Научная статья на тему 'Конструирование рекомбинантного штамма Escherichia coli продуцента основной субъединицы токсин-корегулируемых пилей адгезии TcpA Vibrio cholerae биовара Эль Тор'

Конструирование рекомбинантного штамма Escherichia coli продуцента основной субъединицы токсин-корегулируемых пилей адгезии TcpA Vibrio cholerae биовара Эль Тор Текст научной статьи по специальности «Фундаментальная медицина»

CC BY
438
40
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
ХОЛЕРНЫЙ ВИБРИОН / CHOLERA VIBRIO / БЕЛОК TCPA / TCPA PROTEIN / КЛОНИРОВАНИЕ ГЕНОВ / GENE CLONING / РЕКОМБИНАНТНАЯ ПЛАЗМИДА / RECOMBINANT PLASMID / ШТАММПРОДУЦЕНТ / АФФИННАЯ ХРОМАТОГРАФИЯ / AFFINITY CHROMATOGRAPHY / PRODUCER-STRAIN

Аннотация научной статьи по фундаментальной медицине, автор научной работы — Клавдиенко Елена Владимировна, Тучков Игорь Витальевич, Полунина Татьяна Алексеевна, Гусева Наталья Петровна, Смирнова Нина Ивановна

Цель работы. Конструирование рекомбинантного штамма E. coli, продуцента белка TcpA возбудителя холеры Эль Тор, несущего в геноме ген tсрАCIRS, и его использование для получения антигена. Материалы и методы. В работе использовали нетоксигенный штамм геновариант Vibrio cholerae биовара Эль Тор из ГКПБ ФКУЗ РосНИПЧИ «Микроб», а также коммерческие штаммы Escherichia coli и плазмиды для клонирования фирмы Invitrogen, США. Хромосомную ДНК из клеток V. cholerae выделяли с помощью набора Charage Smitch gDNA Mini Bacteria Kit методом нуклеосорбции. Для выделения плазмидной ДНК из клеток E. coli использовали набор PureLink Quick Plasmid DNA MiniprepKits. Присутствие гена tсрАCIRS определяли в ПЦР, используя рассчитанные нами праймеры. Фрагменты ДНК выделяли из агарозного геля с помощью набора PCR Clear-Up-System. SDSPAGE проводили по методу U.K.Laemmli. Концентрацию белка в пробах измеряли методом M.M.Bradford. Для очистки рекомбинантного белка TcpA применяли набор для аффиной хроматографии. Результаты и выводы.Сконструирован безопасный штамм E. coli – продуцент рекомбинантного белка TcpA – основной субъединицы токсин-коррегулируемых пилей адгезии возбудителя холеры Эль Тор. Участок гена tcpA V. cholerae биовара Эль Тор был клонирован в составе векторной плазмиды pET302 по сайтам рестрикции XhoI-BamHI в штамм E. coli BL21(DE3)Star. В этой конструкции биосинтез протеина находится под транскрипционным контролем промотора фага Т7 и индуцируется с помощью изопропил-β-тиогалактопиранозида (ИПТГ). Отработаны условия оптимальной продукции белка TcpA и схема его очистки с помощью аффинной хроматографии. Показано, что TcpA присутствует в клетках кишечной палочки как в нативной форме, так и в виде телец включения. Общая продукция белка TcpA составляет 60 мкг/мл. Полученный очищенный белок TcpA может быть использован для изучения его иммуногенных и физико-химических свойств, а также для разработки иммунодиагностических препаратов с целью оценки уровня продукции TcpA у различных штаммов V. cholerae и определения антигенного состава холерных вакцинных препаратов.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по фундаментальной медицине , автор научной работы — Клавдиенко Елена Владимировна, Тучков Игорь Витальевич, Полунина Татьяна Алексеевна, Гусева Наталья Петровна, Смирнова Нина Ивановна

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

Construction of Recombinant Escherichia coli Strain – Producer of Basic Subunit of Toxin-Coregulated Pilus of Adhesion (TCPA) of Vibrio cholerae Biovar El Tor

Objective of the study is to construct recombinant E. coli strain – producer of TcpA protein of cholera agent El Tor, carrying tcpACIRS gene in its genome, and use the strains for antigen production. Materials and methods. Utilized was non-toxigenic genovariant strain of Vibrio cholerae biovar El Tor from the “State Collection of Pathogenic Bacteria” at the premises of RusRAPI “Microbe”, as well as commercial E. coli strains and plasmids for cloning (Invitrogen, USA). Chromosomal DNA from V. cholerae cells was extracted using Charge Smitch gDNA Mini Bacteria Kit applying nucleo-sorption. To extract plasmid DNA from E. coli cells PureLink Quick Plasmid DNA MiniprepKits were used. The presence of tcpACIRS gene was assayed by PCR, using designed through our own efforts primers. DNA fragments were isolated from agarose gel with the help of PCR Clear-Up-System panel. SDS-PAGE was performed according to U.K.Laemmli method. Protein content of samples was measured by M.M.Bradford method. The panel for affinity chromatography was applied for recombinant TcpA protein purification. Results and conclusions. Constructed safe strain of E. coli is the producer of recombinant TcpA protein, basic subunit of toxin-coregulated pilus of adhesion of cholera agent biovar El Tor. The region of tcpA gene of Vibrio cholerae biovar El Tor was cloned as part of vector plasmid pET302 by the restriction sites XhoI-BamHI in E. coli strain BL21(DE3)Star. In the stated design protein biosynthesis is under transcriptional control of phage promoter T7 and induced by isopropyl-ß-thiogalactoside (IPTG). Tested were the conditions for optimum TcpA protein production and the layout of its purification using affinity chromatography. It was demonstrated that TcpA is present in cells of intestinal bacterium, both in native form and as inclusion bodies. Overall TcpA protein production amounted to 60 mcg/ml. Obtained purified TcpA protein can be used for studies of its immunogenic and physical-chemical properties, as well as development of immune-diagnostic preparations to evaluate the level of TcpA production in various V. cholerae strains, and identification of antigen composition of cholera vaccine preparations.

Текст научной работы на тему «Конструирование рекомбинантного штамма Escherichia coli продуцента основной субъединицы токсин-корегулируемых пилей адгезии TcpA Vibrio cholerae биовара Эль Тор»

Пробл. особо опасных инф. 2017; 4:32-37. DOI: 10.21055/0370-1069-2017-4-32-37

УДК 616.932:579.222

Е.В.клавдиенко, и.В.Тучков, Т.А.Полунина, н.П.Гусева, н.и.смирнова

КОНСТРУИРОВАНИЕ РЕКОМБИНАНТНОГО ШТАММА ESCHERICHIA COLI ПРОДУЦЕНТА ОСНОВНОЙ СУБЪЕДИНИЦЫ ТОКСИН-КОРЕГУЛИРУЕМЫХ ПИЛЕй АДГЕЗИИ TCPA

VIBRIO CHOLERAE БИОВАРА ЭЛЬ ТОР

ФКУЗ «Российский научно-исследовательский противочумный институт «Микроб», Саратов, Российская Федерация

цель работы. Конструирование рекомбинантного штамма E. coli, продуцента белка TcpA возбудителя холеры Эль Тор, несущего в геноме ген tсрАCIRS, и его использование для получения антигена. материалы и методы. В работе использовали нетоксигенный штамм геновариант Vibrio cholerae биовара Эль Тор из ГКПБ ФКУЗ РосНИПЧИ «Микроб», а также коммерческие штаммы Escherichia coli и плазмиды для клонирования фирмы Invitrogen, США. Хромосомную ДНК из клеток V. cholerae выделяли с помощью набора Charage Smitch gDNA Mini Bacteria Kit методом нуклеосорбции. Для выделения плазмидной ДНК из клеток E. coli использовали набор PureLink Quick Plasmid DNA MiniprepKits. Присутствие гена tсрАCIRS определяли в ПЦР, используя рассчитанные нами праймеры. Фрагменты ДНК выделяли из агарозного геля с помощью набора PCR Clear-Up-System. SDS-PAGE проводили по методу U.K.Laemmli. Концентрацию белка в пробах измеряли методом M.M.Bradford. Для очистки рекомбинантного белка TcpA применяли набор для аффиной хроматографии. результаты и выводы. Сконструирован безопасный штамм E. coli - продуцент рекомбинантного белка TcpA - основной субъединицы токсин-коррегулируемых пилей адгезии возбудителя холеры Эль Тор. Участок гена tcpA V. cholerae биовара Эль Тор был клонирован в составе векторной плазмиды pET302 по сайтам рестрикции XhoI-BamHI в штамм E. coli BL21(DE3)Star. В этой конструкции биосинтез протеина находится под транскрипционным контролем промотора фага Т7 и индуцируется с помощью изопропил-Р-тиогалактопиранозида (ИПТГ). Отработаны условия оптимальной продукции белка TcpA и схема его очистки с помощью аффинной хроматографии. Показано, что TcpA присутствует в клетках кишечной палочки как в нативной форме, так и в виде телец включения. общая продукция белка TcpA составляет 60 мкг/мл. Полученный очищенный белок TcpA может быть использован для изучения его иммуногенных и физико-химических свойств, а также для разработки иммунодиагностических препаратов с целью оценки уровня продукции TcpA у различных штаммов V. cholerae и определения антигенного состава холерных вакцинных препаратов.

Ключевые слова: холерный вибрион, белок TcpA, клонирование генов, рекомбинантная плазмида, штамм-продуцент, аффинная хроматография.

Корреспондирующий автор: Клавдиенко Елена Владимировна , e-mail: rusrapi@microbe.ru.

E.V.Klavdienko, I.V.Tuchkov, T.A.Polunina, N.P.Guseva, N.I.Smirnova

Construction of Recombinant Escherichia coli Strain - Producer of Basic Subunit of Toxin-Coregulated Pilus of Adhesion (TCPA) of Vibrio cholerae Biovar El Tor

Russian Research Anti-Plague Institute "Microbe", Saratov, Russian Federation

Objective of the study is to construct recombinant E. coli strain - producer of TcpA protein of cholera agent El Tor, carrying tc-pACIRS gene in its genome, and use the strains for antigen production. Materials and methods. Utilized was non-toxigenic genovariant strain of Vibrio cholerae biovar El Tor from the "State Collection of Pathogenic Bacteria" at the premises of RusRAPI "Microbe", as well as commercial E. coli strains and plasmids for cloning (Invitrogen, USA). Chromosomal DNA from V. cholerae cells was extracted using Charge Smitch gDNA Mini Bacteria Kit applying nucleo-sorption. To extract plasmid DNA from E. coli cells PureLink Quick Plasmid DNA MiniprepKits were used. The presence of tcpACIRS gene was assayed by PCR, using designed through our own efforts primers. DNA fragments were isolated from agarose gel with the help of PCR Clear-Up-System panel. SDS-PAGE was performed according to U.K.Laemmli method. Protein content of samples was measured by M.M.Bradford method. The panel for affinity chromatography was applied for recombinant TcpA protein purification. Results and conclusions. Constructed safe strain of E. coli is the producer of recombinant TcpA protein, basic subunit of toxin-coregulated pilus of adhesion of cholera agent biovar El Tor. The region of tcpA gene of Vibrio cholerae biovar El Tor was cloned as part of vector plasmid pET302 by the restriction sites XhoI-BamHI in E. coli strain BL21(DE3)Star. In the stated design protein biosynthesis is under transcriptional control of phage promoter T7 and induced by isopropyl-B-thiogalactoside (IPTG). Tested were the conditions for optimum TcpA protein production and the layout of its purification using affinity chromatography. It was demonstrated that TcpA is present in cells of intestinal bacterium, both in native form and as inclusion bodies. Overall TcpA protein production amounted to 60 mcg/ml. Obtained purified TcpA protein can be used for studies of its immunogenic and physical-chemical properties, as well as development of immune-diagnostic preparations to evaluate the level of TcpA production in various V cholerae strains, and identification of antigen composition of cholera vaccine preparations.

Key words: cholera vibrio, TcpA protein, gene cloning, recombinant plasmid, producer-strain, affinity chromatography.

Conflict of interest: The authors declare no conflict of interest.

Funding: The authors received no specific funding for this work.

Corresponding author: Elena V. Klavdienko, e-mail: rusrapi@microbe.ru.

Citation: Klavdienko E.V., Tuchkov I.V., Polunina T.A., Guseva N.P., Smirnova N.I. Construction of Recombinant Escherichia coli Strain - Producer of Basic Subunit of Toxin-Coregulated Pilus of Adhesion (TCPA) of Vibrio cholerae Biovar El Tor. Problemy Osobo Opasnykh Infektsii [Problems of Particularly Dangerous Infections]. 2017; 4:32-37. (In Russ.). DOI: 10.21055/0370-1069-2017-4-32-37

Холера - особо опасная инфекция, эпидемии которой регистрируются на территориях многих стран Азии, Африки, Южной Америки. Возникновение эпидемических осложнений по холере в России связано с ее заносами из зарубежных стран, неблагополучных по этой инфекции. Возбудителем текущей седьмой пандемии холеры, с 1961 г. по настоящее время, является Vibrio cholerae 01 биовара Эль Тор. К ключевым факторам, определяющим патогенный потенциал возбудителя холеры, относятся холерный токсин (СТ, Ло1егае toxin), вызывающий основной клинический симптом - профузную диарею, а также токсин-корегулируемые пили (ТСР, toxin-coregulated pilus), ответственные за колонизацию холерными вибрионами тонкого кишечника человека. Основной субъединицей ТСР является белок TcpA, кодируемый геном tcpA [2]. Структурные гены СТ и ТСР локализованы в геноме возбудителя на двух мобильных элементах - профаге СТХф и острове патогенности VPI-1 (Vibrio pathogenicity island) [3].

ТСР представляют собой пучки из тонких и гибких нитей длиной несколько микрометров и диаметром менее 10 нм, образующих на поверхности клетки длинные тяжи. Каждая нить состоит из го-мополимерных повторяющихся белковых субъединиц TcpA с молекулярной массой 20,5 кДа, которые относятся к IV типу пилей, встречающихся у большинства патогенных грамотрицательных бактерий. С-терминальный регион белка TcpA образует одну дисульфидную связь, необходимую для стабилизации структуры [6, 15]. Установлено, что ТСР являются не только ключевым фактором патогенности возбудителя холеры, но относятся также к протек-тивным антигенам, ответственным за формирование антиколонизирующего иммунитета при холере. Вследствие иммуногенности этот белок включен в состав многих рекомбинантных холерных вакцин [13, 14]. К настоящему времени установлено, что у возбудителя холеры эль Тор нуклеотидная последовательность гена tcpA представлена двумя основными аллелями: tepAElt и teрАCIRS. Аллель teрАЕ1 характерна для типичных штаммов возбудителя, а также геновариантов, вызывавших эпидемии холеры с 1961 по 2002 год. Измененная структура гена tcpA (аллель tepACIRS) обнаружена у высокопатогенных штаммов, изолированных в эндемичных по холере регионах в последующие годы - с 2003 г. и по настоящее время [10]. В отличие от аллели tepAElt, аллель tepACIRS несет одну несинонимичную нуклеотидную замену аденина на гуанин (A/G) в положении 266, что приводит к изменению аминокислотной последовательности в белке TcpA: в позиции 89 аспарагин заменен на серин. Функциональная значимость указанной замены в этом белке пока точно не определена. Тем не менее, широкое распространение геновариантов возбудителя с такой измененной структурой tcpA в разных регионах мира за счет вытеснения ими других штаммов возбудителя, а также их занос на территорию России в последние годы определили наш вы-

бор аллели tcpACIRS для создания штамма-продуцента кодируемого ей белка.

К настоящему времени известно о конструировании рекомбинантных штаммов E. coli - продуцентов белка TcpA - рядом зарубежных исследователей для последующего создания на их основе холерных вакцин [9, 12, 13, 14]. Однако в РФ до сих пор отсутствует подобный штамм-продуцент TcpA, который необходим не только для получения отечественных рекомбинантных холерных вакцин нового поколения, но и для создания иммунодиагностической тест-системы, предназначенной для оценки продукции этого фактора патогенности эпидемически опасными штаммами, поскольку ген tcpA относится к генетическим маркерам таких штаммов. Все это указывает на актуальность исследований, направленных на создание эффективных штаммов-продуцентов протективного белка TcpA.

В настоящее время в основу таких исследований положены достижения генной инженерии, позволяющие использовать экспрессирующие векторные системы, которые определяют возможность получения значительного количества белка с заданными структурно-функциональными характеристиками [12].

Целью нашей работы явилось конструирование рекомбинантного штамма E. coli, продуцента белка TcpA возбудителя холеры Эль Тор, несущего в геноме ген tcpACIRS, и его использование для получения этого антигена.

Материалы и методы

Донором гена tcpACIRS служил штамм V. cholerae M1430 биовара Эль Тор, полученный из Государственной коллекции патогенных бактерий ФКУЗ РосНИПЧИ «Микроб», выделенный от больного холерой на территории России (Тверь, 2005 г.). Для трансформации полученных реком-бинантных плазмид использовали коммерческие штаммы E. coli TOP10 (Invitrogen, США) и E. coli BL21 StarTM(DE3) (Invitrogen, США). Вектором для клонирования служили плазмиды pCR2.1 и рЕТ302 (Invitrogen, США).

Бактериальные штаммы V. cholerae, E. coli TOP10 (Invitrogen, США) и E. coli BL21 StarTM (DE3) культивировали на жидкой и агаризованной среде LB (рН 7,4) без антибиотиков или с добавлением ампициллина (50 мкг/мл). В качестве индуктора экспрессии клонированного гена tcpACIRS использовали изопропил-ß-D-тиогалактозид (ИПТГ ) (Invitrogen, США).

Хромосомную ДНК из клеток V. cholerae M1430 выделяли с помощью коммерческого набора Charge Smitch gDNA Mini Bacteria Kit (Invitrogen, США) методом нуклеосорбции. Для выделения плазмидной ДНК из клеток E. coli использовали коммерческий набор PureLink Quick Plasmid DNA Miniprep Kits (Invitrogen, США).

Компьютерный анализ нуклеотидных и амино-

кислотных последовательностей и конструирование праймеров для амплификации клонируемого фрагмента ДНК осуществляли с помощью пакета программ Vector NTI Suit 9 (Invitrogen, США).

Полимеразную цепную реакцию (ПЦР) проводили как описано ранее [3]. Продукты визуализировали под УФ-светом и фотографировали на гель-документирующей системе VersaDoc фирмы (BioRad, США) с использованием программы Quantity One v.4.6.9 (Bio-Rad, США). В качестве контроля молекулярной массы использовали коммерческие маркеры GenRulerTM 100 пн DNALadder (MBI Fermentas, Литва). Присутствие гена tcpA определяли в ПЦР, используя рассчитанные нами праймеры (F full ca-caaatggtggagttatat и R full gcttaactgttaccaaaagc), фланкирующие фрагмент длиной 701 п.н.

Плазмидный состав штаммов изучали методом скрининг-электрофореза в агарозном геле [8]. Фрагменты ДНК выделяли из агарозного геля с помощью набора PCR Clear-Up-System (Promega, США).

Секвенирование проводили с использованием автоматического секвенатора ABI3500xl (Applied Biosystems, США) с использованием наборов для секвенирования BigDye® Terminator v3.1 Cycle Sequencing Kit. SDS-PAGE электрофорез проводили по методу U.K.Lаemmli [10].

Двумерный гель-электрофорез осуществляли в ячейках Protean II xi и Protean II xi 2D (Bio-Rad Laboratories, США) согласно инструкции производителя с модификациями [4]. Гели анализировали в мультифункциональной системе гель-документирования Syngene с помощью программного обеспечения Dymension (G:BOX Chemi XT4, Великобритания).

Для получения лизатов клеток штамма-продуцента, выращенных в бульоне LB при 37 °C в объеме 50 мл, клетки осаждали центрифугированием при 10000 g в течение 10 мин. Осадок промывали и обрабатывали на ультразвуковом гомогенизаторе циклом озвучивания: 30 с ON, 30 с OFF, 10 раз при частоте 60 кГц на ледяной бане. Для разделения растворимой и нерастворимой фракций белка TcpA образовавшийся клеточный дебрис осаждали при 10000 g в течение 10 мин. Наличие белка в полученных образцах клеточного лизата, осадка и су-пернатанта контролировали с помощью SDS-PAGE электрофореза.

Концентрацию белка в пробах измеряли методом M.M.Bradford [5].

Для очистки рекомбинантного белка TcpA применяли набор для аффинной хроматографии (BioRad, США), содержащий Ni-NTA агарозу (Qiagen, Германия).

Результаты и обсуждение

Конструирование штамма-продуцента белка TcpA осуществляли в два этапа. На первом был получен безопасный штамм E. coli, содержащий пол-

норазмерный хромосомный ген tcpACMS возбудителя холеры в составе вектора для клонирования. Для этого вначале амплифицировали ген tcpACIRS, используя праймеры (F full и R full), фланкирующие его полную нуклеотидную последовательность со старт- и стоп-кодонами. Матрицей ДНК для амплификации гена tcpACIRS служил штамм V. cholerae M1430 биовара Эль Тор. Далее ПЦР-продукты подвергали электрофорезу в 1,5 % агарозном геле. Ампликон размером 701 п.н., соответствующий по молекулярной массе полноразмерному гену tcpACIRS, вырезали и очищали от агарозы на колонках (Centri-Sep Spin Columns Applied Biosystems, США). Далее очищенный пцр-продукт клонировали в плазмидном векторе pCR2.1. Плазмидную ДНК и ампликон гена tcpACIRS лигировали с использованием ДНК-лигазы Т4 (Thermo Fisher Scientific, Германия) согласно рекомендациям изготовителя, затем методом электро-порации лигазной смесью трансформировали компетентные клетки E. coli TOP10, которые высевали на селективную среду, содержащую ампициллин, хромогенный субстрат X-gal и индуктор ИПТГ для «сине-белой селекции». В отобранных белых колониях E. coli TOP10 наличие специфических вставок нуклеотидной последовательности гена tcpACIRS в плазмиде, содержащейся в клетках, подтверждали методом пцр с использованием указанных выше праймеров. Последующее секвенирование клонированного участка ДНК в четырех отобранных колониях штамма E. coli TOP10 pCR2.1 показало идентичность его нуклеотидной последовательности с таковой V. cholerae M1430 лишь у одного клона, который был отобран для дальнейшей работы и обозначен как E. coli TOP10 pCR2.1 tcpA. Таким образом, получен рекомбинантный штамм E. coli TOP10 pCR2.1 tcpA IV группы патогенности, содержащий векторную плазмиду с полноразмерным геном tcpACIRS указанного патогена (рис. 1).

На втором этапе работы путем переклонирования гена tcpA из плазмиды pCR2.1 tcpA в экспресси-рующую векторную систему рЕТ302 создан штамм-продуцент этого белка. Вначале получили укороченный фрагмент клонированного гена tcpACIRS, лишенного лидерного пептида, состоящего из 25 аминокислот и альфа-спирали, характерной для всех пилей адгезии IV типа. Для этого использовали метод ПЦР с рассчитанными нами праймерами, имеющими сайты для эндонуклеаз рестрикции XhoI и BamHI (рис. 1). В результате получили ампликон, который соответствовал фрагменту гена tcpACIRS размером 534 п.н. Далее ДНК выбранной экспрессирующей плазмиды рЕТ302 и ампликон укороченного гена tcpACIRS одновременно расщепляли эндонуклеазами рестрикции XhoI и BamHI (Thermo Fisher Scientific, германия) в течение 15 мин, рестрикционные фрагменты лигировали, и смесью лигированных молекул осуществляли трансформацию методом электропо-рации компетентных клеток E. coli BL21 StarTM(DE3) согласно стандартным протоколам.

Рис. 1. Схема конструирования рекомбинантного штамма E. coli BL21 Star™(DE3) pET302 tcpA

Выбор штамма E. coli BL21 StarTM(DE3) для экспрессии TcpA обусловлен тем, что в хромосоме этого штамма присутствуют мутации по гену рибо-нуклеазы (rne131), что снижает уровень деградации мРНК и увеличивает выход белка за счет стабильности процесса транскрипции (синтеза мРНК). Кроме того, мутация гена ompT устраняет мембранную протеазу OmpT и уменьшает деградацию экспрес-сируемых белков. Также в геном этого штамма интегрирован ген РНК-полимеразы фага Т7 для экспрессии с сильного Т7 промотора [7]. Полученные трансформанты культивировали на LB-агаре, содержащем 50 мкг/мл ампициллина при 37 °C в течение 18-24 ч. Нуклеотидная последовательность гена tcpA шести отобранных клонов была секвенирована. Для дальнейшей работы взяли один клон, обозначенный как E. coli BL21 StarTM(DE3) pET302 tcpA. таким образом, был сконструирован штамм E. coli BL21 StarTM(DE3) pET302 tcpA, несущий в плазмиде pET302 tcpA клонированный участок гена tcpACIRS (534 п.н.), который поставлен под контроль промотора фага, узнаваемого РНК-полимеразой фага T7. добавление в среду выращивания рекомбинантного штамма индуктора ИПТГ обеспечивало эффективную продукцию белка TcpA.

для изучения экспрессии клонированного фрагмента гена tcpACIRS клетки клона E. coli BL21 StarTM(DE3) pET302 tcpA выращивали на агаре LB в присутствии ампициллина (50 мкг/мл) при 37 °C. Затем две петли ночной культуры ресуспензировали в 2,0 мл бульона LB, культивировали до OD600 = 0,6 и вносили в колбы с 50,0 мл LB-бульона (pH 7,4) с добавлением ИПТГ. Для увеличения продукции целевого белка провели ряд экспериментов по выбору условий культивирования штамма-продуцента по следующим параметрам: концентрация ИПТГ (0,01; 0,05; 0,1; 0,5; 1 мМ), время после индукции (2 ч, 3 ч, 4 ч, 6-18 ч) и температура выращивания (30 и 37 °C). Присутствие рекомбинантного белка TcpA в клетках штамма кишечной палочки оценивали с помощью

12,5 % SDS-PAGE электрофореза. В результате показано, что при выращивнии штамма E. coli BL21 StarTM(DE3) pET302 tcpA в жидкой среде LB (pH 7,4) в условиях усиленной аэрации (200 об/мин) при температуре 37 °C в течение 2 ч после индукции 0,1 мМ ИПТГ на электрофореграммах в клеточном лизате штамма E. coli BL21 StarTM(DE3) pET302 tcpA присутствовала белковая полоса с молекулярной массой ~19,0-20,5 кДа (рис. 2, дорожка 2), которая отсутствовала в лизате клеток, выращенных без индукции, а также у контрольного штамма, содержащего векторную плазмиду. При нанесении отдельно осадка и надосадка определено, что белок TcpA в клетках штамма-продуцента присутствует как в нативной растворимой, так и в нерастворимой фракции в виде телец включения (рис. 2, дорожки 3, 4).

На следующем этапе работы получили очищенный белок TcpA. Наличие в плазмиде pET302 по-лигистидиновой метки (His-tag) дает возможность

Рис. 2. Анализ продукции белка TcpA рекомбинантным штаммом методом электрофореза:

1 - маркер молекулярного веса (Invitrogen, США); 2 - отрицательный контроль, штамм E. coli BL21 Star™(DE3) pET302; 3 - суммарный клеточный лизат штамма E. coli BL21 StarTM(DE3) pET302 tcpA с оптимальной индукцией ИПТГ; 4 - растворимая фракция рекомбинантного белка TcpA до очистки на колонке; 5 - нерастворимая фракция штамма E. coli BL21 StarTM(DE3) pET302 tcpA; 6 - первичная элюция нативной формы белка TcpA с Ni-NTA агарозы Native Binding Buffer с 250 mM имидазола; 7 — первичная элюция белка TcpA после рефолдинга

1 2 3 4 5

юс

70 50 40

30

20 15

10 kDa

Рис. 3. Электрофореграмма ренатурированной формы реком-бинантного белка TcpA, полученного из штамма продуцента E. coli BL21 Star™(DE3) pET302 tcpA комбинированным никель-хелатным методом:

1 - маркер молекулярной массы (Invitrogen, США); 2 - образец белка TcpA, полученный нативным методом; 3—5 - первые три элюции ренату-рированного белка TcpA после очистки комбинированным методом

выделения и очистки фракций рекомбинантного белка TcpA с помощью металл-хелатной аффинной хроматографии [1]. Подготовку колонки для металл-хелатной аффинной хроматографии (Bio-Rad, США), а также выделение и очистку фракций белка TcpA в нативных и денатурирующих условиях проводили согласно протоколам.

Для получения растворимой фракции белка TcpA в нативных условиях его супернатант наносили на колонку. Отмывку проводили с помощью буфера Native Wash Buffer, ступенчато повышая в нем концентрацию имидазола: 30 mM (10,0 мл), 50 mM (10,0 мл), 100 mM (10,0 мл) для уменьшения неспецифического связывания с сорбентом загрязняющих белков и повышения чистоты белка TcpA. Элюцию осуществляли с помощью буфера Native Elution Buffer с 250 mM имидазола. Фракции собирали в стерильные пробирки «Эппендорф» и анализировали на наличие белка с помощью SDS-PAGE электрофореза. Такая очистка позволила получить электрофоретически гомогенный белок TcpA (рис. 2, дорожки 5, 6).

После оптимизации уровня экспрессии TcpA показано, что этот рекомбинантный белок синтезировался в клетках штамма-продуцента в растворимой форме. Однако основное его количество находилось в осадке в виде телец включения, на что указывали результаты SDS-PAGE электрофореза. Тельца включения представляют собой частицы, состоящие из агрегатов рекомбинантного белка в денатурированном неактивном состоянии, что осложняет его последующее выделение и очистку. для устранения этой проблемы и восстановления присущей белку конфирмации осадок подвергли процессу рефолдинга.

для получения белка TcpA из телец включения использовали комбинированный метод очистки на колонках с никелем согласно протоколу набора ProBond (Invitrogen, США). Суть метода заключалась в приго-

товлении лизата и колонок в денатурирующих условиях, а проведение отмывки и элюции с использованием буферов - для нативного метода. Фракции белка после очистки собирали в стерильные пробирки и анализировали с помощью SDS-PAGE электрофореза (рис. 3, дорожки 3-5). Исследования полученных растворимых фракций рекомбинантного белка TcpA в нативных и комбинированных условиях показали, что все образцы целевого продукта идентичны и представляют собой электрофоретически гомогенный белок. Изучение белка TcpA 2D-электрофорезом на коммерческих IPG-стрипах (BioRad, США) показало, что белок TcpA фракционировался в пределах градиента рН 5-7 в виде группы белковых пятен с молекулярной массой 17,0-20,5 кДа.

Общая продукция рекомбинантного белка TcpA, определенная методом M.M.Bradford [5], составляла 60 мкг/мл.

Таким образом, сконструирован безопасный штамм E. coli - продуцент рекомбинантного белка TcpA (60 мкг/мл) - основной субъединицы TCP-геновариантов возбудителя холеры Эль Тор. Отработаны условия оптимальной продукции белка TcpA и схема его очистки с помощью аффинной хроматографии на колонках с никель-хелатным сорбентом. этот метод позволяет получать очищенный препарат рекомбинантного белка TcpA, который может быть использован для изучения его иммуногенных и физико-химических свойств, а также для последующей разработки на его основе иммунодиагностических препаратов с целью оценки уровня продукции TcpA у различных штаммов V. cholerae и определения антигенного состава холерных вакцинных препаратов.

Авторы приносят глубокую благодарность лаборанту-исследователю отдела микробиологии Н.В.Котовой за помощь в работе.

Конфликт интересов. Авторы подтверждают отсутствие конфликта финансовых/нефинансовых интересов, связанных с написанием статьи.

СПИСОК ЛИТЕРАТУРЫ

1. Кельциева О.А., Гладилович В.Д., Подольская Е.П. Металл-аффинная хроматография. Основы и применение. Научное приборостроение.

2. Смирнова Н.И., Горяев А.А., Кутырев В.В. Эволюция генома возбудителя холеры в современный период. Мол. генет., микробиол. и вирусол. 2010; 4:11-9.

3. Смирнова Н.И., Заднова С.П., Агафонов Д.А., Шашкова А.В., Челдышова Н.Б., Черкасов А.В. Сравнительный молекулярно-генетический анализ мобильных элементов природных штаммов возбудителя холеры. Генетика. 2013; 49(9):1036-47. DOI: 10.7868/S0016675813090087.

4. Полунина Т.А., Варшавская Ю.С., Заднова С.П., Краснов Я.М. Применение 2D-электрофореза для получения «белковых портретов» лизатов бактериальных культур возбудителей особо опасных инфекций. Пробл. особо опасных инф. 2016; 1:97-101.

5. Bradford M.M. Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976; 72:248-54.

6. Craig L., Taylor R.K., Pique M.E., Adair B.D., Arvai A.S., Singh M., Lloyd S.J., Shin D.S., Getzoff E.D., Yeager M., Forest K.T., Tainer J.A. Type IV pilin structure and assembly: X-ray and EM analyses of Vibrio cholerae toxin-coregulated pilus and Pseudomonas aeruginosa PAK pilin. Mol. Cell. 2003; 11(5):1139-50. DOI: 10.1016/S1097-2765(03)00170-9.

7. Grunberg-Manago M. Messenger RNA Stability and its role in control of gene expression in bacteria and phages. Annu. Rev.

Genet. 1999; 33:193-227.

8. Kado C.I., Liu S.T. Rapid procedure for detection and isolation of large and small plasmids. J. Bacteriol. 1981; 145(3):1365-73.

9. Kiaie S., Abtahi H., Mosayebi G., Alikhani M.Y., Pakzad I. Recombinant toxin-coregulated pilus A (TcpA) as a candidate subunit cholera vaccine. Iran. J. Microbiol. 2013; 6(2):68-73.

10. Laemmli U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T. Nature. 1970; 227(5259):680-5.

11. Matreja A., Kim D.W., Thomson N., Connor T.R., Lee J.H., Kariuki S. Evidence for multiple waves of global transmission within the seventh cholera pandemic. Nature. 2013; 477(7365):462-5. DOI: 10.1038/nature10392.

12. Molaee N., Mosayebi G., Amozande-Nobaveh A., Soleyman M.R., Abtahi H. Evolution of the immune response against recombinant proteins (TcpA, TcpB and FlaA) as a candidate subunit cholera vaccine. J. Immunol. Res. 2017:2412747. DOI: 10.1155/2017/2412747.

13. Price G.A., Holmes R.K. Immunizing adult female mice with a TcpA-A2-CTB chimera provides a high level of protection for their pups in the infant mouse model of cholera. PLoS Negl. Trop. Dis. 2014; 8(12):e3356. DOI: 10.1371/journaLpntd.0003356.

14. Rollenhag ;en J.E., Kalsy A., Cerda F., Manohar J., Harris J.B., LaRocque R.C., Qadri F., Calderwood S.B., Taylor R.K., Ryan E.T. Transcutaneous immunization with toxin-coregulated pilin A induces protective immunity against Vibrio cholerae O1 El Tor challenge in mice. Infect. Immun. 2006; 74:5834-9. DOI: 10.1128/ IAI.00438-06.

15. Sun D., Lafferty M.J., Peek J.A., Taylor R.K. Domains within the Vibrio cholerae toxin-coregulated pilin subunit that mediate bacterial colonization. Gene. 1997; 192(1):79-85. DOI: 10.1016/S0378-1119(97)00007-3.

References

1. Kel'tsieva O.A., Gladilovich V.D., Podol'skaya E.P. [Metal-affinity chromatography. Fundamentals and application]. Nauch. Priborostroenie. 2013; 23(1):74-85.

2. Smirnova N.I., Goryaev A.A., Kutyrev V.V. [Evolution of cholera agent genome in the modern period]. Mol. Genet. Mikrobiol. Virusol. 2010; 4:11-9.

3. Smirnova N.I., Zadnova S.P., Agafonov D.A., Shashkova A.V., Cheldyshova N.B., Cherkasov A.V. [Comparative molecular-genetic analysis of mobile elements of natural cholera agent strains]. Genetika. 2013; 49(9):1036-47. DOI: 10.7868/S0016675813090087.

4. Polunina T.A., Varshavskaya Yu.S., Zadnova S.P., Krasnov Ya.M. [Application of 2-D electrophoresis for the construction of '"protein profiles" of bacterial cultures lysates of particularly dangerous infections agents]. Probl. Osobo opasn. Infek. 2016; 1:97-101. DOI: 10.21055/0370-1069-20161-97-101.

5. Bradford M.M. Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976; 72:248-54.

6. Craig L., Taylor R.K., Pique M.E., Adair B.D., Arvai A.S., Singh M., Lloyd S.J., Shin D.S., Getzoff E.D., Yeager M., Forest K.T., Tainer J.A. Type IV pilin structure and assembly: X-ray and EM analyses of Vibrio cholerae toxin-coregulated pilus and Pseudomonas aeruginosa PAK pilin. Mol. Cell. 2003; 11(5):1139-50. DOI: 10.1016/S1097-2765(03)00170-9.

7. Grunberg-Manago M. Messenger RNA Stability and its role in control of gene expression in bacteria and phages. Annu. Rev. Genet. 1999; 33:193-227.

8. Kado C.I., Liu S.T. Rapid procedure for detection and isolation of large and small plasmids. J. Bacteriol. 1981; 145(3):1365-73.

9. Kiaie S., Abtahi H., Mosayebi G., Alikhani M.Y., Pakzad I. Recombinant toxin-coregulated pilus A (TcpA) as a candidate subunit cholera vaccine. Iran. J. Microbiol. 2013; 6(2):68-73.

10. Laemmli U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T. Nature. 1970; 227(5259):680-5.

11. Matreja A., Kim D.W., Thomson N., Connor T.R., Lee J.H., Kariuki S. Evidence for multiple waves of global transmission within the seventh cholera pandemic. Nature. 2013; 477(7365):462-5. DOI: 10.1038/ nature10392.

12. Molaee N., Mosayebi G., Amozande-Nobaveh A., Soleyman M.R., Abtahi H. Evolution of the immune response against recombinant proteins (TcpA, TcpB and FlaA) as a candidate subunit cholera vaccine. J. Immunol. Res. 2017:2412747. DOI: 10.1155/2017/2412747.

13. Price G.A., Holmes R.K. Immunizing adult female mice with a TcpA-A2-CTB chimera provides a high level of protection for their pups in the infant mouse model of cholera. PLoS Negl. Trop. Dis. 2014; 8(12):e3356. DOI: 10.1371/journal.pntd.0003356.

14. Rollenhagen J.E., Kalsy A., Cerda F., Manohar J., Harris J.B., LaRocque R.C., Qadri F., Calderwood S.B., Taylor R.K., Ryan E.T. Transcutaneous immunization with toxin-coregulated pilin A induces protective immunity against Vibrio cholerae O1 El Tor challenge in mice. Infect. Immun. 2006; 74:5834-9. DOI: 10.1128/IAI.00438-06.

15. Sun D., Lafferty M.J., Peek J.A., Taylor R.K. Domains within the Vibrio cholerae toxin-coregulated pilin subunit that mediate bacterial colonization. Gene. 1997; 192(1):79-85. DOI: 10.1016/S0378-1119(97)00007-3.

Authors:

Klavdienko E.V., Tuchkov I.V., Polunina T.A., Guseva N.P., Smirnova N.I. Russian Research Anti-Plague Institute "Microbe". 46, Universitetskaya St., Saratov, 410005, Russian Federation. E-mail: rusrapi@microbe.ru.

об авторах:

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Клавдиенко Е.В., Тучков И.В., Полунина Т.А., Гусева Н.П., Смирнова Н.И. Российский научно-исследовательский противочумный институт «Микроб». Российская Федерация, 410005, Саратов, ул. Университетская, 46. E-mail: rusrapi@microbe.ru.

Поступила 22.05.17.

i Надоели баннеры? Вы всегда можете отключить рекламу.