CC BY
2
INVESTIGATION OF GENE EXPRESSION
OF HEAT SHOCK PROTEIN A2 IN SEMEN AND SERUM LEVELS OF IL-18 AND IL-37 IN OLIGOSPERMIC MALES WITH VARICOCELE
A.S. Abed1*, B.Q.H. Al-Saadi2
1 Ministry of Health, Anbar Health Department, Anbar, Iraq;
2 Institute of Genetic Engineering and Biotechnology for Postgraduate Studies, University of Baghdad, Baghdad, Iraq.
* Corresponding author: [email protected], [email protected]
Abstract. A varicocele is the most common rectification cause of male infertility. It is an abnormal dilation of the veins of the pampiniform plexus in the spermatic cord. It is estimated to affect 10-15% of men and adolescents. The aim of the current study was to investigate the immunological parameters, gene expression profiles, and their correlations in varicocele and non-varicocele oligospermic patients compared to healthy controls, providing insights into the molecular mechanisms underlying male infertility. A total of 120 males were involved in this study over the period from October 2023 to January 2024. Blood and semen samples were collected from patients who were diagnosed with varicocele confirmed oligospermia (40 samples) and non-varicocele oligospermic patients (40 samples), in addition to 40 apparently healthy males as control. The level of IL-18 and IL-37 was estimated in the serum of tested groups using Enzyme Linked Immunosorbent Assay (ELISA) technique. The serum levels of the pro-inflammatory cytokine IL-18 were significantly elevated in all patient groups compared with control. Interestingly, the anti-inflammatory cytokine IL-37 was also significantly increased. The gene expression of heat shock protein A2 (HSPA2) was detected using reverse transcriptase polymerase chain reaction (RT-PCR). The fold of gene expression results by RT-PCR technique revealed a significant downregulation of HSPA2 (0.3453 ± 0.311-fold) gene expression in varicocele patients and a 0.154 ± 0.13fold decrease in non-varicocele oligospermia compared with control. However, no significant correlation was found between the expression of HSPA2 and the levels of IL-18 and IL-37.
Keywords: varicocele, oligospermia, IL-18, IL-37, ELISA, HSPA2, RT-PCR.
List of Abbreviations
IL-18 - Interleukin-18 IL-37 - Interleukin-37 ELISA - enzyme-linked immunosorbent assay
HSPA2 - heat shock protein family A RT-PCR - real-time polymerase chain reaction
WHO - World Health Organization qRT-PCR - quantitative reverse transcrip-tase polymerase chain reaction Ct - cycle threshold
Introduction
A varicocele is a medical condition characterized by abnormal enlargement and twisting of the veins in the scrotum, specifically in the pampiniform plexus (Lundy & Sabanegh Jr.,
2018). While varicoceles typically exhibit a greater size and prevalence on the left side, around 50% of men with varicocele also experience bilateral varicoceles (Besiroglu et al.,
2019). The presence of a rare and separated var-
icocele on the right side typically indicates that the right internal spermatic vein connects to the right renal vein (Bowdino et al., 2023). Varicoceles are commonly found in 15% of the overall male population, 35% of men experiencing primary infertility, and up to 80% of men with secondary infertility (Alsaikhan et al., 2016). Male infertility has been recognized as an important reproductive health issue in aspect of human life (Agarwal et al., 2015). Varicocele is the common risk factor in male infertility that occurs in approximately 35% of cases (Sollender et al., 2024). The influence of varicocele on male infertility is not fully understood yet and seems to have multifactorial etiopathogenesis. Varicocele causes temperature elevation, venous stasis, hypoxia, and oxidative stress in the testes, which can induce inflammatory responses (Tadros and Sabanegh, 2019). This is characterized by increased pro-inflammatory cytokines as well as decreased anti-inflammatory cytokines. The pro-inflammatory cyto-kines promote leukocyte infiltration, disrupt the
blood-testis barrier, and impair spermatogenesis. Excess cytokines can directly damage sperm and seminiferous tubules. They also stimulate production of reactive oxygen species and nitric oxide, causing further oxidative stress and DNA damage (Zeinali et al., 2017). Molecular factors that regulate cytokine production are being investigated for their involvement in varicocele pathogenesis. Heat shock proteins (HSPs) act as cytokine regulators (Guisasola et al., 2018). HSPAs are considered as intracellular proteins, family comprises 12 highly conserved molecular chaperone proteins of 70-kDa molecular weight, one of stress-non-inducible members of the HSPA family, was originally considered as testis-specific (Radons, 2016). Impaired HSP expression from the HSP70 family in spermatogenic cells responds to various stressors, including increased scrotal temperature due to varicocele (Nixon et al., 2015). HSPA2, a gene located on chromosome 14q23.3, was found in varicocele; a decreased expression of HSPA2 in sperm cells and testicular tissue was detected. HSPA2 suppresses NF-kB signaling which induces pro-inflammatory cytokines (Kumar et al., 2022). There are many studies about Heat Shook Protein A2 (Kadhum & Abdul-Hassan et al, 2022; Jassem et al, 2014; Al-Qazzaz et al, 2022; Khadhim et al., 2017; Jail et al, 2023). Therefore, reduced HSPA2 removes this suppression, allowing cytokine overproduction and chronic inflammation in varicocele (Santana et al., 2017). In addition, the damaged spermatozoa membrane is recognized by the immune system as a foreign antigen, leading to an increased amount of anti-sperm antibody (ASA) and causing an autoimmune reaction that attacks the normal spermatozoa (Ameer Ali Imarah, 2021). Based on what was mentioned above, the study aimed to investigate the association of HSPA2 gene expression, assessing the level of some immu-nological markers IL-37 and IL-18 in some oli-gospermic varicocele Iraqi patients.
Materials and Methods
Study subjects
The study was conducted on 120 male subjects over the period from October 2023 to Jan-
uary 2024. Blood and semen samples were collected from patients who were diagnosed with varicocele confirmed oligospermia (40 samples) and non-varicocele oligospermia (40 samples). Specimens were obtained from patients attending the High Institute for Infertility Diagnosis and Assisted Reproductive Technologies
- Al-Nahrain University/Baghdad and Al-Kad-himiya Teaching Hospital/Baghdad. All participants were informed about the purpose of the study and consent letters were received and the study adhered to the standards of the latest revision of the Declaration of Helsinki. The ethical permission to conduct the research was obtained from these hospitals and from the Ethical Committee of the Institute of Genetic Engineering and Biotechnology for Postgraduate Studies
- Baghdad University. Forty (40) patients diagnosed with varicocele confirmed oligospermia. The patients were diagnosed by hospital physicians using Doppler ultrasonography and seminal analysis. The median age was 30.0. Twenty-five patients were within the age range of 20-35 representing 63%. While 15 patients (37%) were within the range of 36-50. Forty (40) individuals with non-varicocele but oligospermic. The patients were diagnosed with oligospermia using seminal fluid analysis. The median age was 30.5 and the percentage of patients within the 20-35 age range was 73% (29 patients) and 27% (11 patients) within the age range of 3650. Finally, 40 apparently healthy individuals were served as a control with no history of infertility or oligospermia and without any abnormal sperms (confirmed by seminal analysis) with a median age of 34.0 and age range between 20-50 years old (whose have at least one child).
Sample collection
Two types of body fluids were collected from all study participants, blood samples using a disposable syringe and seminal ejaculates. Each participant had 3 mL of venous blood drawn, which were added into gel tubes for the ELISA tests to measure the level of cytokines. After the gel tubes were centrifuged for 10 min at 3000 rpm to separate the serum, they were divided into aliquots and kept at -20 °C. The
seminal ejaculates were collected into a sterile cup following voluntary self-masturbation and processed within 2 hours after collection. The semen sample was centrifuged at 3000 rpm for 10 min and the pellet was suspended in ready-to-use phosphate buffer saline, then an aliquot of 250 |iL of the cell suspension (5 x 106 cells) was mixed with 750 |iL of Trizol reagent in an Eppendorf tube for the detection of HSPA2 expression level in sperms.
Seminal fluid analysis The analysis of semen samples was conducted according to the Semen Analysis Criteria of WHO (2010) using an automated semen analyzer. Parameters including sample volume, sperm concentration, total sperm count, progressive and non-progressive motile and immotile sperms were detected (Boitrelle et al., 2021).
IL-18, IL-37 and ASA quantification The levels of IL-18 and IL-37 in serum were measured quantitatively in patient and control groups. This was done using a sandwich ELISA method, following the step-by-step instructions provided by the manufacturer, using commercially available ELISA kits (Sunlong Medical, China).
Detection of HSPA2 gene expression The expression of HSPA2 was investigated in the semen samples of patients with varicocele as well as healthy controls. RNA was extracted using TRIzol™ Plus RNA Purification Kit (Thermo Fisher, USA) following the manufacturer protocol.
HSPA2 gene expression using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)
After sub-culturing A549 cells and treating them with PO-EE at a concentration of 200 mg/mL for 24 hours, total cellular RNA was extracted using the TRIzol Plus kit, following the procedure provided by the manufacturer. Total RNA samples (0.5 |g - 5 |g) were converted into complementary DNA (cDNA) using EcoDry™ Premix kit (Takara, Japan) based on company instructions. The cDNA obtained was utilized to analyze the expression of HSPA2 gene (Forward: 5'ACTTTCGACGTGTCCATCCT'3, Revers: 5 ' CCCAATGTCCTTCTTGTGCT'3), in the qRT-PCR (Labtron, UK) using the reverse transcription kit (QuantiNova-USA). The expression levels were normalized using B2M as a housekeeping gene (Forward: 5' TGGGTTTCATCCATCCGACA'3, Revers: 5' ACGGCAGGCATACTCATCTT'3). The reaction cycles were carried out as shown in Table (1). The variations in fold expression across groups were then computed using the 2-AAct method. However, the PCR well applied in many medicine subjects due to accurate results in short time, there are many authors applied this technique in their researches such as (Bassi & Al-Rubaii, 2024; Bresam et al., 2023; Ismael et al., 2023; Abdulrazaq et al, 2022; Ali et al, 2021; Ahmed et al, 2022; Ali et al, 2021; Jawad et al, 2023; Al-Saadi et al, 2023; Saleh et al, 2020; Mohsin & AL-Rubaii, 2023; Jalil et al, 2023; Sa-bah et al, 2022; Salih et al, 2018; Al-Jumaily et al, 2023; Sultan et al, 2023; Husain & Alrubaii, 2023; Al-saidi et al, 2022; Muhsin et al., 2022).
Table 1
Amplification program of qRT-PCR for target genes and housekeeping gene
Step Temp. Time Circle
Initial denaturation 95 °C 12 min. 1
Denaturation 95 °C 15 sec.
Annealing 62 °C 20 sec. 40 cycles
Elongation (extension) 72 °C 20 sec.
Statistical analysis
The statistical analysis was performed with GraphPad Prism version 9.2 (GraphPad Software Inc., LaJolla, CA). The student's t-test was applied to calculate the significance of the group variance. The Pearson correlation coefficient (r value) was used to verify the correlation. The data was expressed as the mean ± SD, and statistical significance was represented by * p < 0.05 and ** p < 0.01.
Results
Detection of serum level of IL-18 and IL-37
The serum levels of IL 18 and IL 37 among varicocele and non-varicocele oligospermic patients were detected in comparison with the control group. According to the statistical analysis, the mean level of IL-18 was significantly (p = 0.0171) elevated in varicocele (5933 ± ± 1217 pg/mL) and non-varicocele oligosper-mic (5946 ± 692.2 pg/mL) patients compared to control group (5223 ± 1286 pg/mL). Noteworthy that no significant variation was observed between varicocele and non-varicocele oligo-spermic patients with respect to IL-18 serum level (Fig. 1A). The serum level of IL-37 was significantly (p < 0.0001) increased in varicocele patients compared with control (18961 ± ± 4946 vs. 11929 ± 5235 pg/mL). The level of
IL-37 was significantly (p < 0.0001) highly increased in non-varicocele oligospermic patients compared with control (24711 ± 7910 vs. 11929 ± 5235 pg/mL). Interestingly, the level of IL-37 in oligospermic patients was significantly (p = 0.0015) higher than the level in varicocele patients (Fig. 1B).
Relative expression of H2PA gene
The concentration of RNA isolated from seminal fluid of varicocele and healthy individual was around 18.53 ng/^L. The process involves converting total RNA into complementary DNA (cDNA) to measure it using quantitative real-time PCR. This measurement is used to calculate the relative gene expression, which depends on the relationship between the Ct (Cycle threshold) value of the target gene in patients and the control group, as well as the internal housekeeping gene (B2M) (Schmittgen and Livak, 2008). The relative expression of HSPA2 gene was estimated in varicocele patients compared with healthy control. Results (Fig. 2) showed that there is a downregulation in H2PA gene expression in varicocele and non-varicocele oligospermic patients compared with apparently healthy control. The fold of change of HSPA2 gene expression in varicocele patients was 0.54 ± 0.33 and 0.154 ± 0.13 for
non-varicocele oligospermic patients significantly different (p = 0.0194 and <0.0001, respectively) from control group. Moreover, significant differences (p = 0.0047) between both groups of patients were detected.
Correlation between HSPA2 gene expression and immunological parameters
The relationship between HSPA2 gene expression and the serum level of IL-18 and IL-37 was investigated. Results showed that there was a non-significant positive correlation between HSPA2 gene expression and IL-18 level (r = 0.3002, p = 0.061). IL-37 level has no correlation with HSPA2 gene expression (r = 0.1, p = 0.6771).
Discussion
The potential role of inflammatory cytokines like IL-18 and IL-37 in the pathogenesis of varicocele was determined. The elevation of IL-18 and IL-37 in male patients diagnosed with var-icocele was previously reported compared to healthy control (Rong et al., 2023). IL-18 is a vital pro-inflammatory cytokine responsible for immune response and inflammatory processes'
modulation and progression. Increased IL-18 levels have been reported in numerous studies in a plethora of inflammatory and auto-immune disorders (Yasuda et al., 2019). In the context of varicocele, high IL-18 level is found to be responsible for the elevation of pro-oxidative tendencies, the disruption of spermatogenesis, and the diminished quality of sperm (Melnyk et al., 2022). Particularly, vastly increased levels of serum IL-18 in patients with diseased varico-cele associated the abnormal dilation and tortuosity of the pampiniform plexus vein. Thus, findings are proof that IL-18 is present, and its concentrations might hint at the inflammatory process within the specific foci of oxidative damage provoked by venous stasis and hypoxia (Zeinali et al., 2017). Similarly, non-varicocele oligospermic patients have also been found to have elevated serum IL-18 levels compared to normospermic individuals. The exact mechanisms underlying the increased IL-18 levels in these patients are not fully understood, but it is speculated that inflammatory processes, oxida-tive stress, and impaired spermatogenesis may contribute to the dysregulation of IL-18 production (Melnyk et al., 2022). On the other hand,
IL-37 is an anti-inflammatory cytokine that acts as a natural suppressor of innate and adaptive immune responses (Cavalli et al., 2021). While its exact role in male infertility is still under investigation, increased levels of IL-37 have been reported in both varicocele and non-varicocele oligospermic patients. The elevated levels of IL-37 in these patients are thought to be a compensatory mechanism in response to the pro-inflammatory state induced by increased IL-18 levels and other inflammatory factors (Poli et al., 2022). IL-37 may act to counterbalance the detrimental effects of excessive inflammation on spermatogenesis and sperm function. The imbalance between pro-inflammatory and anti-inflammatory cytokines, such as IL-18 and IL-37, is believed to play a crucial role in the pathogenesis of male infertility. This imbalance can lead to oxidative stress, impaired spermatogen-esis, sperm dysfunction, and potentially contribute to the development of varicocele and oligospermia (Rehman et al., 2020). HSPA2 plays a critical role in spermatogenesis and male fertility by facilitating protein folding, transport, and protecting seminal fluid from stress-induced damage within the testis. Various researchers have reported the downregulated HSPA2 expression level in testicular tissues of varicocele patients compared with healthy fertile males (Scieglinska and Krawczyk, 2015). The downregulation of HSPA2 was associated with the disturbing of spermatogenesis in vari-cocele patients which leads to producing less sperm called oligospermia. Proteins that were developing seminal fluid and helping in maturing sperm required appropriate folding and proper protection of the protein, due to the downregulation of the gene expression of HSPA2 leading to disturbing in the above processes. USA-based study used proteomic proteins collected from varicocele patients which
indicated decreased gene expression of HSPA2. It was observed that the expression of HSPA2 was regulated by the two transcription factors namely, YB-1 and YY1, and both are closely associated with sperm-zona binding and fertilization, and their amount was largely affected due to HSPA2 expression (Panner Selvam et al., 2021). In the in vivo study; treatment was provided to Wistar rats induced with varicocele and results were noticed which indicate that the treatment regime improves the sperm parameters and testis physiology and expression of the level of HSPA2 was also increased (Razeghinia et al., 2022).
While varicocele is associated with decreased HSPA2 expression in testicular tissues and altered levels of IL-18 and IL-37, the mechanisms underlying these changes appear to be independent of each other. The downregulation of HSPA2 is thought to be influenced by factors such as oxidative stress, hypoxia, and hormonal imbalances, rather than directly related to the inflammatory cytokine levels. Similarly, the increased levels of IL-18 and IL-37 in varicocele patients are likely related to the inflammatory processes and the body's attempt to regulate the inflammatory response, respectively, but do not seem to directly impact or correlate with HSPA2 expression (Fang et al., 2021).
Conclusions
In conclusion, serum levels of IL-18 and IL-37 in varicocele and non-varicocele oligo-spermic patients were significantly higher than in the control. The HSPA2 gene expression was significantly downregulated in all patient groups. No significant association was established between the expression of HSPA2 genes and IL-18 and IL-37, suggesting a molecular disease network targeted by different regulatory elements.
References
ABDULRAZAQ R.A., MAHMOOD W.S., ALWAN B., SALEH, T.H., HASHIM ST. & AL-RUBAII B.A.L. (2022): Biological study of protease produced by clinical isolates of Staphylococcus aureus. Research Journal of Pharmacy and Technology 15(12): 5415-5420. AGARWAL A., MULGUND A., HAMAD A. & CHYATTE M R. (2015): A unique view on male infertility around the globe. Reproductive Biology and Endocrinology 13, 37.
AHMED A.A., KHALEED K.J., FADHEL A.A. & Al-RUBAII BAL. (2022): Chronic Myeloid Leukemia: A retrospective study of clinical and pathological features. Bionatura 7(3), 41.
ALI M.A. & Al-RUBAII B.A. (2021): Study of the Effects of Audible Sounds and Magnetic Fields on Staphylococcus aureus Methicillin Resistance and mecA Gene Expression. Tropical Journal of Natural Product Research 5(5), 825-830.
ALI S.M., LAFTAH B.A., Al-SHAMMARY A.M. & SALIH H.S. (2021): Study the role of bacterial neuraminidase against adenocarcinoma cells in vivo. In: AIP Conference Proceedings 2372(1). AIP Publishing, 030009. https://doi.org/10.106375.0067193.
AL-JUMAILY R.M.K, AL-SHEAKLI I.I, MUHAMMED H.J. & AL-RUBAII B A L (2023): Gene expression of Interleukin-10 and Foxp3 as critical biomarkers in rheumatoid arthritis patients. Biomedicine (India) 43(4), 1183-1187.
AL-QAZZAZ H.K. & AL-AWADI S.J. (2020): LINE-1 Gene Expression Profile in some Iraqi Patients with Oligozoospermia. Iraqi Journal of Biotechnology 19(2).
AL-SAADI H.K., AWAD H.A., SALTAN Z.S., HASOON B.A., ABDULWAHAB A.L., AL-AZAWI K.F. & AL-RUBAII B.A.L (2023): Antioxidant and Antibacterial Activities of Allium sativum Ethanol Extract and Silver Nanoparticles. Tropical Journal Natural Product Research 7(6), 3105-3110.
Al-SAIDI M., Al-BANA R.J.A., HASSAN E. & Al-RUBAII B.A.L. (2022): Extraction and characterization of nickel oxide nanoparticles from Hibiscus plant using green technology and study of its antibacterial activity. Biomedicine 42(6), 1290-1295.
ALSAIKHAN B., ALRABEEAH K., DELOUYA G. & ZINI A. (2016): Epidemiology of varicocele. Asian journal of andrology 18, 179.
AMEER ALI IMARAH W.A. (2021): Relationship Between Spermatid Specific Thioredoxin-3 Protein and Antisperm Antibody in Patients with Varicocele Compared with a Control Group. Indian Journal of Forensic Medicine Toxicology Reports 15, 821-825.
BASSI A.G.H. & Al-RUBAII B.A.L. (2024): Detection of Pyocin S and the Effects of Lactobacillus Acidophilus Cell-Free Supernatants on Multi-Drug Resistant Pseudomonas Aeruginosa Isolated from Patients of Baghdad Hospitals. Journal of Communicable Diseases, 56(1), 135-144.
BESIROGLU H., OTUNCTEMUR A., DURSUN M. & OZBEK E. (2019): The prevalence and severity of varicocele in adult population over the age of forty years old: a cross-sectional study. The Aging Male 22, 207-213.
BOITRELLE F., SHAH R., SALEH R., HENKEL R., KANDIL H., CHUNG E., VOGIATZI P., ZINI A., ARAFA M. & AGARWAL A. (2021): The Sixth Edition of the WHO Manual for Human Semen Analysis: A Critical Review and SWOT Analysis. Life (Basel) 11, 1368.
BOWDINO C.S., OWENS J. & SHAW P.M. (2023): Anatomy, Abdomen and Pelvis, Renal Veins. StatPearls Publishing, Treasure Island (FL).
BRESAM S., ALHUMAIRI R.M.A.U., HADE I.M. & AL-RUBAII B.A.L. (2023): Genetic mutation rs972283 ofthe KLF14 gene and the incidence of gastric cancer. Biomedicine (India) 43(4), 1256-1260.
CAVALLI G., TENGESDAL I.W., GRESNIGT M., NEMKOV T., ARTS R.J.W., DOMÍNGUEZ-ANDRÉS J., MOLTENI R., STEFANONI D., CANTONI E., CASSINA L., GIUGLIANO S., SCHRAA K., MILLS TS., PIETRAS EM., EISENMENSSER E.Z., DAGNA L., BOLETTA A., D'ALESSANDRO A., JOOSTEN L.A.B., NETEA M.G. & DINARELLO C.A. (2021): The anti-inflammatory cytokine interleukin-37 is an inhibitor of trained immunity. Cell Reports 35, 108955.
FAKHRY S.S, HAMMED Z.N., BAKIR W A E. & AL-RUBAII B.A.L. (2022): Identification of methicil-lin-resistant strains of Staphylococcus aureus isolated from humans and food sources by Use of mecA 1 and mecA 2 genes in Pulsedfield gel electrophoresis (PFGE) technique. Bionatura 7 (2) 44. http://dx.doi.org/10.21931/RB/2022.07.02.44.
FANG Y., SU Y., XU J., HU Z., ZHAO K., LIU C. & ZHANG H. (2021): Varicocele-Mediated Male Infertility: From the Perspective of Testicular Immunity and Inflammation. Front Immunol 12, 729539.
GUISASOLA M.C., ALONSO B., BRAVO B., VAQUERO J. & CHANA F. (2018): An overview of cytokines and heat shock response in polytraumatized patients. Cell stress chaperones 23, 483-489.
HUSSAIN A.G. & ALRUBAII B.A.L. (2023): Molecular detection and expression of virulence factor encoding genes of Pseudomonas aeruginosa isolated from clinical samples. Biomedicine 43(5), 1514-1519.
ISMAEL M.K., QADDOORI Y.B., SHABAN M.N. & AL-RUBAII B.A.L. (2023): The Immunohistochem-ical Staining of Vimentin and E-Cadherin in Bladder Cancer Patients Infected with Hepatitis C Virus. Journal of Pure and Applied Microbiology 17(2), 1009-1016.
JAIL A.S.A., WASAN W.G. & RAAD Z. (2023): Heat shock protein 70 biomarkers in sperm and its association on oligoasthenozoospermia, and asthe nozoospermia in male infertility. Medical Journal of Babylon 20(2) , 278-282.
JALIL I S., MOHAMMAS S.Q., MOHSEN A.K. & AL-RUBAII B.A.L. (2023): Inhibitory activity of Mentha spicata oils on biofilms of Proteus mirabilis isolated from burns. Biomedicine (India) 43(2), 748752.
JASSEM A.N., MOUSA H.M. & HUSSAIN M.J. (2014). hsp70-2 Polymorphism in Urinary Bladder Carcinoma. Iraqi journal of biotechnology 13(2), 75-86.
JAWAD N.K., NUMAN A T., AHMED A G., SALEH T.H. & AL-RUBAII B.A.L. (2023): IL-38 gene expression: a new player in Graves' ophthalmopathy patients in Iraq. Biomedicine, 43(1), 210-215.
KADHUM N.N. & ABDUL-HASSAN I.A. (2022): Expression of Heat Shock Protein HSPA2 Gene in Some Iraqi Oligoasthenozoospermia Patients. Iraqi Journal of Biotechnology, 3-9.
KHADHIM M.F. & ABDUL-HASSAN I.A. (2017): Association of Androgen Receptor Gene Polymorphisms at three SNPs and their Haplotypes with Severe Oligozoospermia Risk in Iraqi Patients. Iraqi Journal of Biotechnology 16, 1.
KUMAR V., ROY S., BEHERA B.K. & DAS B.K. (2022): Heat Shock Proteins (Hsps) in Cellular Homeostasis: A Promising Tool for Health Management in Crustacean Aquaculture. Life (Basel) 12(11), 1777.
LUNDY S.D. & SABANEGH JR E.S. (2018): Varicocele management for infertility and pain: a systematic review. Arab journal of urology 16, 157-170.
MELNYK O., VOROBETS M., BESEDINA A., POKOTYLO P., FAFULA R. & VOROBETS D. (2022): cytokine profile in blood serum of infertile men with concomitant pathologies. Art of Medicine 4, 104-108.
MOHSIN M R. & AL-RUBAII B.A.L. (2023): Bacterial growth and antibiotic sensitivity of Proteus mirabilis treated with anti-inflammatory and painkiller drugs. Biomedicine 43(2), 728-734.
MUHSIN H.Y., Al-HUMAIRI R.M., ALSHAREEF D.Q. & AD'HIAH AH. (2022): Interleukin-22 is up-regulated in serum of male patients with ankylosing spondylitis. The Egyptian Rheumatologist 44(4), 351-355.
NIXON B., BROMFIELD E.G., DUN M.D., REDGROVE K.A., MCLAUGHLIN E.A. & AITKEN R.J. (2015): The role of the molecular chaperone heat shock protein A2 (HSPA2) in regulating human sperm-egg recognition. Asian Journal of Andrology 17, 568-573.
PANNER SELVAM M.K., BASKARAN S., AGARWAL A. & HENKEL R. (2021): Protein profiling in unlocking the basis of varicocele-associated infertility. Andrologia 53, e13645.
POLI G., FABI C., SUGONI C., BELLET MM., COSTANTINI C., LUCA G. & BRANCORSINI S. (2022): The Role of NLRP3 Inflammasome Activation and Oxidative Stress in Varicocele-Mediated Male Hypofertility. International Journal of Molecular Sciences 23(9), 5233.
RADONS J. (2016): The human HSP70 family of chaperones: where do we stand? Cell Stress and Chaperones 21, 379-404.
RAZEGHINIA M.-S., SAHEBAZZAMANI M., SOLEYMANI S., KETABCHI A.-A., MOQADDASI-AMIRI M. & MOHAMMADI M.-M. (2022): Expression of proapoptotic receptors Fas/Fas-L on sperm cells and levels of their soluble forms in seminal fluid from patients with varicocele. Journal of Reproductive Immunology 149, 103443.
REHMAN R., AMJAD S., TARIQ H., ZAHID N., AKHTER M. & ASHRAF M. (2020): Oxidative stress and male infertility: a cross sectional study. The Journal of the Pakistan Medical Association 70, 461.
RONG C., WENG L., LI M., ZHOU L. & LI Y. (2023): Serum interleukin-38 and-41 levels as candidate biomarkers in male infertility. Immunology Letters 255, 47-53.
SALEH T.H., HASHIM S., ABDULRAZAQ ALOBAIDI R.A. & AL-RUBAII B.A.L. (2020): A biological study of chitinase produced by clinical isolates of Pseudomonas aeruginosa and detection of chia responsible gene. International Journal of Research in Pharmaceutical Sciences 11(2), 1318-1330.
SALIH H.S., AL-SHAMMARI A.M. & AL-RUBAII B.A.L, (2018). Intratumoral co-administration of oncolytic newcastle disease virus and bacterial hyaluronidase enhances virus potency in tumor models. Journal of Global Pharma Technology 10(10), 303-310.
SANTANA VP., MIRANDA-FURTADO C.L., DE OLIVEIRA-GENNARO F.G. & DOS REIS R.M. (2017): Genetics and epigenetics of varicocele pathophysiology: an overview. Journal of Assisted Reproduction and Genetics 34, 839-847.
SCHMITTGEN T.D. & LIVAK K.J. (2008): Analyzing real-time PCRdata by the comparative C(T) method. NatProtoc 3, 1101-8.
SCIEGLINSKA D. & KRAWCZYK Z. (2015): Expression, function, and regulation of the testis-enriched heat shock HSPA2 gene in rodents and humans. Cell Stress Chaperones 20, 221-35.
SOLLENDER G.E., BELARMINO A., FURTADO TP., OSADCHIY V., MILLS J.N., PELLEGRINI M. & ELESWARAPU S.V. (2024): The Interplay of Varicoceles, Sperm Epigenetics, and Male Infertility: A Focused, Contemporary Review. Andrologia 2024, 5525839.
SUTAN R.S., ALKHAYALI B.D., ABDULMAJEED G.M. & AL-RUBAII B.A. (2023): Exploring Small Nucleolar RNA Host Gene 3 as a Therapeutic Target in Breast Cancer through Metabolic Reprogramming. Opera Medica etPhysiologica 10(4), 36-47.
TADROS N N. & SABANEGH E. (2019): Chapter 2.4 - Varicocele. In: HENKEL, R., SAMANTA, L. & AGARWAL, A. (eds.) Oxidants, Antioxidants and Impact of the Oxidative Status in Male Reproduction. Academic Press.
YASUDA K., NAKANISHI K. & TSUTSUI H. (2019): Interleukin-18 in health and disease. International journal of molecular sciences 20, 649.
ZEINALI M., HADIAN AMREE A., KHORRAMDELAZAD H., KARAMI H. & ABEDINZADEH M. (2017): Inflammatory and anti-inflammatory cytokines in the seminal plasma of infertile men suffering from varicocele. Andrologia 49, e12685.
