CC BY
27Russian Journal of Nematology, 2017, 25 (1), 1 - 16
Intra-species variability of Xiphinema brevicolle
Lordello & Costa, 1961 (Nematoda: Longidoridae)
from China
1 1 12 Eda Marie Barsalote , Zhongling Tian and Jingwu Zheng '
'Laboratory of Plant Nematology, Institute of Biotechnology, College of Agriculture & Biotechnology, Zhejiang University,
310058, Hangzhou, China
2Ministry of Agriculture Key Lab of Molecular Biology of Crop Pathogens and Insects, 310058, Hangzhou, China
e-mail: [email protected]
Accepted for publication 6 March 2017
Summary. During a survey of longidorids from natural vegetation in China, eight populations of Xiphinema brevicolle Lordello & Costa, 1961 were detected. Metric characters derived from females showed no significant difference among populations. Morphological characters are markedly similar in body length (1.8-2.2 mm), odontostyle (89-92 ^m), lip width (10-12 ^m), c' ratio (0.8-1.1 ^m) and position of vulva (49-51%). The 18S, 28S rDNA and cytochrome oxidase I (COI) region of the mitochondrial DNA were sequenced for the eight populations sampled from different localities. Phylogenetic relationships using 18S region suggest 98% similar identity to X brevicolle (Japan), X diffusum (China), X! taylori (Slovakia), X! incognitum (China), X! lambertii and X inequali (Czech Republic). The 28S rDNA sequences are identical to X brevicolle (Japan and Brazil) with 98% clade support. By contrast, mitochondrial COI analysis does not show heterogeneity between populations. COI sequence divergence of 6.09-6.95% between the studied populations is believed to be merely intraspecific valiants of a single species; thus, the populations are considered to be conspecific. A combined morphological and molecular investigation was undertaken to emphasise the taxonomic standing of X! brevicolle from Asia. Key words: 18S, 28S rDNA, mitochondrial COI gene, molecular diagnosis, morphology, variation.
Dagger nematodes of the genus Xiphinema are ectoparasitic migratory nematodes that are worldwide in distribution (Weischer & Brown, 2000). This genus comprises 234 valid species (Coomans et al., 2001), which includes the Xiphinema americanum-group that are widely distributed around America, Europe and Asia (Halbrendt & Brown, 1992; Barsi & Lamberti, 2002) and considered the putative vector of four Nepoviruses (Brown et al., 1995; Taylor & Brown, 1997).
The Xiphinema americanum-group is a complex group comprising 55 taxa (Gutiérrez-Gutiérrez et al. , 2012) in which nominal species have not yet been satisfactorily resolved taxonomically due to controversies about species definition and delineation. For example, Luc et al. (1998) listed 34 putative species of the X. americanum-group, Coomans et al. (2001) reported 38 species, whilst Barsi & Lamberti (2004) reported 50 putative species. These differences of species identification are due to dissimilar insights of experts, some of whom are able to delineate species using only minor morphometrical or morphological variations (Brown
& Halbrendt, 1997). It is evident that Xiphinema americanum-group is composed of numerous species whose accurate naming remains ambiguous (Luc et al., 1998). This is best illustrated in the case of Xiphinema brevicolle Lordello & Costa, 1961, which has several junior synonyms (Coomans et al., 2001). Luc et al. (1998) suggested that X. diffusum was a junior synonym of X. brevicolle but later Oliveira et al. (2005) re-established X. diffusum as a valid species on the basis of molecular identification. Meanwhile, the taxonomic status of X. brevicolle occurring in European countries was later separated as a new valid species, X. taylori (Lamberti et al., 1991), but others disagree and continued to include the two species as junior synonyms of X. brevicolle.
Lamberti et al. (1991) considered that X. brevicolle was restricted to Brazil, but it is probably in neighbouring Latin American countries like Venezuela (Crozzoli et al., 1998) and Belize (Bridge et al., 1996) and there are reports of the species occurring in Kenya (Coomans & Heyns, 1997), Bulgaria (Peneva & Choleva, 1992), Russia (Romanenko, 1981), Slovakia (Liskova, 1995) and
2SOO 2000 1500 1000 £00 Body length Hipjniou-i *pin T»i*V»n • 102 100 98 95 94 92 90 £8 Odontostyle Hirnfieu-! H,nf"iu-6 '"i"" * * ♦H.n^^'"'^ * ♦*nhui
0 14(8 10 11 0 2 4 6 8 10 U
S3.S su 52 SIS SI 39 S 50 49 £ 49 48 5 0 V-position BiKii^ Jipjn Juihul IS 30 23 20 15 10 5 Tail Hiphli-! Mjjijihoii-i smni.Jnmd9n|
2 4 C 8 10 12 0 2 4 « £ 10 12
Fig. 1. Comparisons of diagnostic characters of Xiphinema brevicolle from China and topotype population from Brazil, Taiwan and Japan.
Table 1. Isolates, host, origin and corresponding sequence code of Xiphinema brevicolle populations from China.
Species Code Location Host Sequence ID
18S D2-D3 coxl mt
Xiphinema brevicolle HZ-02 Zijingang, Hangzhou, CN Maple KY011962 KY011955 KY011949
Xiphinema brevicolle HZ-03 Botanic Garden, Hangzhou, CN Oleander KY011969 KY011959 KY011946
Xiphinema brevicolle HZ-06 Xixi Wetland, Hangzhou, CN Rubber tree KY011967 KY011958 KY011947
Xiphinema brevicolle WZ-02 Wenzhou, Zhejiang, CN Hoop pine KY011964 KY011961 KY011948
Xiphinema brevicolle SX-03 Shanxi, CN Locust tree KY011968 KY011957 KY011950
Xiphinema brevicolle SHD-02 Shandong, CN Chinese plum KY011966 KY011956 KY011952
Xiphinema brevicolle AH-08 Anhui, CN Loquat KY011963 KY011960 KY011953
Xiphinema brevicolle BJ-07 Beijing, CN Chinese pine KY011965 KY011954 KY011951
China (Xu et al., 1995); detailed confirmatory identifications are needed.
This study aimed to conduct morphological and molecular characterisations of populations of X. brevicolle from China and provide a DNA based phylogeny using rDNA and mitochondrial COI gene (COI) sequences to provide a more robust framework to understand the similarities and/or differences of X. brevicolle populations in China.
MATERIALS AND METHODS
Nematode isolation and examination. Soil core samples were collected beneath perennial trees growing under natural vegetation in China (Table 1). The samples were mixed, and a sub sample of
200 g was washed using the decanting and sieving technique (Brown & Boag, 1988). Soil extracts were allowed set aside for 24 h and nematode suspensions were collected the following day. Adult nematodes were handpicked and mounted in distilled water on a temporary slide and heat killed for morphological examination and measurements of diagnostic characters. Photographs were taken using a digital camera (Leica DM5000B) and morphological measurements were obtained using specialised software (LAS; Leica Camera AG). Morphometric values are given in pm unless noted otherwise.
DNA extraction. A single adult nematode was handpicked and placed in a glass slide with 13 pl distilled H2O. The nematode was cut into fragments using a sterilised needle and fragmented pieces were
pipetted up to 10 ^l and transferred to an Eppendorf tube; 8 ^l Mg+ free buffer and 2 ^l proteinase K (600 ^g ml-1) were added to make a total volume of 20 ^l. The Eppendorf tube was briefly centrifuged for 2 min at 15,520 g (Ye et al., 2004). The PCR tube was frozen at -70°C overnight and then incubated at 65°C for 1 h and 95°C for 15 min. The final DNA extract was cooled down at 8°C and stored at -20°C until use.
PCR and sequencing. PCR amplification and relevant thermal conditions of 18S, D2-D3 region and mtDNA cytochrome oxidase I were all as described by Sakai et al. (2011). PCR were carried out using different primers depending on the target genes (Table 2). PCR mixes of 14.2 ^l dd^O, 2.5 ^l LA buffer, 2 ^l dNTP, 1.5 ^l each primers, 3 ^l DNA template and 0.3 LA Taq were prepared to a total volume of 25 ^l. All PCR reactions were run in
a BIO-RAD S1000 thermal cycler with the following cycling conditions for nematode rRNA gene: one cycle of 94°C for 2 min, followed by 35 cycles of 94°C for 30 s, annealing temperature of 57°C for 45 s, extension of 72°C for 3 min and a final extension of 72°C for 10 min. PCR products were analysed by electrophoresis on agarose gel (100 V, 400 mA, 30 min) and visualisation was made by staining with DuRed 10,000x and observed under UV illumination.
DNA purification was done as described in the Nucleic Acid Purification kit of AXYGEN and sequencing was made by SANGON Biotechnology Co., Shanghai, China. Sequences were BLAST and aligned by Clustal_W program with default parameters (Thompson et al!, 1994). Phylogenetic analysis and model selection were performed using MEGA 5 (Tamura etal., 2011). The ML tree was
Fig. 2. Xiphinema brevicolle juvenile stages. A-D: J1-J4 anterior region; E-H: J1-J4 tail region.
Table 2. Primers used to amplify SSU, D2-D3 and coxl mtDNA of Xiphinema brevicolle populations from China.
Region Primers Direction Sequence (5'-3') Reference
18S 988F forward CTCAAAGATTAAGCCATGC Holterman et. al, 2006
18S 1912R reverse TTTACGGTCAGAACTAGGG Holterman et. al, 2006
D2-D3 D2A forward ACAAGTACCGTGAGGGAAAGTTG De Ley et al., 1999
D2-D3 D3B reverse TCGGAAGGAACCAGCTACTA De Ley et al., 1999
coxl COIF forward GATTTTTTGGKCATCCWGARG He et al., 2005
coxl COIR reverse CWACATAATAAGTATCATG He et al., 2005
constructed using multiple aligned sequences of the COI region, where Hasegawa-Kishino-Yano model (Hasegawa et al., 1985) and heuristic search with Close-Neighbor-Interchange (CNI) were employed with bootstraps value of 1000 replications.
RESULTS
Xiphinema brevicolle Lordello & Costa, 1961 (Figs 1-7, Tables 3 & 4)
Remarks. The diagnostic characters of the population studied generally agree with the original description of Lordello & Costa, 1961 and topotype
populations reported by Lamberti et al. (1991), Luc et al. (1998), Chen et al. (2005), Kumari et al. (2010) and Sakai et al. (2011) (Table 4). Metric characters of body length, odontostyle length, diameter of lip, guiding ring position from oral aperture and tail length were close to previously described X. brevicolle populations. The adult females of X. brevicolle in China coincides and comes closest to populations described from Taiwan (Zhao, 2013) and Japan (Sakai et al., 2012) (Fig. 1). Morphometrics of four juvenile stages were similar in all obtained populations (Table 3), while general
Fig. 3. Xiphinema brevicolle. A-D: development and position of replacement odontostyle of J1, J2, J3 and J4, respectively; E-H: adult habitus.
Fig. 4. Photomicrographs of anterior region of Xiphinema brevicolle females. A-C: Hangzhou populations (HZ-02, HZ-03, HZ06); D: Wenzhou (WZ-01); E: Shanxi (SX-03); F: Shandong (SHD-02); G: Anhui (AH-08); H: Beijing.
Table 3. Morphometric of juvenile stages of Xiphinema brevicolle populations from China (all measurements in pm),
mean ± standard deviation.
Characters J1 J2 J3 J4
N 3 4 4 7
L 650±18 (642-668) 860±30 (830-890) 1200±30.2 (1180-12301) 1300±89.6 (1282-1395)
a 28.8±2.2 (26.3-30.4) 31.9±0.5 (31.3-32.4) 36.1±1.7 (35.2-38.7) 40±2.8 (36.9-42.8)
b 3.8±0.7 (3.4-4.6) 4.1±0.3 (3.9-4.4) 4.9±0.7 (4.3-5.5) 4.8±0.6 (4.2-5.8)
c 19.2±2 (16.8-20.5) 24.7±0.2 (24.6-24.8) 33.5±0.9 (32.6-34.8) 41.4±1.6 (39.9-43.5)
c' 2.2±0.2 (2-2.5) 1.9±0.17 (1.8-2.2) 1.7±0.03 (1.62-1.69) 1.4±0.04 (1.4-1.5)
Odontostyle 42.8±0.5 (42.4-43.4) 48.6±1.1 (47.5-49.7) 61.2±2.5 (58.6-63.8) 72.8±2.8 (70.5-77.1)
Odontophore 32.8±4.5 (29.8-38) 34.6±3.1 (31.1-37.2) 40.8±2.3 (38.6-43.9) 43.9±1.6 (41.1-45.1)
Replacement odontostyle 46.5±2.8 (44.4-49.6) 59.4±1.4 (58.1-61) 72.6±4.5 (67.3-77.6) 86.8±1.9 (84.2-89)
Tail length 34.4±3.8 (32.2-38.8) 34.6±1.4 (33.7-36.2) 34.4±1.9 (32.8-37) 32.2±0.7 (31.2-33.1)
Lip width 8.8±0.06 (8.8-8.9) 9.9±0.5 (9.5-10.4) 10.7±0.2 (10.5-11.1) 11±0.5 (10.8-11.9)
Width at anus 15.4±29.4 (14-16.3) 17.8±0.8 (17.1-18.7) 20.7±1.4 (19.7-22.8) 23.2±0.6 (21.9-23.9)
Width at base of pharynx 22.8±1.8 (21.5-24.9) 26.9±0.9 (26.1-27.8) 31.9±2.4 (29.4-34.8) 33.6±3.9 (29.8-38.4)
Fig. 5. Photomicrographs of posterior region of Xiphinema brevicolle females. A-C: Hangzhou populations (HZ-02, HZ-03, HZ06); D: Wenzhou (WZ-01); E: Shanxi (SX-03); F: Shandong (SHD-02); G: Anhui (AH-08); H: Beijing (BJ-
07).
Table 4. Comparisons of morphometric measurements of Xiphinema brevicolle females from China and topotype populations from different origins.
Holotype Topotypes
Populations Present study & Costa, 1961) Chen et al., 2005 Shah et.al., 2009 Kumari et al., 2010 Zhao et al., 2013
Hosts Nerium indicum (Oleande r) Acer coriaceif olium (Maple) Eucommi a ulmoides (Rubber tree) Araucari a cunningh amii (Hoop pine) Gleditsia tricantho s (Locust tree) Prunus mume (Chinese plum) Eriobotry a japonica (Loquat) Pinus sp. (Chinese pine) Coffea arabica (Coffee) Euphoria longana (Longan) Pseudopa nax arboreus (Five fingers) Vitis vinifera (grapevi ne) Ilex crenata (Yacca tree)
Locality Hangzho u Hangzho u Hangzho u Wenzhou Shanxi Shandon g Anhui Beijing Brazil Taiwan New Zealand Czech Republic Japan
N 12 17 19 14 12 17 13 16 17 25 7 25 22
L (mm) 1.8±0.57 1.9±0.28 1.9±0.16 1.8±0.12 1.9±0.075 1.9±0.12 1.9±0.17 1.9±0.080 2.1±0.1 1.8±0.1 1.8 2.1±128 1.9±0.11
(1.8-2.1) (1.8-1.92) (1.7-2.0) (1.7-1.9) (1.89-2.2) (1.8+2.2) (1.8-2.1) (1.8-2.0) (1.8-2.2) (1.5-2.1) (1.7-1.9) (1.8-2.2) (1.8-2.0)
Tail length 29±3.3 (27-31) 28±3.1 (27-34) 29.2±3.5 (27.2-30) 28.9±1.03 (27.3-30.5) 28.3±0.9 (27.6-28.9) 29.1±2.5 (26.4-34.1) 26.1±1.9 (23.3-27.5) 25.3±2.2 (21.7-27) 26.8±2.0 (24.1-32.1) 25±2.0 (20-27) 27 (25-30) 25±1.78 (21-28) 27.3±2.0 (25-32)
a 40.8±7.9 (39-46) 43.9±4.6 (41-48) 38±5.9 (32.2-43) 35.4±4.7 (32.0-42.3) 43.5±0.9 (42.9-44.2) 47.3±4.9 (40.8-57) 51.5±5.8 (43.1-61.2) 42±4.3 (39.7-48) 44.5±2.3 (40.7-50.1) 46.5±2.9 (42-52) 45 (41-48) 45.7±3.81 (41.3-49.1) 41±3.2 (40.5-50.5)
5.4±1.9 5.5±2.2 5.4±1.6 5.33±0.6 5.1±0.1 5.5±1.3 5.9±1.1 5.3±0.8 6.4±0.6 6±0.5 6.8±0.51 6.6±0.7
(5-6) (5-6) (5-6) (4.8-6) (5-6) (5-7) (4.8-6) (4-7) (5.6-7.7) (5-7) (5.9-7.7) (6.1-7.4)
c 61.2±1.6 (60-63) 63.5±2.9 (60-64) 62.3±2.5 (60-65) 61.1±2.1 (60-63) 60.9±3.1 (60-64) 61±2.0 (60-64) 62.4±2.1 (61-64) 61±1.7 (60-63) 77.8±0.6 (60.3-94) 76.9±6.5 (67-89) 68 (58-77) 84.2±5.73 (74.8-95.3) 60.9±5.8 (55.3-66.9)
13' s-3'
to
>!
TO g
Pi'
o
<
PS 8-
-J?
5' o Bt B
Table 4. continued).
c' 1.1±0.7 (1-1.2) 0.8±0.6 (0.8-1.2) 0.8±0.7 (0.8-1.1)
V 50.1±2.1 (49-52) 50.1±1.8 (49-52)
Odontostyl e 89.6±1.4 (86-90) 89±1.6 (87-91) 90±2.1 (89-91)
Odontopho re 51.1±6.1 (47-55) 53.1±3.6 (50-58) 53.2±3.2 (46-56)
Total stylet 140.7±4. 5 (137-146) 142.1±5. 6(137-148) 143.2±4. 6(139-149)
Guide ring to anterior 74.3±1.9 (69-75) 78.9±2.8 (75-80) 75±0.01 (72-75)
Lip width 11.2±0.6 (10-11.8) 11.5±1.5 (10-12) 12.1±1.4 (11-13)
Width at guide ring 29.4±2.4 (28.7-32) 30.3±4.2 (28-35) 30.4±0.9 (24-31)
Width at pharynx 49.6±4.2 (47-53) 48.8±3.2 (43-53) 49.8±1.4 (39-51)
Width at anus 29.1±2.7 (27-31) 30.0±4.8 (26-35) 27.6±2.7 (26-30)
Width at vulva 49.1±1.2 (45-51) 47.1±3.3 (41-51) 49.5±1.7 (41-52)
I.liO.l (0.8-1.1)
50.1±0.8 (49.1-53.5) 89.3±1.3 (87.9-
91.5) 52.4±1.6
(51.3-
54.7) 141.7±2. 7(138.5-
143) 80.2±3.5 (73.9-
83.8)
II.9±0.8 (10.8-
12.6)
31.6±4.9 (29-32)
49.52±5. 6(44.1-
52) 28.31±2. 0 (25.7-30.1)
49.6±2.5 (44.6-52)
0.9±0.1 (0.9-1.1)
49.9±2.2 (48-50.6)
90.2±5.7 (87.6-96)
55.7±0.8 (55.1-56.3) 145.9±1. 3 (139-147) 76.8±2.1 (75.3-78.3) 12.0±0.8 (11.4-
12.5) 32.1±2.8
(30.1-34.1) 46.3±1.8 (41.6-
49.6)
30.8±0.8 (26-31)
47.1±1.1 (46.3-48.8)
I.liO.l (1-1.2)
49.7Ü.0 (47.6-
50.8) 90±1.9 (88.1-91.4)
50.8±2.1 (47.9-54.3) 140.8±4. 6(137-145) 75.9±3.2 (69.5-79.2)
II.3±0.8 (10.1-12.1)
29.8±1.0 (27.9-
30.9) 49.5±0.9
(46.5-51.7) 27.7±1.5 (25.3-29.6)
45.1±1.0 (40-46.3)
1±0.1 (0.9-1.1)
50±1.5 (48.9-52.4) 91.1±3.5 (88.8-95.1) 51.8±2.5 (48.8-55.1) 143.6±5. 0 (140.2-148)
77±3.0 (73-81.3)
11.4±0.7 (10.4-12.6) 32.6±5.1 (31.2-38.1) 49.7±5.6 (41.7-55.8)
26.6±2.8 (25.6-30)
49.1±1.2 (44-54.7)
Note: Measurements in pm (except L in mm): mean ± standard deviation (range).
1.0±0.06 (0.9-1.1) 0.96±.06 (0.9-1.1) 0.9 (0.7-1.0) 0.77±0.1 0 (0.66-0.88) l.OiO.l (0.9-1.1)
53±0.9 (51-54) 53.6±1.3 (50-56) 50 (44-54) 50±1.0 (48-51) 50.5±0.2 (50.3-53.6)
101.9±7. 2 (84.7-108) 98.2±3.3 (92-103) 90 (84-100) 88±2.09 (85-92) 89.2±2.2 (86.7-90.6)
57±2.9 (48.8-60) 59.2±1.7 (53-62) 52 (49-55) 57±2.66 (54-62) 53.9±2.7 (50.8-56.7)
158.9±10 157.3±3. 142 135-155 145±3.02 142±2.7
.1 (156-168.3) 45(151-163) (140-149) (141-146)
86.3±5.6 (72.3-92.3) - 75 (70-80) 79±2.07 (75-80) 76.5±3.8 (67-83)
11.5±0.5 (10.6-12.3) - - 12±0.87 (11-14) 12.5±0.4 (12-13)
29.8±1.5 (27.1-31.8) - - 31±0.82 (30-32) 30.4±0.8 (29-32)
39.4±2.9 (35.3-45.3) - - 49±1.92 (47-52) 37.9±1.2 (35-40)
26.6±1.7 (21.8-29.4) 25±1.0 (22-28) - 29±2.16 (27-32) 27±1.6 (24-30)
46.6±3.4 45±4.11 42±2.0
(39.4-50) (40-50) (38-46)
Fig. 6. Morphology of odontophore flange of Xiphinema brevicolle females. A-C: Hangzhou populations (HZ-02, HZ-03, HZ06); D: Wenzhou (WZ-01); E: Shanxi (SX-03); F: Shandong (SHD-02); G: Anhui (AH-08); H: Beijing.
morphology between developmental stages differs in tail appearing elongate conical in J1 and becomes short rounded conoid when reaching to adult (Fig. 2). Additionally, the position of the replacement odontostyle is embedded in the wall of odontophore in J1 with its length more or equal to the functional odontostyle of succeeding stage (Fig. 3A-D). Minor overlap in the range of morphometric among populations were not considered significant, thus suggesting that specimens examined belong to the same group; this is supported by the phylogenetic DNA information.
The X. brevicolle population from China showed similar metric characters in body length of 1.8-2.2 ^m, tail conoid (25-29 ^m) with rounded terminus (Fig. 5), odontostyle (89-92 ^m) long with furcate base and well-developed odontophore flange (Fig. 6), vulva a transverse slit (Fig. 7) and located 4951% at mid-body (Fig. 3E-H), vagina extending almost 1/2 of body diameter (Fig. 7), labial width
(10-12 ^m). Anterior region rounded and slightly expanded (Fig. 4) separated from the rest of the body by a shallow depression, basal bulb tubular and reproductive system amphidelphic. Tail shape appears consistently conical to rounded with a slightly curve tail terminus (Fig. 5).
Ribosomal products of 18S and 28S region indicated a fragment length of approximately 13301501 bp and 790-832 bp, respectively. The obtained amplicons of the 18S region (KY011962-KY011969) were sequence in both directions and showed 99% sequence similarity to X. brevicolle populations reported from Japan (AB604340, AB604341), China (KP793045, KP793044 and KP793043) and several related species, X. diffusum, X. incognitum, X. taylori,, X. lamberti and X. inequale. Partial 28S rDNA (KY011954 - Japan (KR095280, AB675668 and AB635401), KY011960) showed 98% similar identity to Taiwan (KF430800), Brazil (AY601605) and New Zealand
Fig. 7. Shape and orientation of female vulva and vagina. A-C: Hangzhou populations (HZ-02, HZ-03, HZ06); D: Wenzhou (WZ-02); E: Shanxi (SX-03); F: Shandong (SHD-02); G: Anhui (AH-08); H: Beijing (BJ-07).
(FM211649) populations. The COI sequences (KY011946-KY011953) showed separate variant groups with COI variation of 6.09-6.65% between populations; despite the sequence difference, all are apparently clustered in the same clade group of X. brevicolle Japan (AB675669-AB675673).
DISCUSSION
Regardless of the geographic location of the isolated populations, the morphological and metric measurements do not show any significant differences, although there are some minor overlaps of morphological characters (Table 4). The small variation observed does not indicate a separation among populations. This is possibly explained by Luc et al. (1998) suggesting that X. brevicolle is a parthenogenic species that can easily colonise new areas and has a single widespread population with little variation and no differences in morphology, and probably also in genetic structure. Given the minimal variation in morphology and morphometric characters of X. brevicolle to other X. americanum species, molecular methods were used to determine species differences among this complex group. In this study, the use of nucleotide sequences of two
loci (18S and D2-D3 region) showed that X. brevicolle China were identical to other X. americanum-group populations (Figs 8 & 9). This result was comparable to Lazarova et al. (2006), who utilised 18S rDNA to characterise Xiphinema species and showed that the 18S region was homogenous for the X. americanum-group. It is believed that the discriminatory power using rDNA was insufficient to separate species with very minute morphological differences and cannot provide useful phylogenetic information. However, the result of COI region indicated that X. brevicolle China has 6.09-6.65% COI differences, but the variations between populations were assumed to be simply intraspecific variants of a single species (Fig. 10). Similar results obtained from the evaluation of Sakai et al. (2012) with COI variations of X. brevicolle Japan reached 7.2-7.6%. In addition, comparable ranges of COI divergence were reported in L. helveticus with 7.3% and X. diversicaudatum with 9.5% (Orlando et al., 2016). There are few published data on intraspecific variability in nematodes using COI gene; Blouin et al. (1998) noted that COI divergence between closely related species was approximately 10-20%, so within this range the populations are still assumed to be conspecific.
74
1 Xiphinema ddfusum austfalo isolate
AM086683 1 Xiphmema d amencanum RN-2005 mpal tsotace
IKY011965 Xiphmema brftKOi» isol*« BJ-071
$9
72
AM086669 1 Xiphinema drfksum china 2 isolate AB6(U340 1 Xjphjnema txe-.icolle DNA Extraction No 53 AM08667* 1 Xiphinema taylon Slovakia 1 isolate AB604341 l x,phmemasp JPtrHS*09 DNA Extraction No 48 AY297822 1 Xiphmema biewcone AJJ086678 1 Xiphinema «cognitum china 1 isolate HM163214 1 Xiphinema lam&eflii isolate XL HM163213 1 Xiphinema maequale isolate HP AM086677 1 Xiphinema cidusum braiil 2 isolate AY297823 1 Xiph*uma diffusum HM 163212 1 Xiphinema brevKollum rotate BV KP793045 1 Xiphmema fc**TColl* isolate S2X1310 KP7930U 1 Xiphinema t*e*KOIJe isolate $2X1309 KP793043 1 Xiphmema txe-.icolle isolate SZX1308 AM08667S 1 Xiphinema taylon Slovakia 1 AM086669 1 Xiphinema (№sum china isolate 011962 Xichmema bfereole isolate HZ 02) /011964 Xiphinema farfrKoBe isolate WZ02] /01 1967 Xiphmema bre^coie isolate HZ-flg1 /011969 Xiphinema bre^oUe isolate HZ oil X-pfrrngma fre^o'!» AH-pd 011966 ttphmema br*Kole isolate SX-031 OH?« flpfmra fcmttflffff FtflWt aiD-g21 KJ9341S9 1 Xiphinema amencanum isolate T30 11 29987 AM086633 1 Xiphinema georgianum flofwJa isolate A7itOS6637 1 Xiphinema flondae Honda isolate AM086686 1 Xiphinema otncoJum Rooda isolate AMQ86671 1 Xiphinema cf amenc^nim RfJ-2005 flonda 1 isolate AJA086634 1 Xiphinema amencanum south aJnca isolate AF 036610 1 Xiphinema rrvesi №086674 1 Xiphinema peranum ffonda isolate AY297832 1 Xiphmema perwanum ■ AY297835 1 Xiphinema oxycaudatum -HM921344 1 Xiphinema mesi isolate nem213
AM086674 1 Xiphinema peranum partial flonda isolate 3Q|KU250140 1 Xiphinema parasimrfe isolate N$86
'KU250136 1 Xiphinema browni isolate N$82 -AMQ86682 1 Xiphinema pachtaicum Slovakia isolate
002
Fig. 8. Phylogenetic relationships of Xiphinema brevicolle populations from China as inferred by Maximum Likelihood using 18S rDNA region. Bootstrap values are shown in branches.
90
98
65
93
6^HQ1&U73 1 Xiphintmj brtsKoN >A6675667 1 ttphmema br*»coU* OflA Extraction No 151
KYOIIttS ttRfrnema brg*collf> .solfl* H2-03)
KF430ÔQ0 1 Xjphmema bresKOlle isolate Tartan KYMHfil »ohmtmi br^colle »sola* WTÏÏT)
KR095280 1 Xiphmema bre*coBe FM2U649 1 Xiphmema breucolle DîiA Extraction No 53 AB675668 1 Xiphmema breucole DMA Extraction No 186 AB6354011 Xiphmema tx^KoOt DMA Extraction No 50 AY601605 1 Xiphmm* brt%KOtt* isolât EU2*
Xfghm^mj fr^'t »yglat Hg pZl
mm Xiphmema bre^olle .solate "STCA
WISH Rtfirraw bfWCrtfg istffl?
fQ11960 Xichmema brewioJIe isolate AH-031
52
flphwM brtYKQfli isolate BJ-Q/i AY601604 1 Xjphinema brtvtcolle isolate EU132 AY6016Ô2 1 Xiphm*ma tayVKi isolate EU117 1 Xiphmema breucofle isolate BV -AY601603 1 Xiphmema taylon isolate TNI
63
85
• AY6016O0 1 Xiphmema d.ffusum isolât« CAN 162
f
-AYS80057 1 Xiphmema brevKolle complete sequence
AY601601 1 Xiphmema breucolle isolate XB1 KP793055 1 Xiphmma brwcoOe rotate SZX1310 KP7930S4 1 Xiphmema brewcolle isolate S2X1309 KP793053 1 Xiphmema brewcolle isofcte S2X1308 KP793052 1 Xiphmema bfe-ucolle isolate S2X1307 KP793051 1 Xiphmema brewcotle isolate S2X1306
-JNÛ31972 t Xiphmema ameixanum group sp LZ-2011
-JÛ3S0042 1 Xiphmema parabreucolle voucher Xbnr
0 002
Fig. 9. Maximum Likelihood tree of Xiphinema brevicolle from China using D2-D3 expansion segment of 28S rDNA region. Bootstrap values are shown in branches.
Fig. 10. Maximum Likelihood analysis of aligned mtDNA sequences. The analysis involved COI sequence of Xiphinema americanum group reported by (Orlando et al., 2016) and closest X. brevicolle from Japan (Sakai et al., 2012). The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown above the branches.
Phylogenetically, based on COI sequence, X. brevicolle China was separated from other members of X. americanum-group populations. There was an apparent similarity of X. brevicolle China and X. brevicolle Japan clustered at 98% support. A range of 4.17-5.58% COI sequence divergence was noted between China and Japan populations. Taking into account the 10-20% COI divergence rule to determine conspecificity, the clade group comprising the majority of X. brevicolle populations from Asia can be assumed to be conspecific. However, the recently reported X. brevicolle by Orlando et al. (2016) from Russia clearly cluster in
a different branch as compared to X. brevicolle Asian isolates; this may be explained by the differences in fragment length amplified by the different primers used. Sakai et al. (2011) and the present study used forward and reverse primers COIF1-COIR1 and COIF-COIR, as used by He et al. (2005), where both primers can amplify >1 kb bp. The longer COI length of the Japan population (886 bp) and the China population (856 bp) compared to X. brevicolle Russia (KX263107-KX263106) having only 369 bp could be a possible reason for their distant phy logenetic separation. By contrast, COI variation of sub-clade X. diffusum is
estimated as 28.3-32.7%, so if we follow the 20% COI divergence approach of Blouin et al. (1998), then variation between X. brevicolle China and X. diffusum is above 20%, thus recognising the two as valid species. This is supported by Oliveira et al. (2005), who discriminated X. brevicolle and X. diffusum as separate species from two different groups, supporting the nomenclature of Lamberti et al. (1991).
In conclusion, justifications of X. brevicolle from Asia are still debatable; it remains a taxonomic issue whether X. brevicolle reported from China, Japan and Taiwan are conspecific to X. brevicolle type and topotype populations reported from different part of the world. Kumari et al. (2010) emphasised that the integrated approach, combining rDNA-based sequence and morphological data, is important to delimit species of X. americanum-group. The use of COI analysis also provides adequate information for species delineation (He et al., 2005; Lazarova et al., 2006; Kumari et al., 2010; Gutiérrez-Gutiérrez et al., 2011; Sakai et al., 2011;). Moreover, the use of COI gene sequences are useful references for future taxonomic analysis of complex nematode groups, and are essential for the study of co-speciation between nematode and their bacterial endosymbionts (Orlando et al., 2016).
ACKNOWLEDGEMENTS
This research was supported by the National Natural Science Foundation of China (project nos 31371921 and 31772137). The authors thank Dr Sergei Subbotin for reviewing the manuscript and H. Zhu, R. Cai and X. Li for helping with the sampling.
REFERENCES
Barsi, L. & Lamberti, F. 2002. Morphometrics of three putative species of the Xiphinema americanum group (Nematoda: Dorylaimida) from the territory of the former Yugoslavia. Nematologia Mediterranea 30: 5972.
Barsi, L. & Lamberti, F. 2004. Xiphinema parasimile sp. n. from Serbia and X. simile, first record from Bosnia and Herzegovina (Nematoda, Dorylaimida). Nematologia Mediterranea 32: 101-109. Blouin, M.S., Yowell, C.A., Courtney, C.H. & Dame, J.B. 1998. Substitution bias, rapid saturation, and the use of mtDNA for nematode systematics. Molecular Biology and Evolution 15: 1719-1727. Bridge, J., Hunt, D.J. & Hunt, P. 1996. Plant-parasitic nematodes of crops in Belize. Nematropica 26: 111119.
Brown, D.J.F. & Boag, B. 1988. An examination of methods used to extract virus-vector nematodes (Nematoda: Longidoridae and Trichodoridae) from soil samples. Nematologia Mediterranea 16: 93-99.
Brown, D.J.F. & Halbrendt, J.M. 1997. Identification of Xiphinema species. In: An Introduction to Virus-Vector Nematodes and their Associated Viruses (M.S.N.A. Santos, I.M.O. Abrantes, D.J.F. Brown & R.J.V.C.M. Lemos Eds). pp. 177-223. Coimbra, Portugal, Centro de Sistematica e Ecologia, Universidade de Coimbra.
Brown, D.J.F., Robertson, W.M. & Trudgill, D.L. 1995. Transmission of viruses by plant nematodes. Annual Review of Phytopathology 33: 223-249.
Chen, D.-Y., Ni, H.-F., Yen, J.-H., Cheng, Y.-H. & Tsay, T.-T. 2005. Differentiation of the Xiphinema americanum-group nematodes X. brevicollum, X. incognitum, X. diffusum and X. oxycaudatum in Taiwan by morphometrics and nuclear ribosomal DNA sequences. Nematology 7: 713-725.
Coomans, A. & Heyns, J. 1997. Three species of the Xiphinema americanum-group (Nematoda: Longidoridae) from Kenya. Nematologica 43: 259-274.
Coomans, A., Huys, R., Heys, J. & Luc, M. 2001. Character analysis, phylogeny and biogeography of the genus Xiphinema Cobb, 1913 (Nematoda: Longidoridae). Annales du Musée Royal de l'Afrique Centrale (Tervuren, Belgique) 287: 1-239.
Crozzoli, R., Lamberti, F., Greco, N. & Rivas, D. 1998. Plant-parasitic nematodes associated with citrus in Venezuela. Nematologia Mediterranea 26: 31-58.
De Ley, P., Felix, M.-A., Frisse, L.M., Nadler, S.A., Sternberg, P.W. & Thomas, W.K. 1999. Molecular and morphological characterisation of two reproductively isolated species with mirror-image anatomy (Nematoda: Cephalobidae). Nematology 1: 591-612.
Gutiérrez-Gutiérrez, C., Castillo, P., Cantalapiedra-Navarrete, C., Landa, B.B., Derycke, S. & Palomares-Rius, J.E. 2011. Genetic structure of Xiphinema pachtaicum and X. index populations based on mitochondrial DNA variation. Phytopathology 101: 1168-1175.
Gutiérrez-Gutiérrez, C., Cantalapiedra-Navarrete, C., Decraemer, W., Vovlas, N., Prior, T., Palomares-Rius, J.E. & Castillo, P. 2012. Phylogeny, diversity, and species delimitation in some species of Xiphinema americanum-group complex (Nematoda: Longidoridae), as inferred from nuclear and mitochondrial DNA sequences and morphology. European Journal of Plant Pathology 134: 561-597.
Halbrendt, J.M. & Brown, D.J.F. 1992. Morphometric evidence for three juvenile stages in some species of
Xiphinema americanum sensu lato. Journal of Nematology 24: 305-309.
Hasegawa, M., Kishino, H. & Yano, T. 1985. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22: 160-174.
He, Y., Jones, J., Armstrong, M., Lamberti, F. & Moens, M. 2005. The mitochondrial genome of Xiphinema americanum sensu stricto (Nematoda: Enoplea): considerable economization in the length and structural feature encoded genes. Journal of Molecular Evolution 61: 819-833.
Holterman, M., van der Wurff, A., van den Elsen, S., van Megen, H., Bongers, T., Holovachov, O., Bakker, J. & Helder, J. 2006. Phylum-wide analysis of ssu rDNA reveals deep phylogenetic relationships among nematodes and accelerated evolution towards crown clades. Molecular Biology and Evolution 23: 1792-1800.
Kumari, S., Decraemer, W. & De Luca, F. 2010. Molecular characterization of Xiphinema brevicollum (Nematoda: Longodoridae) from the Czech Republic. European Journal of Plant Pathology 128: 243-250.
Lamberti, F., Ciancio, A., Agostinelli, A. & Coiro, M.I. 1991. Relationship between Xiphinema brevicolle and X! diffusum with a redescription of X! brevicolle and descriptions of three new species of Xiphinema (Nematoda: Dorylaimida). Nematologia Mediterranea 19: 311-326.
Lazarova, S.S., Malloch, G., Oliveira, C.M.G., Hübschen, J. & Neilson, R. 2006. Ribosomal and mitochondrial DNA analyses of Xiphinema americanum-group populations. Journal of Nematology 38: 404-410.
Liskovâ, M. 1995. Faunistic and ecological notes on Xiphinema (Nematoda: Dorylaimida) in slovakia. Biologia (Bratislava) 50: 125-131.
Lordello, L.G.E. & Costa, C.P. 1961. A new nematode parasite of coffee roots in Brazil. Revista Brasileira de Biologia 21: 363-366.
Luc, M. & Doucet, M.E. 1990. La familia Longidoridae Thorne, 1935 (Nemata) en Argentina: 1. Distribucion. Revista de Ciencias Agropecuarias 7: 19-25.
Luc, M., Coomans, A., Loof, P.A.A. & Baujard, P. 1998. The Xiphinema americanum-group (Nematoda: Longidoridae): 2. Observations on Xiphinema brevicollum Lordello & da Costa, 1961 and comments on the group. Fundamental and Applied Nematology 21: 475-490.
Oliveira, C.M.G., Fenton, B., Malloch, G., Brown, D.J.F. & Neilson, R. 2005. Development of species-specific primers for the ectoparasitic nematode species Xiphinema brevicolle, X! diffusum, X. elongatum, X! ifacolum and X! longicaudatum
(Nematoda: Longidoridae) based on ribosomal DNA species. Annals of Applied Biology 146: 281-288.
Orlando, V., Chitambar, J.J., Dong, K., Chizhov, V.N., Mollov, D., Bert, W. & Subbotin, S.A. 2016. Molecular and morphological characterisation of Xiphinema americanum-group species (Nematoda: Dorylaimida) from California (USA) and other regions, and co-evolution of bacteria from the genus Candidatus Xiphinematobacter with nematodes. Nematology 18: 1015-1043.
Peneva, V. & Choleva, B. 1992. Nematodes of the family Longidoridae from forest nurseries in Bulgaria. II. The genus Xiphinema Cobb, 1913. Helminthology 32: 46-58.
Romanenko, N.D. 1981. [A finding of a new species of nematode Xiphinema paramonovi n. sp. (Nematoda, Longidoridae) from the territory of the Soviet Union]. In: Abstracts of the 1st Conference on Plant, Insect, Soil and Fresh-Water Nematodes. pp. 68-69. Tashkent, Uzbek SSR (in Russian).
Sakai, H., Takeda, A. & Mizukubo, T. 2011. First report of Xiphinema brevicolle Lordello et Costa, 1961 (Nematoda, Longidoridae) in Japan. Zookeys 135: 21-40.
Sakai, H., Takeda, A. & Mizukubo, T. 2012. Intra-specific variation of Xiphinema brevicolle Lordello et Costa, 1961 (Nematoda: Longidoridae) in Japan. Japanese Journal of Nematology 42: 1-7.
Shah, F.A., Bell, N.L. & Bulman, S.R. 2009. Morphological and molecular confirmation of Xiphinema brevicollum, a nematode from the virus-vectoring X. americanum group, from New Zealand. Australasian Plant Pathology 38: 500-504.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & KUMAR, S. 2011. MEGA 5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731-2739.
Taylor, C.E. & Brown, D.J.F. 1997. Nematode Vectors of Plant Viruses. UK, CAB International. 286 pp.
Thompson, J.D., Higgins, D.G. & Gibson, T.J. 1994. Clustal W: improving the sensitivity of progressive multiple sequence alignments through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 46734680.
Weischer, B. & Brown, D.J.F. 2000. An Introduction to Nematodes. General Nematology: a Student's Textbook. Bulgaria, Pensoft Publishers. 122 pp.
Xu, T.H., Fu, P. & Cheng, H.R. 1995. [A taxonomic study of species Xiphinema from seven provinces of China (Nematoda: Longidoridae)]. Journal of Nanjing Agricultural University - Nan Jin Nong Ye Da Xe Xue Bao 18: 37-42 (in Chinese).
Ye, W., Szalanski, A.L. & Robbins, R.T. 2004. Phylogenetic relationships and genetic variation in Longidorus and Xiphinema species (Nematoda: Longidoridae) using ITS1 sequence of nuclear ribosomal DNA. Journal of Nematology 36: 14-19.
Zhao, L. 2013. [Molecular characteristics of Xiphinema brevicollum based on the rDNA D2-D3 sequences]. Plant Quarantine - Zhi Wu Jian Yi 18: 1-5 (in Chinese).
E.M. Barsalote, Zh. Tian and J. Zheng. Внутривидовая изменчивость Xiphinema brevicolle Lordello & Costa, 1961 (Nematoda: Longidoridae) Китая.
Резюме. При изучении фауны лонгидорид в природных экосистемах Китая было выявлено восемь популяций Xiphinema brevicolle Lordello & Costa, 1961. Оценка морфометрических показателей самок не выявила серьезных различий между популяциями. Морфологические особенности были сходными в длине тела (1.8-2.2 мм), длине одонтостиля (89-92 мкм), ширине губного отдела (10-12 мкм), индексу c' (0.8-1.1) и положении вульвы (49-51%). Были получены последовательности 18S, 28S рДНК а также митохондриального гена цитохромоксидазы I (COI) для всех восьми популяций из различных местностей. Анализ филогенетических отношений рибосомальной последовательности 18S выявил 98% сходство с X brevicolle (Японияп), X. diffusum (Китай), X. taylori (Словакия), X. incognitum (Китай), X. lambertii и X. inequali (Чешская Республика). Последовательности 28S rDNA были идентичны X brevicolle (Япония и Бразилия) при 98% поддержке группы. Анализ гена COI у изученных популяций выявил различия на уровне 6.096.95% между изученными популяциями, что рассматривается как внутривидовая изменчивость. Таким образом, сделан вывод о принадлежности всех обнаруженных популяций к одному виду -X. brevicolle. Предпринятое изучение X. brevicolle морфологическими и молекулярными методами позволяет оценить таксономическую структуру этого вида в Азии.
