya. 2011; 7 (5): 36—41. [In Russ.]
3. Ostrova I.V., Avrushchenko M.Sh., Volkov A.V. Vzaimosvyaz urovnya eks-pressii belka GRP78 s vyrazhennostyu postishemicheskogo povrezh-deniya gippokampa u krys raznogo pola. [Association of GRP78 protein expression with the degree of postischemic hippocampal damage in rats of both sexes]. Obshchaya Reanimatologiya. 2011; 7 (6): 28—33. [In Russ.]
4. Smelaya T.V., SalnikovaL.E., Moroz V.V., Golubev A.M., Zarzhetsky Yu.V., Rubanovich A.V. Genetichesky polimorfizm i chastota razvitiya oslozh-nenii pri pnevmonii razlichnogo genezisa. [Genetic polymorphism and the rate of development of complications in pneumonia of varying genesis]. Obshchaya Reanimatologiya. 2011; 7 (2): 10—16. [In Russ.]
5. Ermolov A.S., Abakumov M.M., Sokolov VA., Kartavenko V.I., GalankinaI.E., Garaev D.A. Struktura gospitalnoi letalnosti pri sochetannoi travme i puti ee snizheniya. [Structure of hospital mortality in polytrauma and ways of its reduction]. Khirurgiya. Zhurnal Imeni N.I.Pirogova. 2006; 9: 16—20. [In Russ.]
6. Kollef M.H. Prevention of hospital-associated pneumonia and ventilator-associated pneumonia. Crit. Care Med. 2004; 32 (6): 1396—1405. http://dx.doi.org/10.1097/01.CCM.0000128569.09113.FB. PMID: 15187525
7. Egorova N.I., Vlasenko A.V., Moroz V.V., Yakovlev V.N., Alekseyev V.G. Ventilyator-assotsiirovannaya pnevmoniya: diagnostika, profilaktika, lechenie (sovremennoe sostoyanie voprosa). [Ventilator-associated pneumonia: Diagnosis, prevention, treatment (state-of-the-art of the problem)]. Obshchaya Reanimatologiya. 2010; 6 (1): 79—88. [In Russ.]
8. Khubutiya M.Sh., Shabanov A.K., Chernenkaya T.V., Godkov MA., Dorfman A.G. Infektsionnye legochnye oslozhneniya v reanimatsii i intensivnoi terapii u postradavshikh s sochetannoi travmoi. [Infectious pulmonary complications in intensive care unit patients with polytrauma]. Obshchaya Reanimatologiya. 2011; 7 (4): 24—27. [In Russ.]
9. Gumanenko E.K., Boyarintsev V.V., Nemchenko N.S., Rud A.A., Nikiforenko A.V., Pavlenko A.N. S-reaktivnyi belok pri tyazheloi sochetannoi travme, ne oslozhnennoi i oslozhnennoi sepsisom. [C-reactive protein in severe polytrauma complicated and uncomplicated by sepsis]. Vestnik Khirurgii Imeni I.I.Grekova. 2005; 164 (5): 55—59. [In Russ.]
10. Khubutiya M.Sh., Shabanov A.K. Osnovnye prichiny letalnosti u postradavshikh s tyazheloi sochetannoi travmoi v otdelenii reani-matsii. [Main causes of death in patients with severe polytrauma in the intensive care unit]. Skoraya Meditsinskaya Pomoshch. 2010; 11 (3): 64—69. [In Russ.]
11. Bodman K.-F, Lorents Dzh., Bauer T.T., Evig S., Trauman M., Fogel F. Nozokomialnaya pnevmoniya: profilaktika, diagnostika, lechenie. [Nosocomial pneumonia: Prevention, diagnosis, treatment]. Klinicheskaya Mikrobiologiya I Antimikrobnaya Khimioterapiya. 2004; 6 (1): 92—102. [In Russ.]
12. Moore F.A., Moore E.E., Poggetti R., McAnena O.J., Peterson V.M., Abernathy C.M., Parsons P.E. Gut bacterial translocation via the portal vein: a clinical perspective with major torso trauma.J. Trauma. 1991; 31 (5): 629-638. http://dx.doi.org/10.1097/00005373-199105000-00006. PMID: 2030509
13. Serov V.V., Paukov V.S. (red.). Vospalenie. Rukovodstvo dlya vrachei. [Inflammation. A manual for physicians]. M.: Meditsina Publishers; 1995: 640. [In Russ.]
14. Abakumov M.M., Bulava G.V. Povrezhdeniya grudi, zhivota i immunnaya sistema. [Chest and abdominal injury and the immune system]. Moscow: Firma Strom; 2006: 176. [In Russ.]
15. Castellheim A., Brekke O.L., Espevik T., Harboe M., Mollnes T.E. Innate immune responses to danger signals in systemic inflammatory response
syndrome and sepsis. Scand. J. Immunol. 2009; 69 (6): 479—491. http://dx.doi.org/10.1111/j.1365-3083.2009.02255.x. PMID: 19439008
16. Ibrahim Z.A., Armour C.L., Phipps S., Sukkar M.B. RAGE and TLRs: relatives, friends or neighbours? Mol. Immunol. 2013; 56 (4): 739—744. http://dx.doi.Org/10.1016/j.molimm.2013.07.008. PMID: 23954397
17. Hauser C.J., Sursal T., Rodriguez E.K., Appleton P.T., Zhang Q., Itagaki K. Mitochondrial damage associated molecular patterns from femoral ream-ings activate neutrophils through formyl peptide receptors and P44/42 MAP kinase. J. Orthop. Trauma. 2010; 24 (9): 534—538. http://dx.doi.org/10.1097/B0T.0b013e3181ec4991. PMID: 20736789
18. Zhang Q., Raoof M., Chen Y., Sumi Y., Sursal T., Junger W., Brohi K., Itagaki K., Hauser C.J. Circulating mitochondrial DAMPs cause inflammatory responses to injury. Nature. 2010; 464 (7285): 104—107. http://dx.doi.org/10.1038/nature08780. PMID: 20203610
19. Raoof M., Zhang Q., Itagaki K., Hauser C.J. Mitochondrial peptides are potent immune activators that activate human neutrophils via FPR-1. J. Trauma. 2010; 68 (6): 1328—1332. http://dx.doi.org/10.1097/ TA.0b013e3181dcd28d. PMID: 20539176
20. Lewis W., Day BJ., Copeland W.C. Mitochondrial toxicity of NRTI antiviral drugs: an integrated cellular perspective. Nat. Rev. Drug Discov. 2003; 2 (10): 812—822. http://dx.doi.org/10.1038/nrd1201. PMID: 14526384
21. Yu M. Circulating cell-free mitochondrial DNA as a novel cancer biomarker: opportunities and challenges. Mitochondrial DNA. 2012; 23 (5): 329-332. http://dx.doi.org/10.3109/19401736.2012.696625. PMID: 22775429
22. Lam N.Y., Rainer T.H., Chiu R.W., Joynt G.M., Lo Y.M. Plasma mitochondrial DNA concentrations after trauma. Clin. Chem. 2004; 50 (1): 213—216. PMID: 14709653
23. Lo Y.M., Rainer T.H., Chan L.Y., Hjelm N.M., Cocks RA. Plasma DNA as a prognostic marker in trauma patients. Clin. Chem. 2000; 46 (3): 319-323. PMID: 10702517
24. Myers M.B., Mittelstaedt RA., Heflich R.H. Using phiX174 DNA as an exogenous reference for measuring mitochondrial DNA copy number. Biotechniques. 2009; 47 (4): 867—869. http://dx.doi.org/10.2144/ 000113222. PMID: 19852770
25. Baker S.P., O'NeillB., Haddon W., Long W.B. The injury severity score: a method for describing patients with multiple injuries and evaluating emergency care.J. Trauma. 1974; 14 (3): 187—196. PMID: 4814394
26. Isenberg H.D. (ed.). Clinical Microbiology Procedures Handbook. Washington: American Society for Microbiology; 1992.
27. Afifi A., Eizen S. Statistichesky analiz: podkhod s ispolzovaniem EVM. [Statistical analysis: Computer-assisted approach]. Moscow: Mir; 1982: 488. [In Russ.]
28. Petri A., Sebin K. Naglyadnaya statistika v meditsine. [Descriptive statistics in medicine]. Moscow: GE0TAR-Media; 2003: 143. [In Russ.]
29. Yamanouchi S., Kudo D., Yamada M., Miyagawa N., Furukawa H., Kushimoto S. Plasma mitochondrial DNA levels in patients with trauma and severe sepsis: Time course and the association with clinical status. J. Crit. Care. 2013; 28 (6): 1027—1031. http://dx.doi.org/10.1016/ j.jcrc.2013.05.006. PMID: 23787023
30. Bianchi M.E. DAMPs, PAMPs and alarmins: all we need to know about danger. J. Leukoc. Biol. 2007; 81 (1): 1—5. http://dx.doi.org/10.1189/ jlb.0306164. PMID: 17032697
Submited 04.06.13
