CC BY
2
LATE EFFECTS OF SUBCHRONIC CADMIUM EXPOSURE ON METALLOTHIONEIN GENE EXPRESSION IN RAT KIDNEYS
Ya.V. Valova*, A.A. Gisatullina, D.A. Smolyankin, E.N. Usmanova, A.S. Fazlyeva, G.F. Mukhammadiva, D.O. Karimov, N.Yu. Khusnutdinova, E.F. Repina
Federal Budgetary Institution Ufa Research Institute of Occupational Medicine and Human Ecology, 94 Stepana Kuvykina St., Ufa, 450106, Russia.
* Corresponding author: [email protected]
Abstract. Heavy metals, due to their ability to bioaccumulate and are highly toxic even in low concentrations, are the most dangerous environmental pollutants, especially in industrialized countries. The purpose of the study was to evaluate the degree of cadmium accumulation, as well as the expression of the Mtla and Mt2a genes, in the kidneys of rats using two experimental models of subchronic intoxication with cadmium chloride. A total of 80 adult white outbred rats of both sexes were equally distributed into four groups: a control group (negative control), group 1 (0.001 mg/kg/day CdCl2), group 2 (0.01 mg/kg/day CdCh), 3rd group (0.1 mg/kg/day CdCh). After three months of exposure, 10 animals (5 males and 5 females) were randomly selected from each group and euthanized, followed by kidney samples for cadmium analysis and gene expression assessment. The remaining animals (n = 40) were left for an additional 30 days without treatment, before being sacrificed to collect tissue. The results showed that 1 month after cadmium withdrawal, the processes of redistribution of the metal in the body are still ongoing, which is expressed in a greater accumulation of cadmium in the kidneys. We also recorded an increase in the Mtla gene expression and a decrease in the Mt2a gene expression in the kidneys of animals that went through the remission stage compared to animals without it. These data suggest that even after Cd withdrawal, there may be long-term negative effects on the kidneys.
Keywords: heavy metals, subchronic cadmium intoxication, cadmium, metallothioneins, renal toxicity.
Introduction
The rapid growth of industry and high rates of industrialization have led to serious environmental pollution with various xenobiotics, potentially hazardous to public health. Of these, heavy metals pose a particular threat to human life and health due to their bioaccumulation and high toxicity even at low concentrations. Cadmium (Cd) and lead are the most common heavy metals in the environment. However, Cd exhibits higher rates of transfer from soil to plants than other heavy metals such as lead and mercury, making it a food chain contaminant of serious concern. Although many countries around the world have taken a number of actions to reduce the harm associated with the use of Cd, environmental pollution with this representative of heavy metals still remains a pressing problem, especially in regions with developed industry (Akhpolova & Brin, 2020).
Cd is relatively easily absorbed from food and water and, upon entering the body, is distributed throughout it, accumulating with the highest concentrations in the liver and kidneys.
The predominant deposition of Cd in these organs is due to the fact that metal ions have an affinity for the structures of their membranes, forming chelate complexes with fairly strong bonds, so its elimination occurs very slowly. It is known that, depending on the dose, route and duration of exposure, Cd can cause renal dysfunction, liver dysfunction, genotoxicity and apoptotic effects. One of the manifestations of the detrimental effects of Cd is its effect on the metabolism of essential elements. Since this representative of heavy metals has similar chemical properties to trace elements such as iron, zinc and copper, Cd can replace these metals in their compounds with proteins (Nem-miche et al., 2011).
In most living organisms, protection against the toxic effects of heavy metals is provided by metallothionein (MT) proteins (Salinska et al., 2012). MTs are low-molecular, cysteine-rich proteins that have the ability to high-affinity bind heavy metal ions such as zinc, Cd, copper, mercury and others in biological systems (Don-dero et al., 2005). The mechanism by which Cd
induces MT expression in the liver and kidney has been proposed by Klaassen C.D. and Leh-man-Mckeeman L.D. Scientists have demonstrated that Cd entering the body through the bloodstream is imported into hepatocytes, where it induces the synthesis of MT proteins, to which more than 80% of the heavy metal binds (Klaassen & Lehman-Mckeeman, 1989). In adult mammals functional MTs exist in four isoforms. MT1 and MT2 (MT1/2) are expressed in different organs in heterogeneous abundance, whereas MT3 and MT4 have tissue-specific expression (Sabolic et al., 2018). Numerous studies have shown that induction of MT1/2 synthesis is a sensitive biomarker of heavy metal exposure and predict the toxic effects based on the strong correlation between MT expression and environmental heavy metal burden (Dondero et al., 2005; Genchi et al., 2020; Khalifa et al.., 2012). A better understanding of the pathogenesis of heavy metal poisoning is an important task in basic research and will also be useful for the development of preventive measures for heavy metal intoxication.
The purpose of the study was to evaluate the degree of Cd accumulation, as well as the expression of the Mt1a and Mt2a genes, in the kidneys of rats using two experimental models of subchronic intoxication with Cd chloride.
Materials and Methods
Animals
The experiment was carried out in two stages on 80 white outbred rats of both sexes weighing 170-230 g, which were equally distributed into four groups (10 males and 10 females, respectively). Rats were housed in cages under standard laboratory conditions: temperature of 20-25 °C, with a 12 h light/dark cycle and humidity around 50 ± 5% and provided with standard pellet diet #Cat. № Pro Feed for laboratory rats and mice (Bio Pro, Novosibirsk, Russia) and water ad libitum.
The experiment was carried out in two stages on 80 white outbred rats of both sexes weighing 170-230 g, which were equally distributed into four groups (10 males and 10 females, respectively): the control group (C) and 3 experimental groups. According to the meth-
odology for setting up a subchronic experiment, to assess the toxic effect of heavy metal, the animals of the experimental groups were orally administered an aqueous solution of Cd chloride (CdCh) containing 0.001 (group 1), 0.01 (group 2) and 0.1 (3rd group) mg of Cd per kg of body weight. The control group of animals receive distilled water in an equivalent volume. The calculation of the dosage is based on the indicator of temporary tolerated weekly consumption (TDI) at the level of 7 pg/kg of human body weight established for Cd by experts from WHO and FAO.
Three months after injection, 10 animals (5 males and 5 females) were randomly selected from each group and removed from the experiment by decapitation with collection of kidney samples for analysis. The kidneys were immediately removed after decapitation and autopsy. Small pieces of the organ were immediately frozen in liquid nitrogen for further assessment of Cd content and expression analysis. The rest of animals (n = 40) went through a remission stage for 1 month before being sacrificed to collect tissue.
Determination of Cd content
Organs were mined for sample preparation using a Speedwave Xpert microwave decomposition system (Berghof, Germany). The quantitative content of Cd was carried out using the method of atomic absorption spectrometry with electrothermal atomization on a VARIAN AA240Z device (Australia).
Real-time reverse transcription polymerase chain reaction analysis (real-time RT-PCR)
Total RNA was extracted with the kit Ex-tractRNA (Eurogene, Moscow, Russia) according to the manufacturer's instructions. Purified RNA isolated from each rat kidneys was reverse transcribed with the MMLV reverse transcriptase and oligo-dT primers (Eurogene, Moscow, Russia). Analysis of gene expression was carried out by realtime PCR methods on the Rotor-Gene device (QIAGEN, Germany) using oligonucleotide specific primers (Eurogene) (Table 1) containing intercalating a SYBR Green dye (#Cat. № PB025S, Euro-
Table 1
Rats' primer sequences used for real-time PCR analysis
Gene Forward primer (5'-3') Reverse primer (5'-3')
Mtla ACCCCAACTGCTCCTGCT AGGCACCTTTGCAGACACA
Mt2a CACGCTCCTAGAACTCTGC GAGCAGGATCCATCTGTGG
Gapdh ATGATTCTACCCACGGCAAG CTGGAAGATGGTGATGGGTT
gene, Moscow, Russia). The design of the qPCR primers was carried out using the Pri-merQuest Tool program (Integrated DNA Technologies, USA). The normalization of the expression level was performed using the Glyceraldehyde 3 phosphate dehydrogenase (GAPDH) gene. The delta-delta Ct method was used to calculate relative fold-change values between samples (Schmittgen & Livak, 2008).
Ethical approval
The study was carried out in compliance with the principles of the Animal Research Committee of the Russian Health Ministry, WHO, European Convention for the Protection of Vertebrate Animals used for Experimental and Other Scientific Purposes (Bol-shakov et al., 2008) and was approved by the Ethics Committee of Ufa Research Institute of Occupational Medicine and Human Ecology.
Statistical Methods
The statistical analysis was performed using IBM SPSS 19.0 (IBM, USA). Normality was assessed using the Kolmogorov-Smirnov test. Differences between groups were determined using the Kruskal-Wallis test. Differences were considered significant at p > 0.05.
Results
When recording the Cd content in the kidneys of rats after 3 months of intoxication with CdCl2 in different doses, a statistically significant increase in the concentration of Cd in the kidneys of animals was established in all experimental groups. In animals of the first experimental group, after 3 months of exposure, the average concentration of Cd in the kidneys increased 2 times relative to the control group (p = 0.0001) and amounted to 0.023 [0.015;
0.034] mg/kg. At a Cd dose of 10 ^g, the metal content was 0.071 [0.058; 0.14] mg/kg, which exceeded the control by 7 times (p = 0.0001). At the highest dose, the Cd concentration was 1.1 [0.89; 1.73] mg/kg, which exceeded this indicator in the control group by 100 times (p = = 0.0001).
Changes in Cd content in the kidneys were more pronounced after 3 months of treatment and 1 month of remission. In animals receiving 0.001 mg of CdCh, the Cd content in the kidneys increased 2.5 times relative to the control group (p = 0.001) which amounted to 0.028 [0.2; 0.4] mg/kg. When CdCh was administered at a dose of 0.01 mg, the metal content was 0.197 [0.14; 0.29] mg/kg, which exceeded the control by 17 times (p = 0.001). At the highest dose, the Cd concentration was 1.85 [1.1; 2.77] mg/kg, exceeding the control values by 164 times (p = 0.001).
A comparison of the two experimental periods showed statistically significant differences in the Cd content in the kidneys of experimental animals in all experimental groups. When exposed to CdCl2 in doses of 0.001 mg, 0.01 mg and 0.1 mg, the metal content was, respectively, 1.2; 2.77 and 1.68 times higher in the kidneys of animals that have passed the remission stage (Fig. 1).
Analysis of Mt1a gene expression in the kidney tissue of rats exposed to intoxication with various doses of CdCl2 for 3 months did not reveal statistically significant differences between the groups. Exposure to the toxicant led to a slight increase in the amount of gene transcripts in the kidneys of rats in all experimental groups, but no significant differences with the control were detected.
However, during subchronic CdCh intoxication with a period of remission, a statistically significant increase in the transcriptional activ-
Fig. 1. Cd content in the kidneys of rats in a subchronic experiment with/without remission period. * indicates significant difference p < 0.05 ** indicates significant difference p < 0.01
ity of the Mtla gene was noted in all experimental groups compared to the control 1.37 [0.47; 2.29]; (p = 0.012), 1.69 [0.68; 2.9]; (p = = 0.02), 1.79 [1.26; 2.17]; (p = 0.01), respectively. There was a dose-dependent effect from the minimum to the maximum dose.
When comparing the expression of the Mtla gene in two experimental models, it was noted that the number of gene transcripts predominated in the experiment with remission, but statistically significant differences were detected only in the group of rats receiving the toxicant at a dose of 0.01 mg. Expression of the Mtla gene in the kidneys of rats was more than 2 times higher in the group of animals that went through the remission stage than in the corresponding group of animals without remission (p = 0.041) (Fig. 2).
The expression of the Mt2a gene in the kidneys of rats during subchronic intoxication with CdCl2 was characterized by a statistically significant increase in the transcriptional activity of the gene in response to the administration of the toxicant in doses of 0.001,
0.01 and 0.1 mg, respectively - 1.82 [0.23; 7.11], 1.94 [1.48; 2.42] and 2.56 [1.55; 4.44].
When analyzing the fold expression of the Mt2a gene in renal tissue in a subchronic experiment with remission, it was noted that in the experimental groups there was a slight increase in the number of transcripts compared to the control group without a visible dose-dependent effect - 0.8 [0.4; 1.89]; p = 0.084; 1.11 [0.07; 2.33]; p = 0.046; 1.08 [0.07; 2.73]; p = 0.062). At the same time, statistically significant differences with the control group were detected only in the group receiving CdCl2 at a dose of 10 ^g/kg.
When comparing the fold expression rates of the Mt2a gene in the kidneys of rats in a subchronic experiment without and with remission, it was shown that gene activity in all experi mental groups was higher in the organs of animals that did not go through the remission stage. However, statistically significant differences were found only between groups in animals receiving 0.1 mg/kg CdCh (p = 0.031) (Fig. 3).
Fig. 2. Effect of different doses of CdCl2 on the Mtla gene expression in a subchronic experiment with/without remission period. * indicates significant difference (p < 0.05)
Fig. 3. Effect of different doses of CdCh on the Mt2a gene expression in a subchronic experiment with/without remission period. * indicates significant difference (p < 0.05)
Discussion
In this study, we compared the Cd content and the level of expression of MT genes in the kidneys of rats after 3 months of intoxication with various doses of CdCl2 in two experi-
mental models. The chronic effects of Cd on renal function are well documented. The kidneys along with the liver are the main target organs that accumulate most of the metal entering the body (Cobbina et al., 2015). Accumulation of
Cd in the kidneys of animals or humans chronically exposed to Cd has been demonstrated in numerous studies (Koizumi et al., 2008; Johri et al., 2010; Fazlyeva et al., 2021).
Liu Q. in their study showed that daily oral intake of CdCh in doses of 1 mg/kg, 2.5 mg/kg and 5 mg/kg for 60 days provides accumulation, respectively, of 12.341 |mol/L, 30.121 |mol/L and 54.420 |mol/L of metal in the kidneys (Liu et al., 2019). Long-term accumulation of Cd in the kidney is mainly due to the slow excretion of Cd, as previously reported: approximately 0.001% of body Cd is excreted per day, mainly through urine, and may also be due to redistribution of Cd from other organs such as the liver (Satarug & Moore, 2004).
As can be seen from our study, the Cd content in the kidneys of rats that went through the remission stage was significantly higher than in the organs of animals in the experiment without remission. This may indicate processes of Cd redistribution within the body after its intake has been cancelled. As is known, the primary site of Cd deposition is the liver, where it combines with MT proteins into the low-toxic form Cd-MT. After 30 days Cd withdrawal the metal, contained in the liver, pancreas and other organs undergoes gradual elimination, as a result the content in the kidneys may increase (Dudley et al., 1985; Chan et al., 1993).
A study with a similar design was conducted by Wang B. In their work, scientists showed that intraperitoneal administration of 20 nmol/kg CdCl2 to rats every other day for 4 weeks resulted in a gradual decrease in Cd content in the 20th, 28th, 36th, 44th and 52nd weeks from the beginning of the 4th week., however, it still remained 5 times higher than the control group (Wang et al., 2013). These results are slightly contradictory to those obtained in our study, which can be explained by different doses, treatment times, and methods of administration of the toxicant.
Interesting results were obtained when assessing the expression of MT genes. The amount of Mtla gene transcripts was higher in the experiment with remission, while the expression of the Mt2a gene, on the contrary, was higher in the experiment without remission.
It is known that theMT1/2 expression can be transcriptionally induced by a variety of environmental stressors such as metals, oxidative stress, or hypoxia (Haq et al., 2003). A key role in the regulation of transcription of the promoters of MT1/2 genes is played by transcription factor -1 (metal transcription factor 1 - MTF-1), which binds to specific DNA sequences in the promoter region of MT genes, called metal response elements (MREs) and causes their activation (Baeck et al., 2013). In turn, activation of MTF-1 requires stress-induced post-transla-tional modifications, mainly by dynamic phos-phorylation/dephosphorylation (Chen et al., 2014).
Activation of MT genes in the presence of Cd ions has been demonstrated in vitro. In a primary culture of human proximal tubule cells, MT1/2 was induced by only 0.5 ^M Cd (Boon-prasert et al., 2016). Zhang D. in their work demonstrated that the expression levels of the Mt1a and Mt2a genes were increased in the kidneys of rats after 3 weeks of intraperitoneal administration of 1.0 mg/kg Cd2+ in 0.9% NaCl. Moreover, the transcriptional activity of the Mt1a gene was higher than that of Mt2a gene (Zhang et al., 2012). Similar results were obtained by Dai S. in response to combined exposure to Pb(NO3)2 and CdCh-2.5H2O for 90 days (Dai et al., 2013).
In our study, we also noted an increase in the transcriptional activity of both the Mt1a gene and the Mt2a gene in response to oral administration of cadmium chloride at various doses. Although the fold expression was lower than in similar studies. Thus, Zhang D. et al. in their work showed that the mRNA levels of the Mt1a and Mt2a genes in the kidneys of treated rats were 13 and 5, respectively (Zhang et al., 2012), while in our study the expression of these genes was 1.16 and 2.56, respectively, in the group receiving the maximum dose of cadmium chloride for 3 months. These differences may be due to differences in dosage and exposure time.
Interesting results were obtained when comparing two experimental models. The amount of Mt1a gene transcripts was higher in the experiment with remission, while the expression
of the Mt2a gene, on the contrary, was higher in the experiment without remission. Although statistically significant differences were found only in certain groups. Unfortunately, the effects of long-term exposure to cadmium with a recovery period on the metal-lothionein genes expression are not sufficiently covered in the literature. In the above-mentioned study by Wang B., MT expression increased in rat kidneys at week 20 after 4 weeks of Cd exposure, and then gradually decreased in a time-dependent manner until week 52, still remaining above control levels. However, the authors do not provide data on the expression of Mt1a and Mt2a isoforms separately (Wang et al., 2013).
Conclusions
Thus, we demonstrated that a month after treatment of rats with CdCl2 was discontinued, the metal content in the kidneys continued to increase. The expression of the Mt1a and Mt2a genes showed differences in transcriptional activity depending on the experimental design, however, the mechanisms of induction of expression of these genes in experiments with a longer period of remission remain to be elucidated.
Funding: this work received no funding from any source.
Acknowledgments
None.
References
AKHPOLOVA V.O. & BRIN V.B. (2020): Modern ideas about the kinetics and pathogenesis of the toxic effects of heavy metals (literature review). Bulletin of New Medical Technologies 27(1), 55-61.
BACK C.M., STOHR S., SCHAFER E.A. & BUCH T.R. (2013): TSH induces metallothionein 1 in thyro-cytes via Gq/11-and PKC-dependent signaling. J Mol Endocrinol 51(1), 79-90.
BOLSHAKOV O.P., NEZNANOV N.G. & BABAKHANYAN R.V. (2008): Didactic and ethical aspects of conducting research on biomodels and laboratory animals. Qualitative Clinical Practice 1, 58-61 [In Russian].
BOONPRASERT K., SATARUG S., MORAIS C. & VESEY D.A. (2016): The stress response of human proximal tubule cells to Cd involves up-regulation of haemoxygenase 1 and metallothionein but not cytochrome P450 enzymes. Toxicology Letters 249, 5-14.
CHAN H.M., ZHU L.F., ZHONG R. & CHERIAN M.G. (1993): Nephrotoxicity in rats following liver transplantation from Cd-exposed rats. Toxicology and applied pharmacology 123(1), 89-96.
CHEN L., MA L., BAI Q. & XIAO Y. (2014): Heavy metal-induced metallothionein expression is regulated by specific protein phosphatase 2A complexes. Journal of Biological Chemistry 289(32), 22413-22426.
COBBINA S.J., CHEN Y., ZHOU Z. & YANG L. (2015): Interaction of four low dose toxic metals with essential metals in brain, liver and kidneys of mice on sub-chronic exposure. Environmental Toxicology and Pharmacology 39(1), 280-291.
DAI S., YIN Z., YUAN G. & ZHANG W. (2013): Quantification of metallothionein on the liver and kidney of rats by subchronic lead and Cd in combination. Environmental toxicology and pharmacology 36(3), 1207-1216.
DONDERO F., PIACENTINI L., BANNI M. & VIARENGO A. (2005): Quantitative PCR analysis of two molluscan metallothionein genes unveils differential expression and regulation. Gene 345(2), 259-270.
DUDLEY R.E., GAMMAL L.M. & KLAASSEN C D. (1985): Cd-induced hepatic and renal injury in chronically exposed rats: likely role of hepatic Cd-metallothionein in nephrotoxicity. Toxicology and applied pharmacology 77(3), 414-426.
FAZLYEVA AS., KARIMOV DO., DAUKAEV R.A. & ZELENKOVSKAYA EE. (2021): Accumulation of Cd in the organs of experimental animals and its effect on the content of essential elements during chronic intoxication. Hygiene and Sanitation 100(11), 1303-1309 [In Russian].
GENCHI G., SINICROPI M.S., LAURIA G. & CATALANO A. (2020): The effects of Cd toxicity. International journal of environmental research and public health 17(11), 3782.
HAQ F., MAHONEY M. & KOROPATNICK J. (2003): Signaling events for metallothionein induction. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 533(1-2), 211-226.
JOHRI N., JACQUILLET G. & UNWIN R. (2010): Heavy metal poisoning: the effects of Cd on the kidney. Biometals 23, 783-792.
KHALIFA O A., ALHUSSEINI N.F., SOSA G.A. & HEMEDA S.A. (2012): Effect of Cd chloride and/or vitamin "C" on metallothionein gene expression. J. Am. Sci 8, 198-203.
KLAASSEN C D. & LEHMAN-MCKEEMAN L.D. (1989): Induction of metallothionein. Journal of the American College of Toxicology 8(7), 1315-1321.
KOIZUMI N., MURATA K., HAYASHI C. & GOJI J. (2008): High Cd accumulation among humans and primates: comparison across various mammalian species - a study from Japan. Biological trace element research 121, 205-214.
LIU Q., ZHANG R., WANG X. & HAI C. (2019): Effects of sub-chronic, low-dose Cd exposure on kidney damage and potential mechanisms. Annals of translational medicine 7(8).
NEMMICHE S., CHABANE-SARI D., KADRI M. & GUIRAUD P. (2011): Cd chloride-induced oxidative stress and DNA damage in the human Jurkat T cell line is not linked to intracellular trace elements depletion. Toxicology in Vitro 25(1), 191-198.
SABOLIC I., SKARICA M., LJUBOJEVIC M. & LJUBESIC N. (2018): Expression and immunolocalization of metallothioneins MT1, MT2 and MT3 in rat nephron. Journal of Trace Elements in Medicine and Biology 46, 62-75.
SALINSKA A., WLOSTOWSKI T., MACIAK S. & KOZLOWSKI P. (2012): Combined effect of dietary Cd and benzo (a) pyrene on metallothionein induction and apoptosis in the liver and kidneys of bank voles. Biological trace element research 147, 189-194.
SATARUG S. & MOORE M R. (2004): Adverse health effects of chronic exposure to low-level Cd in foodstuffs and cigarette smoke. Environmental health perspectives 112(10), 1099-1103.
SCHMITTGEN T.D. & LIVAK K.J. (2008): Analyzing real-time PCR data by the comparative CT method. Nature protocols 3(6), 1101-1108.
WANG B., LUO Q., SHAO C. & CAI L. (2013): The late and persistent pathogenic effects of Cd at very low levels on the kidney of rats. Dose-Response 11(1), 11-046.
ZHANG D., GAO J., ZHANG K. & LI J. (2012): Effects of chronic Cd poisoning on Zn, Cu, Fe, Ca, and metallothionein in liver and kidney of rats. Biological trace element research 149, 57-63.
