CC BY
12
SHORT REPORTS
Mapping the D.melanogaster En1A Enhancer Modules Responsible for Transcription Activation and LongDistance Enhancer-Promoter Interactions
L. S. Melnikova*, E. A. Pomerantseva, V.V. Molodina, P. G. Georgiev
Institute of Gene Biology, Russian Academy of Sciences, Vavilova str. 34/5, Moscow, 119334, Russia
*E-mail: [email protected]
Received June 23, 2015; in final form, November 08, 2016
Copyright © 2017 Park-media, Ltd. This is an open access article distributed under the Creative Commons Attribution License,which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ABSTRACT The structure of the new enhancer En1A of the 1A region of the X chromosome of D. melanogaster was investigated. Two distinct regulatory elements were found. The first element is responsible for transcription activation, and the second element provides specific interaction with the promoter of the yellow gene. The findings support the hypothesis of a modular structure for enhancers, including certain sequences that bind transcription activators and special communication elements providing long-distance enhancer-promoter interaction.
KEYWORDS Drosophila melanogaster, long-distance interactions, transcription activation, enhancer structure, yellow gene.
ABBREVIATIONS TF - transcription factors; EnlA (Enhancer 1A) - enhancer of the 1A region of the X chromosome; Cm1A (Communicator 1A) - communication element of the EnlA enhancer; TE (tethering element) - a regulatory element in the promoter responsible for long-distance enhancer-promoter interactions.
INTRODUCTION
One of the key properties of enhancers is their ability to specifically activate the transcription of the target gene that, in some cases, covers a distance of tens or even hundreds of kilobase pairs [1]. However, the mechanisms that are at play for maintaining specific long-distance interactions between enhancers and promoters remain elusive. In some cases, the crs-regulatory sequences found within the promoter regions of eukary-otic genes have been known to enable communication between an enhancer and a promoter [2-4]. Collected data [5] suggest that the specificity of some enhancers is due to the presence in them of binding sites for the said transcription factors (TF), which are responsible for transcription activation, and of proteins providing a stable long-distance enhancer-promoter interaction.
The aim of the current study was to investigate the new enhancer EnlA found in the intron of the unexplored gene CG3777 located on the X chromosome.
The En1A enhancer was shown to have a modular structure. We found the activation and communication elements in the structure of EnlA. The activation element is able to functionally replace the yellow gene body and wings enhancers; i.e., stimulate transcription in the corresponding cuticular structures. The com-
munication element is necessary for the interaction between EnlA and the yellow gene promoter and able to provide long-distance GAL4-dependent transcription activation.
EXPERIMENTAL PROCEDURES
All constructs are based on a pCaSpeR3 vector containing the mini-white gene. The plasmid vector pCA derived from pCaSpeR3, which contains a deletion of the mini-white gene, has been described previously [6].
For the constructs EcoRI-PstI-Y, PstI-PvuII-Y, and HindIII-y+s-Y, the corresponding restriction fragments of the chimeric element from the y+s allele were used. The fragments were inserted upstream of the yellow gene promoter at position -343 bp (hereinafter, including figures, the numeration within the yellow locus is determined relative to the gene transcription initiation site) at the Kpnl restriction site.
For (a1-a2)Y construct design, yellow cDNA lacking a bristle intron and an enhancer was used (pCaSpeR3-Yil). A fragment of 362 bp was amplified from the genomic DNA of a y+s fly line using the primers al (5'-CTTTTTGCATACACATCCAC-3') and a2 (5'-GCTGATGGAAGTTGCAGA-3') and cloned into a vector based on the pBlueScript plasmid between two
loxP sites at the EcoRV site (a1-a2/lox). Next, a a1-a2/ lox fragment was cloned into the vector pCaSpeR3-Yil at the Kpnl site at position -343 bp. All of the constructs had a deletion of the yellow regulatory sequence of up to -343 bp (XbaI-Eco47III fragment).
In order to obtain a vector lacking yellow body and wing enhancers, the XbaI-Eco47III fragment containing body and wing enhancers was deleted from the pCA vector, which contains a complete sequence of the yellow gene (CA-y (-890)). In the constructs YG4(Cm1A), eveYG4(Cm1A), and AeveYG4(Cm1A), a DNA fragment containing 10 binding sites for the yeast activator protein GAL4 (two copies of five binding sites from the pUAST plasmid vector) was inserted into a CA-y (-890) vector at the 3'-end of the yellow gene at the Smal restriction site, while a a1-a2/lox fragment was inserted at the SacI restriction site. The procedures for the substitution of the -68 ... +130 bp sequence in the yellow promoter with the sequence of the eve promoter and how to obtain pre-promoter -69. -100 bp deletion have been described previously [2].
DNA constructs and a P-element with defective inverted P25.7wc repeats used as a source of transposase were injected into pre-blastoderm-stage embryos of yacw1118. The survived flies were crossed with a yacw1118 line. The transgenic flies were selected based on the phenotypic expression of the genes white and yellow. Lines with a single construct copy in the genome, which was confirmed by Southern blot analysis, were selected for further studies. Details of the cloning of yellow gene sequences into vectors, molecular methods of research, embryo transformation and production of transgenic lines of Drosophila, phenotypic analysis of yellow gene expression in transgenic lines, induction of site-specific recombination between loxP sites, and induction of GAL4-dependent activation in transgenic lines have been described in detail in previous studies [2, 5, 6].
Line yw1118; P[w+, tubGAL4]117/TM3, Sb (Bloom-ington Center #5138) was used for the induction of the yeast protein GAL4. Line y ac w1118;Cyo, P[w+,cre]/Sco was used for the induction of recombination between the loxP sites. The nucleotide sequence of the gene CG3777 and the structure and profile of its expression are presented in the FlyBase database (http://flybase. org/reports/FBgn0024989.html).
RESULTS AND DISCUSSION
In Drosophila melanogaster, gene yellow is responsible for the pigmentation of cuticular structures: the body, wings, and bristles. The enhancers that control yellow expression in the body and wing cuticle are located on the 5'-end of the gene, whereas the enhancer responsible for expression in bristles is located in the intron [7].
In wild-type flies, the body, wings, and bristles have a dark color.
The allele y2 is often used as a model system in works that study transcriptional regulation in D. melanogaster. The y2 allele has an incorporated retrotransposon, MDG4 (gypsy), between the promoter and enhancer of the body and wings of the yellow gene [8]. As a result, a Su(Hw) insulator comprising MDG4 blocks yellow activation through body and wing enhancers. Thus, the y2 phenotype is characterized by a yellow color of the body and wings, while the bristles are dark-colored.
The superunstable allele y+s (Fig. 1A) was obtained by induction of P-M hybrid dysgenesis in a line containing the y2 mutation [9]. Allele derivatives y+s - y2s1 and y2s2 containing a chromosome X region 1A duplication in the pre-promoter region of yellow have also been obtained [9, 10]. The study of the structure of the alleles y2s1 and y2s2 made it possible to identify the regulatory element 1A-RE, which activates long-distance yellow expression and is a yellow-specific insulator, within the duplicated fragment comprising the region 1A [10]. In the presented paper, we continued our thorough study of the structure of the y+s allele.
The mutation y+s was a result of the introduction of a chimeric 5,4 kb element at position -69 bp with simultaneous deletion of the yellow sequence between -146 and -70 bp. The chimeric element consists of 1,2 kb P-elements located "tail to tail" and a 3 030 bp sequence trapped between them, which presents a duplication of the region 1A of chromosome X and is located distal to the yellow locus in the genome (Fig. 1A) [9]. This duplication includes a fragment of the unexplored gene CG3777, which is expressed at the same stages of development as the yellow gene.
The body and wings of the flies carrying allele y+s exhibit a dark color close in intensity to the color of wildtype flies. Hence, gene expression is activated in the body and wings in the case when the 1A region from chromosome X is shifted to the yellow gene, despite the fact that the Su(Hw) insulator blocks the corresponding enhancers. We managed to localize a 1748 bp enhancer, which was called enhancer 1A (En1A), in the relocated DNA sequence by using transgenic constructs (Fig. 1B).
First, we tested two restriction fragments which together cover most of the region 1A duplications: Eco-Rl-Pstl of 771 bp and PstI-PvuII of 1748 bp (Fig. 1A). In the transgenic constructs EcoRI-PstI-Y and PstI-PvuII-Y, these fragments were located upstream of the yellow promoter at position -343 bp (Fig. 1B). Both constructs contained no body or wing enhancers. Among the lines carrying the EcoRI-PstI-Y construct, 19 flies out of 20 had an uncolored body and wings. The phenotype of the flies from transgenic PstI-PvuII-Y lines was similar to the wild-type phenotype in 23 out of 31 lines
LTR
LTR
X HR PHR EcoRI-PstI
V R H X
1 PstI-PvuII
1
al-a2
HindIII-PvuII
EcoRI-PstI
bp
PstI-PvuII-Y
Br
white
N/T A 1/20
-343bp HindIII-PvuII-Y
white
A 23/31
bp
(al-a2)Y
white
4 0/10
bp
white
4 0/17
1ÖX bp lox
Fig. 1. Mapping of a new enhancer, En1A, of the 1A region of the X chromosome. A - schematic representation of the structures of the yellow locus and y+s allele. The Yellow ex-ons and intron are depicted by black and white boxes, respectively. The direction of transcription is indicated by an arrow. Grey circles represent the tissue-specific transcriptional enhancers responsible for yellow expression in the wings (W), body (B), and bristles (Br). Triangles indicate insertions of the gypsy retrotranspo-son and chimeric element. Long terminal repeats (LTR) at the ends of the retrotransposon are shown by gray arrows. Black arrows in the chimeric element indicate the size and orientation of P-element sequences. The internal region of the chimeric element corresponding to the sequence of gene CG3777 is depicted by a gray rectangle. Abbreviations of the restriction sites are: R - EcoRI; X -Xhol; P - PstI; H - HindIII; V - PvulI. Localization and direction of PCR primers are shown by open triangles. The rectangles under the scheme of the chimeric element correspond to fragments comprising transgenic constructs.
B - schematic representation of transgenic constructs including fragments of the chimeric element. Arrows indicate the direction of yellow and white transcription. Ends of the P-element in the vector are shown by black triangles. White vertical arrows signed "lox" indicate Cre recombinase binding sites. N is the number of fly lines with a dark body and wings pigmentation. T is the total number of transgenic lines.
B
obtained, which is proof of the ability of the 1748 bp fragment to functionally replace the body and wing enhancers of the yellow gene. Hence, the EnlA enhancer is localized within the PstI-PvuII region.
In order to accurately map EnlA, two genetic constructs containing distinct PstI-PvuII fragments incorporated at position -343 bp were designed: HindIII-PvuII-Y and (a1-a2)Y (Fig. 1B). The HindIII-PvuII fragment, of 1 511 bp (Fig. 1A), had no enhancer properties: the body and wings of the flies were yellow in all 10 transgenic HindIII-PvuII-Y lines (Fig. 1B). A bio-
informatic analysis of the structure of the PstI-PvuII sequence revealed a 362-bp fragment comprising recurring motifs, which, possibly, could serve as binding sites for regulatory proteins. This DNA fragment was amplified by PCR using the primers a1 and a2 and then incorporated upstream of the yellow promoter as part of the (a1-a2)Y construct (Fig. 1B). Fragment a1-a2 is surrounded by the Cre recombinase recognition sites (loxР sites), which allow in vivo excision of the analyzed element [11]. It should be noted that yellow cDNA contained no bristle enhancer in the construct (a1-a2)Y
(Fig. 1B). We obtained 17 transgenic lines carrying the construct. Despite the absence of a bristle enhancer, the flies of all the lines had the y2 phenotype. Excision of the a1-a2 sequence resulted in the disappearance of pigmentation in bristles in 12 out of 15 lines. Thus, the studied 362 bp fragment within the (a1-a2)Y construct interacted with a promoter and stimulated yellow expression in bristles but was incapable of functionally substituting body and wing enhancers.
The obtained results allowed us to suggest that enhancer En1A has a heterogeneous structure. One part of the enhancer, (a1—a2) of 362 bp, named the "communication part" (hereinafter Cm1A), alone stimulates yellow expression only in the bristles. However, it is necessary for the stimulation of yellow expression by the full-length En1A in the body and wings. Another part of the PstI-PvuII sequence of 1,386 bp is capable of inducing a high level of yellow expression in the body and wings only in combination with the communication part (Fig. 1A, B). Full-length En1A of 1,748 bp activates yellow transcription in all cuticular structures. Apparently, the 1,386-bp fragment contains binding sites for yellow transcription activators in the body and wings, but their interaction with the promoter is provided by Cm1A-binding proteins.
To further explore the communication properties of the Cm1A element, we used a model system based on the properties of the yeast activator GAL4. This activator is known to stimulate promoters of various genes in the Drosophila genome [2]. However, GAL4, located at the 3'-end of the gene, is incapable of transcription activation [12]. In the construct YG4(Cm1A), the protein GAL4 binding sites and a potential communicator, Cm1A, surrounded by loxP sites were incorporated at the 3'-end of the yellow gene. In addition, the 5' sequence of yellow containing body and wing enhancers (up to -890 bp) was deleted (Fig. 2). In seven transgenic lines carrying the YG4(Cm1A) construct, the flies had a y2 phenotype. Thus, in the absence of GAL4 activation, the Cm1A fragment is incapable of activating the transcription of yellow in the body and wings. Then, we crossed YG4(Cm1A) transgenic lines with a line expressing the GAL4 protein. As a result of GAL4 activation, the body and wings of the flies in all the lines acquired a darker color (Fig. 2). Deletion of Cm1 A led to a decrease in yellow expression to its initial level. Therefore, the Cm1A element, indeed, has communication properties. It provides stable long-distance interaction with the GAL4 activator and yellow promoter.
Earlier, we had localized TE at -69 ... -100 of yellow, which provides long-distance interaction of body and wing enhancers with the yellow promoter, as well as the heterologous promoter of the gene eve [2]. We hypothesized that the Cm1A communicator functionally
Transgenic line
Body/wing pigmentation
N/T
5 4 3 2
-890 bp
yellow
YG4(CmlA)
I
^+GAL4 YG4
U+GAL4 -890 bp
yellow
GAL4
eveYG4(CmlA) L-+GAL4 eveYG4 L>-+GAL4 -890 bp
lox lox
... J J
1 5 1 - 7/7
- - - 7 7
- - - 7 0/7
lox 1ÓX
- 5 5 1 - 5/5
- 5 5
- 5 0/5
GAL4
GAL4
lox lox
6 6
6 0/6
6 6
6 0/6
►(A)^^ yellow — Aeve YG4(Cm 1 A)
L^+GAL4
AeveYG4 ^►+GAL4
Fig. 2. Screening of the communication properties of the Cm1A fragment. Results of the phenotypic analysis of the flies in transgenic lines are presented under construct schemes. Designations: y - yellow gene promoter; eve -even skipped gene promoter; black ellipse - Cm1A communicator. The arrow inside an ellipse indicates the transcription direction. Deletion of the yellow gene sequence of -69 to -100 bp (TE) is marked by A. Pigmentation of the body and wings is numbered from 5 (dark color, as in the wild-type) to 2 (yellow color corresponding to the phenotype of the y2 allele). The designation "+ GAL4" refers to the derivatives obtained after GAL4 activation in transgenic lines of the corresponding genotype. N is the number of lines of flies that acquired a new phenotype after Cm1A deletion or by crossing with the line expressing GAL4. T is the total number of lines examined for each particular construct. For other designations, see Fig. 1.
interacts with TE of the yellow gene. In order to test this hypothesis, the constructs eveYG4(Cm1A) and AeveYG4(Cm1A) were obtained (Fig. 2). In both constructs, the yellow gene promoter was replaced by a heterologous promoter of the eve gene (-68 ... +130 bp) (Fig. 3). Moreover, the TE sequence of the yellow gene was deleted in the AeveYG4(Cm1A) construct (Figs. 2, 3). The results obtained during a phenotypic analysis of five eveYG4(Cm1A) transgenic lines were similar to the results of a YG4(Cm1A) line analysis. As in the previous case, the communicator provided GAL4-de-pendent transcription activation of yellow. Since the structures of the yellow and eve promoters are different (Fig. 3), one can assume that the core elements of the promoter are not involved in the functional interaction with Cm1A. In six transgenic lines carrying the AeveYG4(Cm1A) construct, GAL4 activation did not lead to changes in the initial y2 phenotype (Fig. 2). Hence, the communicator Cm1A is incapable of supporting long-distance interaction between the transcription activator and the promoter of the gene in the absence of yellow gene TE. Apparently, the proteins binding the communication element Cm1A can interact with the proteins recruited to TE of the yellow gene. Such interaction brings the GAL4 activator and promoter spatially together in the described model system, which enables contact between the activation complex recruited to the GAL4 sequences and the transcription-al complex of the promoter.
CONCLUSION
The presented data allow us to conclude that the new enhancer En1A has a modular structure. In a previous study, we showed that the regulatory system of white also includes elements that do not affect transcription but provide long-distance enhancer-promoter interaction. The pre-promotor region and the eye enhancer of gene white contain binding sites for the Zeste protein. The Zeste protein is not involved in transcription activation but allows the eye enhancer to activate a longdistance promoter through binding to its target sites [5]. The results of the current study support the hypothesis that the regulatory regions of various genes have a modular structure and include activation elements that bind to transcription factors, initiating and providing efficient transcription and communication elements that bind proteins, providing spatial contact between an enhancer and a promoter. The described model
(-ii8)ccgaatcactaaaacca
ccg aagttggcgcgcgccttcgttttcatttt
ca t t ggc cigiciicgicii egg agaaaaaa
aacttcATATAAacgcggccgacata
ttatggccACcXGTcgttaccgcgcca
ggtccacagaagaggattaaaaaaatat
cacacagccgaaggctagagaagaacc
ccctatagctgaacatatataaacaaatat
a ttttttttta ttgcca a caca ctttgg ctta a g
tgttaagagtgattgtcagcttagagcta
agtgcaATG(+i73)
(-31)
yellow
TATAAA
(+1) CCAGTC
(+29)
GAGG
TATA
(-42) (-31)
GAGCGCA TATAAA
(+1)
CACTC - ->
eve
BRE TATA
iàr
Fig. 3. Promoter regions of the yellow and eve genes. The upper part of the figure depicts the sequence of the yellow promoter region. The TATA promoter, initiator, and translation start site are designated by capital letters. The 198-bp yellow region substituted in the eveYG4(Cm1A) and AeveYG4(Cm1A) constructs is shown in italic. The transcription initiation site is indicated by an asterisk. Partially duplicated sequences (a putative tethering element) upstream of TATA are underlined. The sequence of -69 to -100 bp including TE of the yellow gene is boxed. Figures in parentheses indicate the relative distance from the transcription start site. The core promoter elements of the yellow and eve promoters are shown schematically. Arrows indicate the transcription direction. Previously reported sequences of the TATA box (TATA), initiator (Inr), downstream promoter element (DPE), and the putative sequence of the TFIIB binding element (BRE) are shown. The sequences of core promoter elements are designated by capital letters.
systems can be used to study the enhancer structure and identification of the sequences involved in longdistance interactions between the regulatory elements of the genome.
The authors would like to express their gratitude to E.K. Koryagina for technical imput. This work was financially supported by a grant of the Russian Science Foundation (project № 14-14-01067).
REFERENCES
1. Erokhin M., Vassetzky Y., Georgiev P., Chetverina D. // Cell Mol. Life Sci. 2015. V. 72. № 12. P. 2361-2375.
2. Melnikova L., Kostuchenko M., Silicheva M., Georgiev P.
// Chromosoma. 2008. V. 117. № 2. P. 137-145.
3. Calhoun V.C., Levine M. // Proc. Natl. Acad. Sci. USA. 2003. V. 100. № 17. P. 9878-9883.
4. Calhoun V.C., Stathopoulos A., Levine M. // Proc. Natl.
Acad. Sci. USA. 2002. V. 99. № 26. P. 9243-9247.
5. Kostyuchenko M., Savitskaya E., Koryagina E., Melnikova L., Karakozova M., Georgiev P. // Chromosoma. 2009.
V. 118. № 5. P. 665-674.
6. Savitskaya E., Melnikova L., Kostuchenko M., Kravchenko E., Pomerantseva E., Boikova T., Chetverina D., Parshikov A., Zobacheva P., Gracheva E., et al. // Mol. Cell. Biol. 2006. V. 26. № 3. P. 754-761.
7. Geyer P.K., Corces V.G. // Genes Dev. 1987. V. 1. № 9. P. 996-1004.
8. Geyer P.K., Spana C., Corces V.G. // EMBO J. 1986. V. 5. № 10. P. 2657-2662.
9. Georgiev P., Tikhomirova T., Yelagin V., Belenkaya
T., Gracheva E., Parshikov A., Evgen'ev M.B., Samarina O.P., Corces V.G. // Genetics. 1997. V. 146. № 2. P. 583-594.
10. Pomerantseva E., Biryukova I., Silicheva R., Savitskaya E., Golovnin A., Georgiev P. // Genetics. 2006. V. 172. № 4. P. 2283-2291.
11. Siegal M.L., Hartl D.L. // Methods Mol. Biol. 2000. V. 136. P. 487-495.
12. Erokhin M., Davydova A., Kyrchanova O., Parshikov A., Georgiev P., Chetverina D. // Development. 2011. V. 138. № 18. P. 4097-4106.
