Научная статья на тему 'Изучение вставок прямых повторов в микроэволюции митохондрий и пластид растений на основе кластеризации белков'

Изучение вставок прямых повторов в микроэволюции митохондрий и пластид растений на основе кластеризации белков Текст научной статьи по специальности «Биологические науки»

CC BY
84
19
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
ВСТАВКИ ТОЧНЫХ ПРЯМЫХ ПОВТОРОВ / ПЛАСТИДЫ / МИТОХОНДРИИ / СЕМЕННЫЕ РАСТЕНИЯ / МИКРОЭВОЛЮЦИЯ НЕКОДИРУЮЩИХ УЧАСТКОВ ДНК / КЛАСТЕРИЗАЦИЯ ПЛАСТИДНЫХ БЕЛКОВ / PERFECT DIRECT REPEAT INSERTIONS / PLASTIDS / MITOCHONDRIA / SPERMATOPHYTA / MICROEVOLUTION / PROTEIN CLUSTERING

Аннотация научной статьи по биологическим наукам, автор научной работы — Зверков Олег Анатольевич, Русин Леонид Юрьевич, Селиверстов Александр Владиславович, Любецкий Василий Александрович

На основе кластеризации пластидных белков трех обширных групп растений и водорослей исследованы вставки точных прямых повторов и длины повторяемых участков в пластомах и митохондриях семенных растений. Предположено, что в ходе эволюции некодирующих участков ДНК прямые повторы часто возникают одномоментно, возможно, в результате репликативных ошибок, состоящих в удвоении участка ДНК. Обсуждается роль таких дупликаций в эволюции пластома.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по биологическим наукам , автор научной работы — Зверков Олег Анатольевич, Русин Леонид Юрьевич, Селиверстов Александр Владиславович, Любецкий Василий Александрович

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

Текст научной работы на тему «Изучение вставок прямых повторов в микроэволюции митохондрий и пластид растений на основе кластеризации белков»

ГЕНЕТИКА

УДК 575.852

ИЗУЧЕНИЕ ВСТАВОК ПРЯМЫХ ПОВТОРОВ

В МИКРОЭВОЛЮЦИИ МИТОХОНДРИЙ И ПЛАСТИД РАСТЕНИЙ

НА ОСНОВЕ КЛАСТЕРИЗАЦИИ БЕЛКОВ

О.А. Зверков*, Л.Ю. Русин, А.В. Селиверстов*, В.А. Любецкий*

(лаборатория геносистематики; e-mail: zverkov@iitp.ru)

На основе кластеризации пластидных белков трех обширных групп растений и водорослей исследованы вставки точных прямых повторов и длины повторяемых участков в пласто-мах и митохондриях семенных растений. Предположено, что в ходе эволюции некодирующих участков ДНК прямые повторы часто возникают одномоментно, возможно, в результате ре-пликативных ошибок, состоящих в удвоении участка ДНК. Обсуждается роль таких дупликаций в эволюции пластома.

Ключевые слова: вставки точных прямых повторов, пластиды, митохондрии, семенные растения, микроэволюция некодирующих участков ДНК, кластеризация пластидных белков.

Введение и постановка задачи. Широко рассматривается задача поиска в одном геноме неточных повторов некоторого участка ДНК ("слова"). Часто поиск выполняется с помощью программы REPuter [1]. В [2] эта программа применена к пластому Phoenix dactylifera и в нем найдены 11 прямых и обратных неточных повторов с длиной повторяемого слова 30 п.н. В [3] с помощью REPuter найдены прямые неточные повторы с длиной повторяемого слова от 10 до 100 п.н. в пластомах пяти видов рода Oenothera. В [2] рассматриваются неточные повторы в двух видах рода Silene. При секвенировании новых плас-томов среди первичной информации о них обычно ищутся и неточные повторы слов [4—6]. Можно привести много примеров такого типа результатов, в которых рассматриваются единичные геномы, в частности пластомы, и повторяемые слова не короткие (иначе возникает огромное перепредсказание), а повторы неточные (часто они имеют 90% точность).

В [7] на основе большого числа недавно сек-венированных пластомов рассматривалась эволюция большого инвертированного повтора, что не связано с изучением прямых точных повторов слов, которые, как показывают, в частности, наши результаты, имеют сравнительно небольшую длину. Работа [8] посвящена полиморфизмам в почти совпадающих геномах митохондрий некоторых близких растений родов Oryza и Brassica; в ней отмечено, что ранее рассматривался и вид Beta vulgaris. В нашей заметке сопоставлены более далекие друг от друга митохондрии видов из больших таксономических групп.

Существенное обстоятельство, побуждающее к исследованию произвольной длины точных повторов некоторого слова, состоит в том, что модель независимых однонуклеотидных замен и вставок, обсуждаемая, например, в [9], не позволяет объяснить их в случае слова с длиной четыре и более п.н. в некодирующих областях генома. Хотя такие вставки часто встречаются, например в хлоропластах.

В [9, 10] приведен перечень основных эволюционных событий в некодирующих областях хлоро-пластов и отмечена высокая частота вставок (точных) прямых повторов слов и особенно многократной вставки одного нуклеотида. Однако в [9, 10] рассматривались только короткие специальные участки геномов, например интроны первой группы гена ШЬ у а81епё8. Такие вставки использовались для построения и классификации деревьев видов [11].

Мы рассмотрим задачу поиска и подсчета числа вставок (точных) прямых повторов любой длины в не-кодирующих областях, включая интроны, в пластидах и митохондриях видов семенных растений. Подчеркнем, что эта задача не сводится к поиску повторов в отдельных последовательностях и требует существенно множественного выравнивания последовательностей, например ради возможности отличить вставку от серии независимых нуклеотидных замен. Чтобы пояснить разницу между повторами и вставками повторов, мы дадим следующее определение. Вставка прямого повтора наблюдается как множественное выравнивание нуклеотидных последовательностей,

* Федеральное государственное бюджетное учреждение науки Институт проблем передачи информации им. A.A. Харкевича РАН, г. Москва.

tgactctttcaag----аттсаттсатстст

tgaatcttgaaag--------аттсатстст

tggatcttgaaag--------аттсатстст

tggatcttgaaag----аттсаттсатстст

т g gat с т т gaaagaaagatт CATтсат с т с т

Рис. 1. Множественное выравнивание участков 5'-лидерных областей гена psbM. Повторяемое слово f выделено полужирным

в котором имеются две строки: одна ("образец") содержит точный прямой повтор вида ff некоторого слова f, а в другой строке это ff выравнивается на f— или —f, где "—" означает делецию всех букв в f; при этом для образца и каждой последовательности выполняется: ff выравнивается на один из четырех типов участков ff, f—, —f или —. На рис. 1 приведено иллюстративное выравнивание с повтором слова длины 4 п.н., оно является частью выравнивания на рис. 2. На рис. 2 приведен пример неточного повтора, который произошел у Keteleeria davidiana в результате, вероятно, сначала вставки точного повтора слова длины 11 п.н., а затем замены в одной из его позиций.

Объекты и методы. В части пластид нами проведен широкомасштабный поиск вставок прямых по-

второв в следующих семействах, которые охватывают почти все семейства семенных растений, включающих хотя бы два вида с полностью секвенирован-ным пластомом. После названия вида указан номер пластома в базе GenBank. Acoraceae: Acorus calamus (NC_007407), Acorus americanus (NC_010093). Astera-ceae: Lactuca sativa (NC_007578), Helianthus annuus (NC_007977), Guizotia abyssinica (NC_010601), Part-henium argentatum (NC_013553). Brassicaceae: Arabi-dopsis thaliana (NC_000932), Aethionema cordifolium (NC_009265), Aethionema grandiflorum (NC_009266), Olimarabidopsis pumila (NC_009267), Arabis hirsuta (NC_009268), Barbarea verna (NC_009269), Capsella bursa-pastoris (NC_009270), Crucihimalaya wallichii (NC_009271), Draba nemorosa (NC_009272), Lepidium virginicum (NC_009273), Lobularia maritima (NC_009274), Nasturtium officinale (NC_009275). Convolvulaceae: Cuscuta gronovii (NC_009765), Cuscuta reflexa (NC_009766), Cuscuta obtusiflora (NC_009949), Cuscuta exaltata (NC_009963), Ipomoea purpurea (nC_009808). Faba-ceae: Lotus japonicus (NC_002694), Medicago truncatu-la (NC_003119), Glycine max (NC_007942), Phaseolus vulgaris (NC_009259), Cicer arietinum (NC_011163), Trifolium subterraneum (NC_011828), Vigna radiata

Ca T T AGT T AGAT T T T GT T AT T С GAAC CAAT T T T ATAAAT T---------------------------ACATCTCTTTCA

С d T T AG T T AGAT TCCGTTACTC GAAC С GAT T С T AT TAAT T----------------------CAAT С AC AT С TAT T T С A

Kd Т Т AGT TAT AT Т С CAT TACT С GAAC С GATTCTATTCATTTTCTATTCATTTTCTATTAATTCAAT CAT AT CT AT T T CA

P s T T AGT T AGAT TCCGTTACTC GAAC С GAT T CT AT CAAT T---------------------------ACAT С TAT T T CA

P с T T AGT T AGAT TCCGTTACTC GAAC CAAT T CT AT CAAT G-----------------------ACAT AGAT С TAT T T CA

P g T T AGT T AGAT TCCGTTACTC GAAC С GAT T С CAT AGAT A-----------------------AAAT ACAT С TAT T T CA

P k r T T AGT T AGAT TCCGTTACTC GAAC С GAT T С CAT AGAT A-----------------------AAAT ACAT CT AT T T CA

P k T T AGT T AGAT TCCGTTACTC GAAC С GAT T С CAT AGAT A-----------------------AAAT ACAT CT AT T T CA

P t T T AGT T AGAT TCCGTTACTC GAAC CAAT T С T AT CAAT G-----------------------ACAT AC AT С TAT T T С A

Cj T С AGAT T GAT С С TAT T GAT G GAAT T - AC T С CAT G GAT T---------------------------CAATCCATTTTT

Ca TGACTCTTTCAAG----АТТСАТТСАТСТСТ----------------------ATGAGAT С AAAT T С GAG С TAT T T T

Cd TGAATCTTGAAAG--------АТТСАТСТСТ----------------------ATGAGAT С AAAT С T С GAG С T AT T T

Kd TGGATCTTGAAAG--------АТТСАТСТСТ----------------------AT GAGAT AAAAT С T С GAG С TAT T T

Ps TGGATCTTGAAAG----АТТСАТТСАТСТСТ----------------------ATGAAATTAAATCTCGAGCTATTT

Pc TGGATCTTGAAAGAAAGATTCATTCATCTCTATGAGATCAAAATGAGATCAAAATGAGATCAAATCTCGAGCTATTT

Pg TGGATCTTGAAAG----АТТСАТТСАТСТСТ----------------------AT GAGAT AAAAT С T С GAG С TAT T T

P k r T GGAT CT T GAAAG----ATTCATTCAT CTCT----------------------AT GAGAT AAAAT CT С GAG С TAT TT

Pk TGGATCTTGAAAG----АТТСАТТСАТСТСТ----------------------AT GAGAT AAAAT С T С GAG С TAT T T

Pt T GGAT CT T GAAAGAAAGATT CATTCAT CT CTAT GAGAT СAAAATGAGAT CAAAATGAGATCAAAT CT СGAGСTATTT С j TTTGAC-------AAAAAAAT GAGAT ACT CT----------------------ATGAGATCAAAT CT С GAGTTATTG

С a T - GAAC GAAGTAAAAAT AAG GAGAT С

Cd T AGAAC GAAGTAAAAAT AAG GAGAT С

Kd T-AAACGAAGTAAAAATCAGGGGATС

Ps T T TAAC GAAGTAAAGAT CAG GAGAT С

P с T T GAACAAAGTTAAAATAAGGAGAT С

Pg T GGAACAAAGT GAAAAT CAG GAGAT С PkrT GGAACAAAGT GAAAAT CAGGAGAT С

Pk T GGAACAAAGT GAAAAT CAG GAGAT С

Pt TTGAACAAAGTTAAAATAAGGAGATС

Cj T----AAAAC GAAG G GAAAAT CAAT С

Рис. 2. Множественное выравнивание участков 5'-лидерных областей гена psbM, в которых возникли троекратные прямые повторы слов длиной 11 п.н. и двукратные повторы слов длиной 4 п.н. Подчеркнуты повторы, а в случае K. davidiana подчеркнуто и продолжение повтора, которое отличается от повторяемого слова в одной позиции, — выделено серым цветом. Полужирным выделены повторяемые слова <р. Обозначения видов: Ca — C. argyrophylla, Cd — C. deodara, Kd — K. davidiana, Ps — P. sitchensis, Pc — P. contorta, Pg — P. gerar-diana, Pkr — P. krempfii, Pk — P. koraiensis, Pt — P. thunbergii, Cj — C.japonica

(NC_013843), Pisum sativum (NC_014057), Lathyrus sativus (NC_014063). Geraniaceae: Pelargonium x hor-torum (NC_008454), Erodium texanum (NC_014569), Géranium palmatum (NC_014573), Monsonia speciosa (NC_014582). Mahaceae: Gossypium hirsutum (NC_007944), Gossypium barbadense (NC_008641). Myrtaceae: Eucalyptus globulus (NC_008115), Eucalyptus grandis (NC_014570). Nymphaeaceae: Nymphaea alba (NC_006050), Nuphar advena (NC_008788). Oleaceae: Jasminum nudiflorum (NC_008407), Olea europaea (NC_013707). Onagraceae: Oenothera elata (NC_002693), O. argillicola (NC_010358), O. glazioviana (NC_010360), O. biennis (NC_010361), O. parviflora (NC_010362). Pinaceae: Pinus thunbergii (NC_001631), Pinus koraiensis (NC_004677), Picea sit-chensis (NC_011152), Pinus contorta (NC_011153), Pinus gerardiana (NC_011154), Pinus krempfii (NC_011155), Keteleeria davidiana (NC_011930), Cedrus deodara (NC_014575), Cathaya argyrophylla (NC_014589). Poa-ceae (BEP): Oryza sativa Japónica Group (NC_001320), Triticum aestivum (NC_002762), O. nivara (NC_005973), O. sativa Indica Group (NC_008155), Hordeum vulgare (NC_008590), Agrostis stolonifera (NC_008591), Lolium perenne (NC_009950), Brachypodium distachyon (NC_011032), Festuca arundinacea (NC_011713), Bambusa oldhamii (NC_012927), Dendrocalamus latiflorus (NC_013088). Poaceae (PACCAD): Zea mays (NC_001666), Saccha-rum hybrid SP80-3280 (NC_005878), Saccharum offi-cinarum (NC_006084), Sorghum bicolor (NC_008602), Coix lacryma-jobi (NC_013273). Ranunculaceae: Ranunculus macranthus (NC_008796), Megaleranthis saniculi-folia (NC_012615). Saliceae: Populus alba (NC_008235), Populus trichocarpa (NC_009143). Solanaceae: Nicotiana tabacum (NC_001879), Atropa belladonna (NC_004561), Nicotiana sylvestris (NC_007500), Nicotiana tomentosifor-mis (NC_007602), Solanum lycopersicum (NC_007898), Solanum bulbocastanum (NC_007943), Solanum tubero-sum (NC_008096). Также рассмотрен пластом Crypto-meria japonica (NC_010548) из семейства Cupressaceae, который относительно плохо выравнивается с плас-томами других видов и на рис. 2 играет роль внешней группы.

В части митохондрий вместо семейства Brassica-ceae рассмотрены порядки Brassicales: Brassica napus (NC_008285), Arabidopsis thaliana (NC_001284), Carica papaya (NC_012116); Caryophyllales: Beta vulgaris subsp. vulgaris (NC_002511), Beta vulgaris subsp. maritima (NC_015099). A также рассмотрены митохондрии видов семейства Poaceae: Triticum aestivum (NC_007579), Sorghum bicolor (NC_008360), Oryza sativa Indica Group (NC_007886), Oryza sativa Japonica Group (NC_011033), Oryza rufipogon (NC_013816), Zea mays subsp. mays (NC_007982), Zea perennis (NC_008331), Zea mays subsp. parviglumis (NC_008332), Zea luxurians (NC_008333), Tripsacum dactyloides (NC_008362).

Для решения указанной задачи нами использовалась следующая база данных, представляющая и самостоятельный интерес. База содержит результаты кластеризации (разбиения на семейства родственных

по последовательности) пластидных белков из трех обширных групп: родофитной и хлорофитной ветвей и однодольных растений. Для ее построения разработан оригинальный алгоритм кластеризации.

Непосредственно вставки прямых повторов искались следующим образом. Для каждой пары видов искались пары позиционно сцепленных генов или экзонов из близких видов, при этом очень короткие неконсервативные гены игнорировались. Затем собранные вместе некодирующие области между такими генами или экзонами из всех видов одного семейства выравнивались, на выравнивании определялись вставки прямых повтором. Для этого использовались программы [12—14].

Результаты. Получена база данных, отражающая кластеризацию белков, кодируемых в пластидах указанных групп растений [15]. Поиск кластеров по филогенетическому профилю белка на ее основе доступен по адресу http://lab6.iitp.ru/ppc/. Там же расположено описание упомянутого алгоритма и инструкции по его применению. Коротко напомним смысл параметров алгоритма. Параметр H — верхний порог сходства белков из разных кластеров (белки со сходством выше Hне разделяются). Параметр L — нижний порог сходства (белки со сходством ниже L считаются не обладающими сходством). Параметрp — верхний порог размера кластера относительно числа видов N (кластеры с числом белков больше p х N всегда разделяются, если в них есть ребро с весом ниже H). Приведем результаты для однодольных растений, для которых наилучших результатов удалось достичь при значениях параметров: p = 2, L = 0, H = 0,41. Полученные при этих значениях кластеры были исправлены вручную: в кластер PetG добавлены белки YP_654227.1 из Oryza sativa Indica Group и YP_358627.1 из Phala-enopsis aphrodite; в кластер RpL23 добавлены белки YP_874745.1 из Agrostis stolonifera и YP_899416.1 из Sorghum bicolor; в кластер RpL2 добавлены парало-ги YP_654244.1 и YP_654261.1 из Oryza sativa Indica Group. Так образовано 105 неодноэлементных кластеров и 20 одноэлементных. Из неодноэлементных кластеров 71 содержит не более одного белка из одного вида, 30 содержат пары белков из одного вида, 2 содержат по три белка из одного вида и 2 содержат по 4 белка из одного вида. В 29 (неодноэлементных) кластерах представлены от одного до 12 видов; нет кластеров, в которых представлены от 13 до 30 видов; в 76 кластерах представлены от 31 до 36 видов (границы диапазонов везде включены). Максимум распределения — 30 кластеров с 35 видами.

В результате получены следующие распределения числа вставок прямых повторов в зависимости от длины слова р в семействах цветковых; после двоеточия используется запись "длина слова р: число найденных вставок с этой длиной". В семействе Acoraceae: 1: 9. В семействе Asteraceae: 1: 153, 2: 10, 3: 5, 4: 9, 5: 27, 6: 31, 7: 9, 8: 4, 9: 1, 10: 5, 11: 1, 12: 2, 13: 1, 17: 2, 18: 2, 21: 2,22: 3,23: 1. В семействе Brassicaceae: 1:1373, 2: 82, 3: 26, 4: 31, 5: 66, 6: 57, 7: 32, 8: 16, 9: 5, 10: 3, 11: 3,

Рис. 3. Число всех найденных вставок прямых повторов в зависимости от длины повторяемого слова, результаты показаны для длин от 2 до 24 п.н. Черные столбики показывают числа вставок прямых повторов в пластидах, серые в митохондриях

12:1, 13: 6, 15: 1, 16: 1, 17: 2, 20: 3, 22:1, 23:1. В семействе Fabaceae: 1: 783, 2: 84, 3: 41, 4: 91, 5: 71, 6: 25, 7: 10, 8: 3, 10: 1, 12: 2, 13: 1, 14: 1, 16: 2. В семействе Gera-niaceae: 1: 186, 2: 14, 3: 6, 4: 25, 5: 34, 6: 21, 7: 9, 8: 2, 9: 1. В семействе Convolvulaceae: 1: 168, 2: 8, 3: 4, 4: 6, 5: 4, 6: 7, 7: 3, 8: 2, 15: 1, 18: 1, 19: 1. В семействе Malvaceae: 1: 45, 2: 1, 4: 2, 5: 8, 6: 4, 7: 2, 8: 2, 51: 1. В семействе Myrtaceae: 1: 34, 6: 1, 18: 1, 19: 1. В семействе Nymphaeaceae: 1: 58, 2: 8, 3: 3, 4: 22, 5: 32, 6: 8, 7: 5, 9: 2, 11: 1, 14: 2, 24: 1. В семействе Oleaceae: 1: 46, 2: 4, 3: 3, 4: 5, 5: 6, 6: 3, 7: 1, 8: 2, 11: 1, 12: 1, 14: 1, 17: 1. В семействе Onagraceae: 1: 114, 2: 6, 3: 1, 4: 5, 5: 14, 6: 10, 7: 4, 9: 1, 11: 1, 12: 3, 13: 2, 15: 2, 16: 2, 17: 1, 19: 1, 20: 1, 21: 2, 22: 2, 23: 2, 24: 2, 26: 1, 29: 1, 35: 1, 50: 1, 78: 1. В семействе Pinaceae: 1: 378, 2: 41, 3: 38, 4:104, 5:99, 6:23, 7:6, 8:4, 9:4, 10:2, 11:3, 12:3, 13: 2, 16: 1. В кладе BEP семейства Poaceae: 1: 695, 2: 22, 3: 9, 4: 47, 5: 108, 6: 52, 7: 15, 8: 6, 9: 6, 10: 1, 11: 1, 13: 2, 14: 2, 15: 1, 16: 1, 18: 1, 19: 1, 21: 2, 24: 1, 27: 1. В кладе PACCAD семейства Poaceae: 1: 202, 2: 7, 3: 4, 4: 11, 5: 30, 6: 7, 7: 5, 8: 2, 9: 2, 14: 3, 16: 3, 17: 3, 18:3, 19: 1, 20: 1, 26: 1. В семействе Ranunculaceae: 1: 111, 2: 13, 3: 3, 4: 12, 5: 22, 6: 7, 7: 5. В семействе Saliceae: 1: 49, 2: 2, 4:1, 6: 4, 7: 6, 8: 1, 9: 1, 10: 1, 11: 4, 13: 2, 14: 4, 16: 1, 17: 1, 18: 1, 20: 1. В семействе Sola-naceae: 1: 238, 2: 18, 3: 2, 4: 19, 5: 15, 6: 13, 7: 14, 8: 10, 9: 7, 10: 3, 11: 3, 12: 1, 13: 5, 14: 4, 15: 1, 16: 4, 17: 3, 18: 3, 19: 1, 20: 1, 24: 1, 30: 1.

Прямые повторы слов с наибольшей длиной найдены в семействе Onagraceae: 50 п.н. между генами petA и psbJ и 78 п.н. между генами atpH и atpI. В семействе Malvaceae найден повтор слова длиной 51 п.н. между генами petN и psbM. Преобладают вставки слова из одного нуклеотида, их найдено 4642. Среди вставок прямых повторов слов большей длины наиболее

часто встречаются слова длины 5 п.н., что видно из рис. 3. Вставки повторов слов длиной более 24 п.н. наблюдаются очень редко. Это — две вставки при длине слова 26 и по одной вставке при длинах слов 27, 29, 30, 35, 50, 51, 78. При поиске вставок отсутствовало какое-либо ограничение на длину повтора.

Рассмотрим пример вставок прямых повторов в 5'-лидерных областях гена psbM в семействе Pinaceae, рис. 2. Здесь имеются троекратные повторы слова длиной 11 п.н. у K. davidiana и P. thunbergii, которые расположены в разных местах относительно инициирующего кодона psbM и различны по нукле-отидному составу, что указывает на их независимое возникновение в эволюции. У C. argyrophylla, C. deo-dara, P. sitchensis, P. gerardiana, P. krempfii, P. korai-ensis перед этим геном отсутствуют повторы слов длины 11 п.н., у P. contorta и P. thunbergii имеется повтор слова ATGAGATCAAA, который отсутствует у остальных видов. У K. davidiana имеется повтор слова TTCTATTCATT с одним отличием в третьей копии, который отсутствует у двух видов сосен и расположен дальше от начала гена. Также в этой области наблюдаются вставки прямых повторов слова AAAG у P. contorta и P. thunbergii и слова ATTC у C. argyrophylla, P. sitchensis и Pinus spp. Можно думать, что 5'-лидерная область гена psbM удобна для возникновения повторов участков независимо от их нуклео-тидного состава. У близкого вида C. japonica, не входящего в семейство Pinaceae, повторы перед psbM отсутствуют, что подтверждает возникновение, а не потерю повторов в этом семействе. Отметим, что области, расположенные по соседству от этих повторов, также обладают заметной консервативностью.

При исследовании митохондрий получены следующие распределения числа вставок прямых повторов

в зависимости от длины слова <р. В порядке Вга88ь са1ев: 1: 159, 2: 20, 3: 7, 4: 12, 5: 16, 6: 5; в семействе Роасеае: 1: 164, 2: 12, 3: 6, 4: 71, 5: 181, 6: 31, 7: 3, 9: 1, 12: 1. Так же как и в пластидах, абсолютный максимум числа вставок прямых повторов приходится на длину 1 повторяемого слова, а локальный максимум — на длину 5.

Обсуждение и выводы. Нами анализировались пластомы и митохондрии близких видов с целью расширить и уточнить представления об эволюции не-кодирующих участков ДНК. Полученные результаты показывают, что вставки (точных) прямых повторов являются частыми элементарными событиями в микроэволюции относительно коротких некодирующих участков ДНК пластид и митохондрий. Повторяемое слово обычно имеет длину пять. Распределение длин этих слов в пластомах и митохондриях сходно (рис. 3).

Неточный повтор у Ке1е1еет1а йауШапа, по-видимому, возник в результате вставки (точного) прямого повтора слова длины 11 с последующей однонуклео-тидной мутацией (рис. 2). Предполагается, что мгновенное появление вставок (точных) прямых повторов является результатом ошибок репликации, ведущих к дупликации некодирующих участков ДНК.

Полученные результаты доложены на конференции [16] (при участии О. Зверкова). Часть полученных

результатов была представлена в [17].

* * *

Работа выполнена при частичной поддержке Министерства образования и науки РФ (14.740.11.1053, 8858, 8481, 8091, 8823).

СПИСОК ЛИТЕРАТУРЫ

1. Kurtz S, Choudhuri J.V., Ohlebusch E, Schleiermacher C., Stoye J, Giegerich R. REPuter: the manifold applications of repeat analysis on a genomic scale // Nuc. Acids Res. 2001. Vol. 29. P. 4633—4642.

2. Yang M., Zhang X. et al. The complete chloroplast genome sequence of date palm (Phoenix dactylifera L.) // PLoS ONE. 2010. Vol. 5. 9. e12762.

3. Greiner S., Wang X., Rauwolf U., Silber M.V., Mayer K., Meurer J., Haberer G., Herrmann R.G. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution // Nuc. Acids Res. 2008. Vol. 36. N 7. P. 2366—2378.

4. Ogihara Y., Terachi T., Sasakuma T. Intramolecular recombination of chloroplast genome mediated by short direct-repeat sequences in wheat species // Proc. Natl. Acad. Sci. USA. 1988. Vol. 85. N 22.P. 8573—8577.

5. Cai Z, Guisinger M., Kim H.G., Ruck E., Blazier J.C., McMurtry V., Kuehl J.V., Boore J., Jansen R.K. Extensive reorganization of the plastid genome of Trifolium subterraneum (Fabaceae) is associated with numerous repeated sequences and novel DNA insertions // J. Mol. Evol. 2008. Vol. 67. N 6. P. 696—704.

6. Timme R.E., Kuehl J.V., Boore J.L., Jansen R.K. A comparative analysis of the Lactuca and Helianthus (Astera-ceae) plastid genomes: identification of divergent regions and categorization of shared repeats // Amer. J. Bot. 2007. Vol. 94. N 3. P. 302—312.

7. Moore M.J., Hassan N., Gitzendanner M.A., Bru-enn R.A., Croley M., Vandeventer A., Horn J.W., Dhingra A., Brockington S.F., Latvis M., Ramdial J., Alexandre R., Pied-rahita A., Xi Z., Davis C.C., Soltis P.S., Soltis D.E. Phyloge-netic analysis of the plastid inverted repeat for 244 species: insights into deeper-level angiosperm relationships from a long, slowly evolving sequence region // Intern. J. Plant Sci. 2011. Vol. 172. N 4. P. 541—558.

8. Honma Y, Yoshida Y, Terachi T., Toriyama K, Mi-kami T., Kubo T. Polymorphic minisatellites in the mitochondrial DNAs of Oryza and Brassica // Current genetics. 2011. Vol. 57. N 4. P. 261-270.

9. Borsch T., Quandt D. Mutational dynamics and phy-logenetic utility of noncoding chloroplast DNA // Plant Syst. Evol. 2009. Vol. 282. P. 169-199.

10. Kelchner S.A. The evolution of non-coding chloroplast DNA and its application in plant systematics // Ann. Missouri Bot. Garden. 2000. Vol. 87. P. 482-498.

11. Ingvarsson P.K., Ribstein S., Taylor D.R. Molecular evolution of insertions and deletion in the chloroplast genome of Silene // Mol. Biol. Evol. 2003. Vol.20. N 11. P. 1737-1740.

12. Официальный сайт лаборатории Института проблем передачи информации им. А.А. Харкевича РАН (URL: http://lab6.iitp.ru/ru/repeats 25.08.2011).

13. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput // Nucleic Acids Res. 2004. Vol. 32. P. 1792-1797.

14. Официальный сайт лаборатории Института проблем передачи информации РАН (URL: http://lab6.iitp.ru/en/treeal/ 25.08.2011).

15. Зверков O.A., Селиверстов A.B., Любецкий В.А. Белковые семейства, специфичные для пластомов небольших таксономических групп водорослей и простейших // Молекулярная биология. 2012. Т. 46. № 5. С. 799—809.

16. Селиверстов А.В., Любецкий В.А. Прямые повторы в некодирующих областях хлоропластов у семенных растений // Тр. 52-й науч. конф. Моск. физ.-тех. ун-та. 2009. Т. 1. № 1. P. 116-117.

17. Зверков O.A., Русин Л.Ю., Селиверстов А.В., Любецкий В.А. Вставки прямых повторов в микроэволюции пластид и митохондрий семенных растений // Информационные процессы. 2012. Т. 12. № 3. С. 191-197.

Поступила в редакцию 25.08.2011

A STUDY OF DIRECT REPEATS IN MICROEVOLUTION

OF PLANT MITOCHONDRIA AND PLASTIDS BASED ON PROTEIN CLUSTERING

O.A. Zverkov, L.Y. Rusin, A.V. Seliverstov, V.A. Lyubetsky

The study focuses on insertions of perfect direct repeats of words of arbitrary length in plasto-mes and mitochondriomes. The approach is exemplified on seed plants. Plastomes of close species were analyzed to further develop and refine published evidence on the evolution of non-coding DNA. The results suggest that insertions are common elementary events in microevolution of short non-coding DNA regions. The repeated word length is usually 5, the word length distribution is similar between plastomes and mitochondriomes.

Key words: perfect direct repeat insertions, plastids, mitochondria, Spermatophyta, microevolution, protein clustering.

Сведения об авторах

Зверков Олег Анатольевич — мл. науч. сотр., Федеральное государственное бюджетное учреждение науки Институт проблем передачи информации им. А.А. Харкевича РАН. Тел.: 8-495-694-33-38; e-mail: zverkov@iitp.ru.

Русин Леонид Юрьевич — канд. биол. наук, науч. сотр. лаборатории геносистематики биологического факультета МГУ, Федеральное государственное бюджетное учреждение науки Институт проблем передачи информации им. А.А. Харкевича РАН. Тел.: 8-495-694-33-38, e-mail: rusin@iitp.ru.

Селиверстов Александр Владиславович — канд. физ.-мат. наук, ст. науч. сотр., Федеральное государственное бюджетное учреждение науки Институт проблем передачи информации им. А.А. Харкевича РАН. Тел.: 8-495-694-33-38, e-mail: slvstv@iitp.ru.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Любецкий Василий Александрович — докт. физ.-мат. наук, зав. лаб., Федеральное государственное бюджетное учреждение науки Институт проблем передачи информации им. А.А. Харкевича РАН. Тел.: 8-495-694-33-38, 8-910-464-69-17; e-mail: lyubetsk@iitp.ru

i Надоели баннеры? Вы всегда можете отключить рекламу.