CC BY
3
INVESTIGATING THE INSIG2 GENE RS6726538 VARIANT AS A NOVEL MARKER FOR CERVICAL CANCER
H.J. Muhammed1,1.A.A.M. Rasheed2, R.M. Hassan3, S.T. Hashim1, T.H. Saleh1*
1 Department of biology, College of Science, Mustansiriyah University, Baghdad, Iraq;
2 Department of pathology, College of medicine, Tikrit University Salahaddine, Iraq;
3 Department of biotechnology, College of Science, University of Baghdad, Baghdad, Iraq.
* Corresponding author: [email protected]
Abstract. Background: previous studies have implicated the INSIG2 rs6726538 single nucleotide polymorphism (SNP) as a potential risk factor for cervical cancer. Our objective was to examine the correlation between this genetic variation and the vulnerability of Iraqi women to cervical cancer. Methods: this case-control study analyzed rs6726538 genotypes and allele frequencies in 109 cervical cancer cases and 109 healthy controls. Logistic regression calculated odds ratios (OR) and 95% confidence intervals (CI). The rs6726538 SNP was genotyped using tetra-primer ARMS-PCR. Results: the AT genotype occurred more frequently in cases than controls (52.2% vs 34%, OR 0.783, 95% CI 0.38-1.25, p = 0.0391). The TT genotype was less common but showed a non-significant decreased cancer risk versus AA (OR 0.336, 95% CI 0.17-0.96, p = 0.0707). The T allele was significantly higher in cases (36.3% vs 20.6% in controls, p = 0.0023), while the A allele was higher in controls (79.4% vs 63.7% in cases, p = 0.05). Conclusion: this preliminary data indicates that the rs6726538 T allele and TT genotype may be associated with increased cervical cancer risk, while the A allele and AA genotype could have a protective effect. However, larger studies are required to validate these initial findings on how this SNP may impact cervical cancer susceptibility.
Keywords: cervical cancer, INSIG2 gene, rs6726538, tetra primer, women's cancer.
List of Abbreviations
INSIG2 - insulin-induced gene 2 SNP - single nucleotide polymorphism OR - odds ratios
ARMS - the amplification-refractory mutation system
CI - confidence intervals HPV - high-risk human papillomavirus SREBPs - sterol regulatory element-binding proteins
GWAS - genome-wide association studies XRCC1 - X-ray repair cross-complementing protein
ERCC2 - excision repair 2, core complex helicase subunit
APE1 - purinic/apyrimidinic endonuclease 1
Introduction
Numerous cancer-causing diseases have been investigated locally in Iraq, such as gastric cancer (Sultan et al., 2023), bladder cancer (Al-Humairi et al., 2023a; Ismael et al., 2023), and peptic ulcer disease (Bresam et al., 2023) and other. The cervical cancer is one among these diseases, it kills about 300,000 people annually (Torre et al., 2012). HPV infection is the main
cause of cervical cancer (Walboomers et al., 1999). However, only a tiny percentage of HPV infections cause cancer, suggesting genetic variations may affect disease risk (Ramachandran and Dork, 2021). SNPs in genes involved in cell cycle control, apoptosis, and DNA damage repair have been linked to cervical and peptic cancer risk (Das et al., 2022; Bresam et al., 2023a). The rs6726538 SNP, located in an intron of the INSIG2 gene on chromosome 2q14.2, may impact cancer risk. The INSIG2 gene encodes an endoplasmic reticulum protein that blocks proteolytic activation of SREBP transcription factors, influencing cholesterol synthesis and possibly carcinogenesis (Yabed et al., 2002; Fagny et al., 2020). An earlier study by Miura et al. (2014) discovered that having the A allele of rs6726538 enhanced the risk of cervical cancer (Miura et al., 2014). A case-control study in a Bangladeshi population also reported the rs6726538 T allele and TT/AT genotypes significantly increased cervical cancer risk compared to the AA genotype. Given the potential role of INSIG2 genetic variants in cancer, analysis of rs6726538 may provide insight into cervical cancer susceptibility (Hasan et al., 2021).
Here, we conducted a preliminary case-control study analyzing the genotype and allele frequencies of rs6726538 in 109 cervical cancer patients and 109 healthy controls of Iraqi descent. The goal was to elucidate if this SNP is associated with altered cervical cancer risk in this population. Findings from this study will help determine if INSIG2 rs6726538 warrants further investigation as a novel genetic marker for cervical cancer risk. If replicated in larger cohorts, screening for this SNP could potentially help stratify women according to genetic predisposition to cervical cancer. However, additional research in diverse populations is needed to validate the association before clinical recommendations can be made.
Materials and Methods
Study Participants
We performed a hospital-based case-control study including 109 women diagnosed with cervical cancer and 109 healthy controls. Cases were recruited from the gynecology department at Medical City Hospital - Baghdad between 13-11-2022 and 25-2-2023. Inclusion criteria were aged 18-65 years, histopathologically confirmed cervical cancer. The cases were stratified into two age groups; 67 cases aged < 40 years (mean age 34.5 years) and 42 cases aged > 40 years (mean age 52.8 years). Previous hysterectomy or pelvic radiotherapy excluded. We matched controls from the hospital's screening clinic to cases based on age (±5 years) and location. The institutional ethics review committee approved the study, and all subjects gave written informed permission.
DNA Extraction and Genotyping
The manufacturer's instructions were followed to extract genomic DNA from 5 ml of peripheral blood using a Qiagen/German kit. DNA concentration and purity was measured by spectrophotometry. Genotyping of the IN-SIG2 rs6726538 SNP was carried out by tetra-primer ARMS-PCR using primers designed by (Hasan et al., 2021). This method uses two outer primers and two inner allele-specific primers to amplify allele-specific amplicons in a single tube that can be visualized on an agarose
gel (Table 1). Figures 1 and 2 show PCR results on 2% agarose gels stained with ethidium bromide. For quality control, 5% of samples were randomly selected and repeated to evaluate re-producibility.
PCR Amplification
The polymerase chain reaction (PCR) combination includes 2X PCR master mix, 10 pM primers (forward outer, reverse outer, inner, inner), 40 ng genomic DNA, and Nuclease-free water (up to 25 pl total volume). These thermo-cycling settings will be used for tetra-primer ARMS-PCR: initial denaturation: 95 °C for 5 minutes, 35 cycles of 95 °C for 1 minute; annealing: 64 °C for 30 seconds; extension: 72 °C for 30 seconds; and final extension: 72 °C for 10 minutes. A 432bp band indicates the A allele, a 231bp band indicates the T allele, and both bands indicate a heterozygote AT. The PCR well regarded in various medical topics such as Al-Saadi et al, 2023; Jawad et al, 2023; Salih et al, 2018; Al-Humairi et al., 2019; Saleh et al, 2020a; Saleh et al, 2020b; Jalil et al, 2023; Mohsin & AL-Rubaii, 2023; Al-Jumaily et al, 2023; Lafta et al, 2023; Ra-soul, 2023; Shehab & Al-Rubaii, 2019; Ab-dulrazaq et al., 2022; Husain & Alrubaii, 2023.
Statistical Analysis
In SPSS v22.0, Pearson's chi-square compared case and control genotype frequencies. Logistic regression calculated rs6726538 genotype odds ratios and 95% confidence intervals for cervical cancer risk. Statistical significance was set at P < 0.05 (Cary, 2018).
Results
This study analyzed 109 patients' age, marital status, pregnancy status, and births (Fig. 3). Of the total patients, 67 (61.5%) were under 40 and 42 (38.5%) were 40 or older. The age distribution difference was significant (p = 0.0166). There were 55 married patients (50.4%) and 54 unmarried patients (49.6%). We found no significant marital status difference across groups (p = 0.923). Of the married patients, 26 (47.3%) were pregnant and 29 (52.7%) were not. The difference in pregnancy
Table 1
Primer sequence for the INSIG2 gene rs6726538
Primer Classifications Primer sequence 5'- 3' Base pair Mutation
Forward outer primer GAGTAGCTGGGACTACAAGCACACACTA 432 frequent
Reverse outer primer A allele CTCACTTTCCACAAACTTTGAAGGAAGA 432
Forward inner primer CAACCCCATCCCCCTTGCTATTTATT 261 A/A
Reverse inner primer T allele GAACACTGATTATGTGATAGTCTTCCTGAT 231 rs6726538 T/A g.118131653
6 5 4 3 2 1
432bp
432bp
231bp
231bp
261bp
Fig. 1. Tetra Primer ARMS-PCR amplifies DNA. Lane 1: DNA ladder (100 bp). Lane 2: TT homozygous genotype 432 and 261 bp bands. Lanes 3 and 4: AT heterozygous genotype 3 bands 432, 261, and 231. Lanes 5 and 6: AA wild type homozygous two bands 432 and 231bp
gtagctgggactäcäägcacacactaccacgccaagctaatttttgtattttt agtagagacagggtt
ttaccatgttggccaggctggtctcaaactcctgacctcaagtgatccgcccgcctcagcctccccaagt gctgggattacaggtgtatttttatatcaacaaattatctcctgtctccataaagctcatcaaaactttt
ttgttatctgtgtgctccccaaccccatcccccttgctatttgt|ttaggaagactatcacataatcagt
gttcaagatgaatgttaactaggaagatäagggatcaaatgcttctcttgtctaacatgtacatgatgga tcttactttccatccaggataaattattgtaaattctctattagtttctagtgaatgaaacttcagattc
AA 7 7 A G C 7 AC T T CT T CCTTCAAAGTTTGTGGAAAGTGA
I
Fig. 2. Referring to the NCBI Reference Sequence: NC_000002.12 GenBank Graphics, this is the primary assembly of human chromosome 2, GRCh38.p14
status was not statistically significant (p = 0.685). As for the number of births among married patients, 31 (56.4%) had <4 births and 24 (43.6%) had >4 births. The difference in number of births was not statistically significant (p = 0.345). Patients aged <40 years were significantly more common compared to those aged
> 40 years. Nevertheless, there were no notable disparities among the groups regarding marital status, pregnancy status, or number of births.
There were 109 cases (cervical cancer patients) and 109 controls analyzed (Fig. 4). The AA genotype was most frequent in controls (62.4%) compared to cases (37.7%). The AT
Fig. 3. The age, marital status, pregnancy status, and the number of birth distribution of cervical cancer. Among 109 cervical cancer patients, those aged <40 years were significantly more common; marital status did not differ significantly, as well as pregnancy status, or number of births
Fig. 4. The frequency of the Genotype AA in two groups: Cases and Control. The percentage for Cases is 37.70%, while the percentage for the Control group is significantly higher - 62.40%. The p-value of 0.0097 indicates a statistically significant difference between the two groups
genotype was more frequent in cases (52.2%) than controls (34%), this difference was statistically significant (OR 0.783, 95% CI 0.381.25, p = 0.0391) (Fig. 5). The TT genotype was
less prevalent in both groups but had a non-significant lower cervical cancer risk than the AA genotype (OR 0.336, p = 0.0707) (Fig. 6). Cases had 36.3% T alleles compared to 20.6% con-
trols (p = 0.0023) (Fig. 7), suggesting the T allele may be associated with increased cervical cancer risk. The A allele frequency was significantly higher in controls than cases (p = 0.05), further suggesting the A allele may be protective against cervical cancer for this SNP
(rs6726538). However, the AT genotype and T allele seem to be associated with higher cervical cancer risk. Overall, preliminary data implies that the rs6726538 may impact cervical cancer risk. However, larger validation studies are needed.
Genotype AT rs6726538
60% 50% 40% 30% 20% 10% 0%
P-Value=0.0391*
52.20%
| 34% |
i
Cases
Control
Fig. 5. This graph shows the frequency of the Genotype AT rs6726538 in Cases and Control groups. The Cases group has a higher percentage of 52.20%, compared to 3.4% in the Control group. The p-value of 0.0391 suggests a statistically significant difference between the two groups
Fig. 6. The bar graph represents the frequency of the Genotype TT in Cases and Control groups. The percentage for Cases is 10.10%, while the Control group has a lower percentage of 3.60%. However, the p-value of 0.07 and the notation "NS" (not significant) indicate that the difference between the two groups is not statistically significant
Fig. 7. The frequency of the A allele is 63.70% in the case group and 79.40% in the control group, with a significant p-value of 0.05. The frequency of the T allele is 36.30% in the case group, with a significant p-value of 0.0023 compared to the control group the T allele is 20.60%
Discussion
This study found a significantly higher proportion of patients aged <40 years compared to >40 years among women with cervical cancer. This finding aligns with previous research showing an increasing trend of cervical cancer in younger women. A study by (Bray et al., 2018) found that globally, the incidence of cervical cancer in women aged 15-39 years has increased over the past few decades (Bray et al., 2018). Married and unmarried women were not significantly different in this study. Marital status has varied effects on cervical cancer outcomes, according to past studies. Some studies show that married women have higher screening rates and lower mortality than unmarried women (Machida et al., 2017; Petkeviciene et al., 2018). However, other studies have not found a significant association between marital status and cervical cancer survival after adjusting for other factors (Patel et al., 2010). More research may be needed to clarify the relationship between marital status and cervical cancer outcomes. For pregnancy status and number of births, this study did not find any significant
differences. Increased parity and early age at first birth have been associated with higher risk of developing cervical cancer in previous studies (Tekalegn et al., 2022). However, there is limited research on how pregnancy or parity affects outcomes once cervical cancer has developed. Further studies are likely needed on this topic. Overall, the finding of higher cervical cancer incidence in younger women has been reported previously. However, the role of marital status, pregnancy, and parity on cervical cancer outcomes remains unclear based on existing research. The data presented in this study indicates that the AT genotype and T allele of SNP rs6726538 may be associated with increased cervical cancer risk in this population. The percentage of AT heterozygotes was significantly higher in cervical cancer cases compared to healthy controls (52.2% vs 34%, p = 0.0391). The T allele was more common in patients (36.3%) than controls (20.6%), p-value of 0.0023. The early results support recent research that shows genetic variants can alter cervical cancer risk. Several studies have linked particular SNPs to cervical cancer risk. Several
HLA class II SNPs, like rs9272143, increase the risk of several diseases, according to genome-wide association studies (GWAS) (Leo et al., 2017). Han Chinese and Taiwanese women with CD83 rs750749 SNP showed a higher cervical cancer risk (Yul et al., 2019). DNA repair gene studies have found many SNPs connected to cervical cancer risk. The SNPs are Arg399Gln in XRCC1 and Asp312Asn in ERCC2 (Niwa et al., 2005). A meta-analysis of the XRCC1 Arg194Trp SNP found that the 194Trp allele lowered cervical cancer risk, as did this study's AA genotype and A allele (Zeng et al., 2017). North Indians with the APE1 Asp148Glu SNP had lower cervical cancer rates (Charles et al., 2020). Furthermore, some SNPs may only impact risk for certain cervical cancer subtypes like adenocarcinoma (Leo et al., 2017). Gene-gene and gene-environment interactions likely further modulate risk, as SNPs in inflammation genes like TNF-a have shown differential effects based on HPV co-infection status (Hamadani et al., 2017). While promising, many studies report inconsistent findings on the same SNPs, likely due to differences in ethnicity, HPV subtype distribution, and other factors in study populations (Mar-tinez-Navz et al., 2016). The complexity of cervical carcinogenesis involving multiple genetic and external variables makes definitively
implycating individual SNPs difficult (Habbous et al., 2012). Additionally, most studies assess SNPs independently, but polygenic models suggest multiple low-risk alleles cooperatively affect susceptibility (Kuguyo et al., 2018; Bresam et al., 2023b).
In summary, the accumulating evidence supports the role of SNPs in genetic predisposition to cervical cancer. However, adequately powered studies in diverse populations are still required to validate relationships between specific polymorphisms like rs6726538 and cervical cancer pathogenesis. Investigating SNP-SNP and gene-environment interactions could further elucidate the complex interplay between genotype, alleles, and cervical carcinogenesis (Wang et al., 2021). This will facilitate the development of SNP-based predictive screening approaches and targeted prevention strategies for cervical cancer.
Conclusion
The INSIG2 gene rs6726538 T allele and AT genotype enhanced cervical cancer risk relative to the wildtype AA genotype. Age-stratified analysis indicated the SNP had a stronger influence in women under 40 years old. The results implicate the INSIG2 variant as a potential novel genetic marker for assessing cervical cancer risk pending validation in larger studies.
References
ABDULRAZAQ R.A., MAHMOOD W.S., ALWAN B., SALEH, T.H., HASHIM S.T. & AL-RUBAII B.A.L. (2022): Biological study of protease produced by clinical isolates of Staphylococcus aureus. Research Journal of Pharmacy and Technology 15(12), 5415-5420.
Al-HUMAIRI R.M.A., AL-MUSAWI M.T. & AD'HIAH AH. (2019): Bidirectional expression of Toll-like receptor 7 gene in urinary bladder cancer and urinary tract infection of Iraqi patients. Gene Reports 17, 100491.
Al-HUMAIRI R.M.A, HASHIM M.T., THANOON A S. & AD'HIAH A.H. (2023): Systemic Interleukin-6 Response after Intravesical Instillation of Bacillus Calmette-Guerin and Mitomycin C in Superficial Bladder Cancer. Archives of Razi Institute 78(1), 353-360.
AL-JUMAILY R.M.K, AL-SHEAKLI I.I, MUHAMMED H.J. & AL-RUBAII B.A.L (2023): Gene expression of Interleukin-10 and Foxp3 as critical biomarkers in rheumatoid arthritis patients. Biomedicine (India) 43(4),1183-1187.
AL-SAADI H.K., AWAD H.A., SALTAN Z.S., HASOON B.A., ABDULWAHAB A.L., AL-AZAWI K.F. & AL-RUBAII B.A.L. (2023): Antioxidant and Antibacterial Activities of Allium sativum Ethanol Extract and Silver Nanoparticles. Tropical Journal Natural Product Research 7(6), 3105-3110.
BRAY F., FERLAY J., SOERJOMATARAM I., SIEGEL R.L., TORRE LA. & JEMAL A. (2018): Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: a cancer journal for clinicians 68(6), 394-424.
BRESAM S., AL-JUMAILY R.M., KARIM G.F. & AL-RUBAII B.A.L. (2023a): Polymorphism in SNP rs972283 of the KLF14 gene and genetic disposition to peptic ulcer. Biomedicine 43(1), 216-20.
BRESAM S., ALHUMAIRI R.M.A.U., HADE I.M. & AL-RUBAII B.A.L. (2023b): Genetic mutation rs972283 of the KLF14 gene and the incidence of gastric cancer. Biomedicine (India) 43(4), 1256-1260.
CARY N. (2018): Statistical analysis system, User's guide. Statistical. Version 9. SAS. Inst. Inc. USA.
CHARLES M R., RAZA S T., SHARMA R., PRATAP P., EBA A. & SINGH M. (2020): Association of DNA repair genes XRCC1 and APE-1 with the risk of cervical cancer in North Indian population. Asian Pacific Journal of Cancer Prevention 21(7), 2061-2065.
DAS A.P., CHOPRA M. & AGARWAL S.M. (2022): Prioritization and Meta-analysis of regulatory SNPs identified IL6, TGFB1, TLR9 and MMP7 as significantly associated with cervical cancer. Cytokine 157, 155954
FAGNY M., PLATIG J., KUIJJER ML., LIN X. & QUACKENBUSH J. (2020): Nongenic cancer-risk SNPs affect oncogenes, tumor suppressor genes, and immune function. British Journal of Cancer 122 (4), 569577.
HAMADANI S., KAMALI M., HANTOUSHZADEH S., TABATABAEE R.S., NEAMATZADEH H., FOROUGHI E., HAGHIGHI F., ZARE-SHEHNEH M. & HEJAZIAN-YAZDI E.A. (2017): Association of the s1799724 and rs1800629 polymorphisms of the TNF-a gene with susceptibility to cervical cancer: a systematic review and meta-analysis based on 24 casecontrol studies. Asian Pacific Journal of Cancer Care 2(2), 29-36.
HABBOUS S., PANG V., ENG L., XU W., KURTZ G., LIU F.F., MACKAY H., AMIR E. & Liu G. (2012): p53 Arg72Pro polymorphism, HPV status and initiation, progression, and development of cervical cancer: a systematic review and meta-analysis. Clinical Cancer Research 18(23), 6407-6415.
HASAN M.E., MATIN M., HAQUE M.E., AZIZ M.A., MILLAT M.S., UDDIN M.S., MOGHAL M.M.R. & ISLAM M.S. (2021): Polymorphic variants INSIG2 rs6726538, HLA-DRB1 rs9272143, and GCNT1P5 rs7780883 contribute to the susceptibility of cervical cancer in the Bangladeshi women. Cancer Medicine 10(5), 1829-1838.
HUSAIN A.G. & Alrubaii B.A.L. (2023): Molecular detection and expression of virulence factor encoding genes of Pseudomonas aeruginosa isolated from clinical samples. Biomedicine 43(5), 1514-1519.
ISMAEL M.K., QADDOORI Y.B., SHABAN M.N. & AL-RUBAII B.A.L. (2023): The Immunohistochem-ical Staining of Vimentin and E-Cadherin in Bladder Cancer Patients Infected with Hepatitis C Virus. Journal of Pure and Applied Microbiology 17(2), 1009-1016.
JALIL I S., MOHAMMAS S.Q., MOHSEN A.K. & AL-RUBAII B.A.L. (2023): Inhibitory activity of Mentha spicata oils on biofilms of Proteus mirabilis isolated from burns. Biomedicine (India) 43(2), 748-752.
JAWAD N.K., NUMAN A T., AHMED A G., SALEH T.H. & AL-RUBAII B.A.L. (2023): IL-38 gene expression: a new player in Graves' ophthalmopathy patients in Iraq. Biomedicine 43(1), 210-215.
KUGUYO O., TSIKAI N., THOMFORD N.E., MAGWALI T., MADZIYIRE M.G., NHACHI C.F., MATIMBA A. & DANDARA C. (2018): Genetic susceptibility for cervical cancer in African populations: what are the host genetic drivers? OMICS: A journal of integrative Biology 22(7), 468-483.
LAFTA F.M., AL-JUMAILY R.M.KH., RASOUL L.M. (2023): Global DNA Methylation Levels in Epstein-Barr-Virus-Positive Iraqi Patients with Acute Lymphoblastic Leukaemia. Iraqi Journal of Science 64(3), 1109-1118.
LEO P.J., MADELEINE MM., WANG S., SCHWARTZ S.M., NEWELL F., PETTERSSON-KYMMER U., HEMMINKI K., HALLMANS G., TIEWS S., STEINBERG W. & RADER J.S. (2017): Defining the genetic susceptibility to cervical neoplasia-A genome-wide association study. PLoS Genet. 13(8), e1006866.
MACHIDA H., ECKHARDT S.E., CASTANEDA A.V., BLAKE E.A., PHAM H Q., ROMAN L.D. & MASTUO K. (2017): Single marital status and infectious mortality in women with cervical cancer in the United States. International Journal of Gynecologic Cancer 27(8),1737-1746.
MARTINEZ-NAVZ G.A., FERNANDEZ-NINO J.A., MADRID-MARINA V.& TORRES-POVEDA K. (2016): Cervical cancer genetic susceptibility: a systematic review and meta-analyses of recent evidence. PLoS One 11(7), e0157344.
MIURA K., MISHIMA H., KINOSHITA A., HAYASHIDA C., ABE S., TOKUNAGA K., MASUZAKI H. & YOSHIURA K.I. (2014): Genome-wide association study of HPV-associated cervical cancer in Japanese women. Journal of medical virology 86(7),1153-1158.
MOHSIN MR. & AL-RUBAII B.A.L. (2023): Bacterial growth and antibiotic sensitivity of Proteus mirabilis treated with anti-inflammatory and painkiller drugs. Biomedicine 43(2), 728-734.
NIWA Y., MATSUO K., ITO H., HIROSE K., TAJIMA K., NAKANISHI T., NAWA A., KUZUYA K., TAMAKOSHI A. & HAMAJIMA N. (2005): Association of XRCC1 Arg399Gln and OGG1 Ser326Cys polymorphisms with the risk of cervical cancer in Japanese subjects. Gynecologic Oncology 99(1), 43-49.
PATEL M.K., PATEL DA., LU M., ELSHAIKH M.A., MUNKARAH A. & Movsas B. (2010): Impact of marital status on survival among women with invasive cervical cancer: analysis of population-based surveillance, epidemiology, and end results data. Journal of lower genital tract disease 14(4), 329-338.
PETKEVICIENE J., IVANAUSKIENE R. & KLUMBIENE J. (2018): Sociodemographic and lifestyle determinants of non-attendance for cervical cancer screening in Lithuania, 2006-2014. Public Health 156, 79-86.
RAMACHANDRAN D. & DORK T. (2021): Genomic Risk Factors for Cervical Cancer. Cancers 13(20), 5137.
RASOUL L.M. (2023): The Anti-cancer Impact of Genetically Engineered Newcastle Disease Virus Expressing GFP Gene Against U87-MG Cell Line. Iraqi Journal of Science 64(12),6204-6214.
RASOUL L.M., ALLAMI RH., ALSHIBIB A.L., AL-RUBAII B.A.L & SALE T.H. (2023): Expression and cytotoxic effect of recombinant Newcastle Disease Virus (rNDV) vector expressing enhanced green fluorescent gene in JHH5 cell line. Biomedicine 43(1), 205-209.
SALIH H.S., AL-SHAMMARI A.M. & AL-RUBAII B.A.L. (2018): Intratumoral co-administration of on-colytic newcastle disease virus and bacterial hyaluronidase enhances virus potency in tumor models. Journal of Global Pharma Technology 10(10), 303-310.
SALEH T.H., HASHIM S., ABDULRAZAQ ALOBAIDI R.A. & AL-RUBAII B.A.L. (2020): A biological study of chitinase produced by clinical isolates of Pseudomonas aeruginosa and detection of chia responsible gene. International Journal of Research in Pharmaceutical Sciences 11(2), 1318-1330.
SALEH T.H., HASHIM ST., MALIK S.N. ' & AL-RUBAII B.A.L. (2020): The impact some of nutrients on swarming phenomenon and detection the responsible gene RsbA in clinical isolates of Proteus mirabilis. International Journal of Research in Pharmaceutical Sciences 11(1), 437-444.
SHEHAB Z.H & Al-Rubaii B.A.L. (2019): Effect of D-mannose on gene expression of neuraminidase produced from different clinical isolates of Pseudomonas aeruginosa. Baghdad Science Journal 16(2), 291-298.
SUTAN R S., ALKHAYALI B D., ABDULMAJEED G.M. & AL-RUBAII B.A. (2023): Exploring Small Nucleolar RNA Host Gene 3 as a Therapeutic Target in Breast Cancer through Metabolic Reprogramming. Opera Medica etPhysiologica 10(4), 36-47.
TEKALEGN Y., SAHILEDENGLE B., WOLDEYOHANNES D., ATLAW D., DEGNO S., DESTA F., BEKELE K., ASEFFA T., GEZAHEGN H. & KENE C. (2022): High parity is associated with increased risk of cervical cancer: Systematic review and meta-analysis of case-control studies. Women's Health 18, 17455065221075904.
TORRE L.A., BRAY F., SIEGEL R.L., FERLAY J., LORTET-TIEULENT J. & JEMAL A. (2012): Global cancer statistics, 2012. CA: a cancer journal for clinicians 65(2), 87-108.
WALBOOMERS J.M., JACONS M.V., MANOS M M., BOSCH F X., KUMMER J A., SHAH K.V., SNIJDERS P.J., PETO J., MEIJER C.J. & MUNOZ N. (1999): Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. The Journal of pathology 189(1),12-19.
WANG M., YUAN B., ZHOU Z.H. & HAN W W. (2021): Clinicopathological characteristics and prognostic factors of cervical adenocarcinoma. Scientific Reports 11(1), 7506.
YABE D., BROWN M.S. & GOLDSTEIN J.L. (2002): Insig-2, a second endoplasmic reticulum protein that binds SCAP and blocks export of sterol regulatory element-binding proteins. Proceedings of the National Academy of Sciences 99(20), 12753-12758.
YU L., FEI L., LIU X., PI X., WANG L & CHEN S. (2019): Application of p16/Ki-67 dual-staining cytology in cervical cancers. Journal of Cancer 10(12), 2654-2660.
ZENG X., ZHANG Y., YUE T., ' ZHANG T., WANG J., XUE Y. & AN R. (2017): Association between XRCC1 polymorphisms and the risk of cervical cancer: a meta-analysis based on 4895 subjects. Onco-target 8(2), 2249-2260.
