CC BY
0© 2016, Scienceline Publication
World's Veterinary Journal
World Vet J, 6(3): 101-109, September 25, 2016
Insight into the Virulence-Related Genes of Edwardsiella Tarda Isolated from Cultured Freshwater Fish in Egypt
Eman Moustafa Moustafa1*, Amira Alaa El-Dein Omar1 and Waleid Sobhy Abdo2
1 Department of Fish Diseases and Management, Faculty of Veterinary Medicine, Kafr El-Sheikh University, Kafr El-Sheikh Governorate, Postal code: 33516, Egypt
2 Department of Animal Pahology, Faculty of Veterinary Medicine, Kafr El-Sheikh University, Kafr El-Sheikh governorate, Postal code: 33516, Egypt
*Corresponding author's Email: emantarek2002@yahoo.com ABSTRACT
One of the most serious fish pathogens infecting both cultured and wild fish species was found to be Edwardsiella tarda which contains important virulence factors that enhance bacterial survival and pathogenesis in hosts. The present study aims to isolate, identify and characterize E. tarda in freshwater fishes in Kafr El-Sheikh governorate, Egypt using selective differential cultural medium (Rimler Shotts agar), morphological and biochemical tests (oxidase, catalase, methyl red, voges proskauer, indole, citrate utilization, gelatine hydrolysis, H2S production, oxidation-fermentation, nitrate reduction and sugar utilization tests). Pathogenesis of E. tarda was checked 1 y experimental infection to Oreochromis niloticus fish together with screening of the highly virulent three virulence genes (esrB, mukF and gadB). The obtained results revealed the presence of the three virulence genes in the selected strain of E. tarda which gave severe lesions in the experimentally infected Oreochromis niloticus. E. tarda strain having more than one virulence gene results in more severe lesions than strains having one or even no virulence genes.
Key words: Edwardsiella tarda, Virulence genes, Freshwater fish INTRODUCTION
Edwardsiella tarda (E. tarda) is a predominantly enteric pathogen of both fresh water and brackish water fishes (Plumb, 1994). It is mainly responsible for causing a serious systemic bacterial disease, the edwardsiellosis, having a worldwide distribution among variety of fish taxa (Austin and Austin 1999; Maiti et al., 2009). The bacterium is also a pathogen for wide range of hosts rather than fish namely, reptiles, birds and mammals including humans (Plumb, 1993 and Park and Oh, 2008). E. tarda is a Gram-negative bacterium that causes a systemic suppurative disease in fish and humans. Recently, the complete genome sequence of a highly virulent and multidrug resistant E. tarda strain isolated in China indicated that this microorganism harbor a number of virulence and toxin secretion system related genes that explain in some extent it capacity to survive within phagocytic cells and to infect a variety of hosts (Verjan et al., 2013).
E. tarda is widely distributed in aquatic environments (Pitlik et al., 1987 and Wyatt et al., 1979). It is one of the serious fish pathogens, infecting both cultured and wild fish species. Research on edwardsiellosis has revealed that E. tarda has been considered as a common guest of a high variety of animals including fish, reptiles, amphibians, chickens and other warm-blooded animals as humans (Castro et al., 2016), and contains important virulence factors that enhance bacterial survival and pathogenesis in hosts (Park et al., 2012). E. tarda is an intracellular, rod-shaped, Gram negative, non-capsulated, motile, facultative anaerobic bacterium that was first isolated from a pond-cultured eel (Hoshino, 1962).
The basis of pathogenicity depends on the number of virulence factors in E. tarda, including the ability to invade epithelial cells (Janda et al., 1991 and Ling et al., 2000), resist serum and phagocyte-mediated killing (Ainsworth and Chen, 1990 and Srinivasa et al., 2001), and production of toxins, such as, haemolysins and dermatotoxins for disseminating infection (Ullah and Arai, 1983 and Hirono et al., 1997). E. tarda virulence is believed to be a multifactorial process not yet completely understood. Several potential pathogenic properties have been suggested to contribute to the infection process of E. tarda, including secretion of degradative enzymes, adhesions, type III secretion system, type VI secretion system and the ability to survive and replicate in phagocytes. It has been established that the
101
ISSN 2322-4568
A
R
de - :
C 4
A U u £ g 22 C 0
O R G
HH
N A L
A R
T —
C L
E
pathogenic strains of E. tarda have virulence genes which might be absent in nonpathogenic strains (Rao et al., 2003 and Castro et al., 2016). Now, many virulence-related genes in E. tarda have been cloned or reported, which included catalase (katB), TTSS regulator (esrB), putative killing factor (mukF), Fimbrial operon (fimA), glutamate decarboxylase (gadB), Citrate lyaseligase (citC), pstS, pstC, type III secretion system (ssrB), astA, isor, ompS2, Hemolysine A (hlyA) and ATPase domain of DNA Gyrase (gyrB) (Rao et al., 2003; Rao et al., 2003; Rao et al., 2004; Tan et al., 2005; Choresca et al., 2011 and Abd El-Kader, 2015). Abd El-Kader, 2015 studied that the Nile Tilapia (Oreochromis niloticus) could be used as the animal model for studying the pathogenicity of E. tarda.
This study was carried out to isolate, identify and characterize E. tarda from freshwater fish in Kafr El-Sheikh governorate, Egypt, and using various culture media, morphological and biochemical tests. In the present study we screened the presence of three virulence-associated genes of E. tarda isolated from diseased cultured fishes.
MATERIALS AND METHODS
Ethical approval
Animal ethics committee, faculty of veterinary medicine, Kafr El-Sheikh University, Egypt, approved the protocol and conducting of the study.
Isolation and identification of E. tarda
A total number of 120 Oreochromuis niloticus fish were collected from Kafr El-Sheikh governorate farms over the seasons of the year 2015. The collected fish showed hemorrhagic patches on different parts of the body and eye exophthalmia externally. Internally, abundant ascetic fluid was found in the abdominal cavity and small white nodules were observed in liver, kidney, spleen and gills.
For bacteriological examination, swabs were collected from the infected parts of the fishes. The collected swabs were firstly pre-enriched on Tryptic Soy Broth (TSB, Oxoid). After which (pre-enrichment on TSB) they were streaked on Rimler Shotts agar (RS) for presumptive identification and incubated at 28 °C for 24 hours. Well-differentiated single bacterial colonies were further streaked onto Tryptic Soy Agar (TSA, Oxoid) for obtaining pure culture.
Biochemical analysis
For phenotypic identification, pure cultures were subjected to Gram staining and viewed microscopically. Further biochemical tests like motility, oxidase, catalase, methyl red, voges proskauer, indole, citrate utilization, gelatine hydrolysis, H2S production, Oxidation-fermentation, nitrate reduction and sugar utilization tests, were performed for the identification as well as strain differentiation of bacteria and results were compared with the reference strain of E. tarda (obtained from the food analysis center, faculty of veterinary center, Banha university, Egypt).
Molecular identification by PCR
DNA Extraction using QIA amp kit: Genomic DNA was extracted from every isolate of E. tarda using DNA extraction kit (QIAamp: Qiagen inc., USA). Isolated DNA samples were checked for purity and quantified in ND-1000. The samples were then resolved on agarose gel (0.8%) with 4 ^l of template DNA mixed with 1 ^l of loading dye (xylene cyanol + bromophenol blue) and electrophoresed at 120 volts for 70 min. DNA samples showing intact bands were used for Polymerase Chain Reaction (PCR) amplifications (Shah et al., 2009).
Primer sequences of E. tarda used for PCR identification system: Detection of the virulence factors of E. tarda
represented by esrB (TTSS regulator), mukF (putative killing factor) and gadB (glutamate decarboxylase) was carried out using the peimers which is introduced in Table 1.
DNA amplification of E. tarda: The amplification was performed on a thermal cycler (master cycler, eppendorf, Hamburg, Germany). The targeted genes of E. tarda isolates were esrB, mukF and gadB. To amplify the genes, 25 ^l of reaction mixture was made containing 20ng of template DNA, 20 pM of primers, 160 ^M of dNTP mix, 1.25 U Taq polymerase, 1 xTaq buffer, and 0.5 mM MgCl2. The three genes were amplified using the specific primers with 32 cycles of denaturation at 94°C for 1 min, annealing at 55°C, extension at 72°C for 1 min, and a final extension at 72°C for 10 min. PCR amplified products were analyzed by 1.5% of agarose gel (Sigma, USA), stained with ethidium bromide and visualized as well as captured on UV transilluminator, then compared with the marker DNA ladder (100 bp) (Wang et al., 2012).
102
Table 1. The primers used for the amplification of different virulence associated genes
Target gene Oligonucleotide sequence (5' ^ 3*) Product size (bp) Reference
esrB (F) 5' TCGTTGAAGATCATGCCTTGC '3 311
esrB (R) 5' TGCTGCGGGCTTTGCTT '3
mukF (F) mukF (R) 5' TTGCTGGCTATCGCTACCCT '3 5' AACTCATCGCCGCCCTCTTC '3 357 Wang et al. (2012)
gadB (F) 5' ATTTGGATTCCCGCTTTGGT '3 583
gadB (R) 5' GCACGACGCCGATGGTGTTC '3
Experimental infection
Total Bacterial count: Using the drop plate method for estimation of E. tarda strain per 1 ml, was used in demonstration of the inoculum dose for the experimental studies according to Cruickshank et al. (1975).
Lethal Dose 50: A total number of 70 apparently healthy Oreochromis niloticus fish weighting (50±0.5 gm), were divided into 7 groups, 10 fishes per each group and the seventh group was kept as a control group. All fishes were kept for 15 days under observation prior to injection for accommodation and to confirm that they are free from diseases.
24 hours colony culture of E. tarda strain on TSA was used, the colonies were picked up and suspended in sterile saline in a ten fold serial dilution with subsequent incubation at 28 °C for 24 hours for plate counts on TSA. Only the dilutions (102-107 cfu) were used. Each group was intraperitoneally injected with 0.5 ml/fish of each bacterial dilution. The fishes in the control group were injected with 0.5 ml PBS/fish (Phosphate Buffer Saline). All the injected fish were kept for 1 week post-inoculation for observation. The mortalities were recorded twice/ day according to Ibrahim et al. (2011). The freshly dead fishes were moved for further pm examination. The LD50 (the dose which kill 50% of the injected fish) was calculated according to Reed and Muench (1938).
Pathogenicity test: Experimental infection was carried out to determine the pathogenicity of E. tarda strain using intra-peritoneal route injection according to Ibrahim et al. (2011). A total number of 60 apparently healthy O. niloticus fishes weighting (50±0.5 gm), were divided into 3 groups; 20 fishes per each. Each fish in the first group was intraperitoneally injected with 0.2 ml/fish of LD50 dose E. tarda strain which was determined previously (1.8 x 105 cfu). Each fish in the second group (control negative group), was intraperitoneally injected with 0.2 ml/fish of PBS (Phosphate Buffer Saline). Each fish in the third group (Control positive group), was intraperitoneally injected with 0.2 ml/fish of obtained reference E. tarda strain. All injected fishes were observed for a period of 28 days post-inoculation. Mortalities were recorded daily and freshly dead fishes were moved for further pm examination and histopathological studies.
Histopathological examination
Specimens from liver, kidney and spleen of experimentally infected fishes were taken. Specimens were fixed immediately in 10% neutral buffered formalin, dehydrated and embedded in paraffin blocks. Paraffin blocks were sectioned at 4-5 ^m thickness and stained with Hematoxilin & Eosin (H&E) and examined under light microscope (Leica) using ><200 and ><400 magnification power according to Bancroft and Gamble (2007).
Table 2. Comparison of the phenotypic and biochemical characteristics between the isolated E. tarda strain and the reference strain
Biochemical tests Isolated E. tarda strain Reference strain
Motility test + +
Oxidase test - -
Catalase test + +
Gram staining - -
Indole test + +
Methyl red test + +
Voges proskaeur test - -
Citrate utilization test - +
Arginine dehydrolization test - -
Acid production from glucose + +
Acid production from fructose + +
Acid production from maltose + +
Acid production from lactose - -
Acid production from rhaminose - -
Acid production from sucrose - -
Acid production from mannitol - -
Lysine decarboxylase test + +
Ornithine decarboxylase test + +
H2S production + +
Lecithinase test - -
+ = positive reaction, - = negative reaction
103
RESULTS AND DISCUSSION
E. tarda, the causative agent of Edwardsiellosis, is a serious systemic disease of both cultured and wild fishes, has been recognized as one of the most dangerous pathogens causing high economical losses among aquaculture industries worldwide with expanded host range (Hou et al., 2009 and Park et al., 2012) including humans (Xie et al., 2014).
External examination of naturally infected Oreochromis niloticus revealed hemorrhagic patches on different parts on the body, eye exophthalmia (Figure 1 and Figure 2) and cutaneous ulcers (Figure 3). The gross lesions displayed in the current study are similar to those reported by several authors (Han et al., 2006; Padros et al., 2006; Shabaan, 2007 and Ibrahim et al., 2011).
However, the postmortem findings exhibited the presence of abundant ascetic fluid in the abdominal cavity together with the enlarged congested gall bladder, liver, kidney and spleen (Figure 4). The postmortem findings displayed in the present study are similar to those reported by Shabaan (2007) and Carlos et al. (2012). The current postmortem findings may be due to the action of bacterial toxins. E. tarda secretes Haemolysin and Dermotoxins, Exotoxins Extracellular Products (ECP) and Endotoxin Intracellular Components (ICC) (Suprapto et al., 1995; Hirono et al., 1997 and Mathew et al., 2001). However, liver and kidney congestion might be due to hepatic and nephric virulence factors of E. tarda (Miwa and Mana, 2000 and Mathew et al., 2001).
Figure 1. Oreochromis niloticus, collected from Figure 2. Oreochromis niloticus, collected from
Kafr El-Sheikh farm, Egypt in summer, naturally infected Kafr El-Sheikh farm, Egypt in autumn, naturally infected
with E. tarda showing hemorrhagic patches (arrow) with E. tarda showing exophthalmia (arrow) on different parts of the body
Figure 3. Oreochromis niloticus, collected from Figure 4. Oreochromis niloticus, collected from
Kafr El-Sheikh farm, Egypt in summer, naturally infected Kafr El-Sheikh farm, Egypt in autumn, naturally infected
with E. tarda showing cutaneous ulcers on the body with E. tarda showing enlarged and congested spleen (arrow (arrow)
104
The presumptive identification of the bacteria in the recent study was carried out from colony morphology over Rimler Shotts (RS) medium which acts as a selective medium for E. tarda (Buller, 2004; Das et al., 2014 and Achrya et al., 2007). They showed typical greenish colonies with black center over RS plates. Microscopically, the bacteria were observed as Gram negative short rod shaped organism. Biochemical characterizations have proven to be a valuable method for typing and differentiation of bacterial fish pathogens (Tison et al., 1982 and Austin et al., 1997). In the present study, based on 20 biochemical tests, a total number of thirty isolates were positively identified as E. tarda. All strains were positive for motility, catalase, indole, methyl red, production of gas and acids from glucose, fructose, maltose, H2S production on TSI agar and lysine and ornithine decarboxylation. But, showed negative results for oxidase, voges proskauer, arginine dehydroxylation production of acid from lactose, rhamnose, sucrose and mannitol. All the obtained biochemical results were compared with the reference strain (Table 1). Most of the phenotypic characteristics of the isolates were similar as reported in Bergey's manual of determinative bacteriology (Holt et al., 1994). Based on the biochemical tests results, all obtained isolates were similar to E. tarda reference strain. However, a low degree of heterogeneity was observed in citrate utilization test. All biochemical obtained results were similar to findings of Amandi et al., (1982); Wei and Musa (2008) and Kumari (2011). However, negative results to citrate utilization test was similar to Coles et al. 1978) and Baya et al. (1997).
Pathogenic bacteria may have virulence genes that are absent in non-pathogenic bacteria, making them virulent. Virulence genes may also be present in both pathogenic and non-pathogenic bacteria but may be functional only in pathogenic ones (Rao et al., 2003; Wang et al., 2012 and Castro et al., 2016). One of E. tarda positive strains was screened for the presence of three virulence genes (TTSS regulator (esrB), putative killing factor (mukF) and glutamate decarboxylase (gadB) by PCR technique. The results revealed that the selected strain had the three screened virulence genes (esrB, mukF and gadB) (Figure 5). It has been reported that the three virulence genes (esrB, mukF and gadB) obtained in the current study were specific to pathogenic E. tarda (Rao et al., 2003; Choresca et al., 2011 and Wang et al., 2012). These genes can therefore be used as biomarkers to perform diagnosis of pathogenic E. tarda.
The median lethal dose fifty (LD50) experiments in the present study revealed that the concentration 105 cfu was the most potent dilution causing 50% mortalities within (24-48 hr). This result is similar to Shaaban (2007) but, disagrees with Ibrahim et al. (2011) who obtained LD50 at concentration of 104 cfu. The differences in LD50 between different authors may be due to the number of the virulent genes in E. tarda strain, pathogen properties as well as size, weight of fish species and temperature difference (Amandi, 1982 and Ibrahim et al., 2011).
The (gadB) recorded in the current study, provides resistance to bacteria towards phagocytes-mediated killing inside the host. The gad system neutralizes acidity and enhances the survival under extreme acid conditions, the glutamate-dependant acid resistance system requires the glutamate decarboxylase gene for protection under acidic condition. Mutation in gadB gene of E. tarda resulted in attenuation of the mutant in vivo and acid sensitivity in vitro indicating that the mutant was unable to survive and cause infection inside the host (Srinivasa Rao et al., 2003). Bacteria fight against serum and phagocyte-mediated killing by gadB.
M 1 2 3
Figure 5. Agarose gel electrophoresis of multiplex PCR of esrB (311 bp), mukF (357 bp) and gadB (583 bp).virulence genes for characterization of Edwardsiella tarda
Lane M: 100 bp ladder as molecular size DNA marker; Lane 1: Control positive of E. tarda for esrB, mukF and gadB genes; Lane 2: Control negative; Lane 3: Positive E. tarda strain for esrB, mukF and gadB genes.
105
The clinical signs of experimentally infected O. niloticus with current E. tarda strain revealed that fishes were lethargy showing abnormal swimming behavior, loss of escape and defensive reflexes, floating near water surface with gasping atmospheric air followed by fish death with opened mouth. This might be due to stress response and/or development of anaemia leading to insufficient oxygen supplements inside tissues and compensatory increased respiration as a result (Meyer and Bullock, 1973; Walters and Plumb, 1980; Miyazaki and Kaige, 1985; Mohanty and Sahoo, 2007 and Vasquez-Pineros et al., 2010). The Pathogenesis of edwardsiellosis is complex and associated with multiple virulence factors that might be encoded in the chromosome or in conjugative plasmids (Wang et al., 2009). The recorded mortalities of the experimentally infected fishes may be attributed to the presence of more than one virulent gene in the same strain as well as the synergistic effects conferred by combination of several virulence genes including gadB (Shen and Chen, 2005). Besides, the esrB and mukF play an important role in virulence of E. tarda (Rao et al., 2003; Rao et al., 2004 and Zheng et al., 2005), that appear to confer survival and replication within macrophages (Okuda et al., 2009) or causes pore formation in the host cell membrane (Tan et al., 2005).
Figure 6. Posterior Kidney of Oreochromis niloticus infected with Edwardsiella tarda showing interstitial nephritis represented by marked leukocytic infiltration (White arrow) and degenerative tubules (Black arrow), H&E, bar=100^m, x200
f *
-
B f
À
Wr fet
JK__•
A
09
4 mBP
M
«T;
'f m "1
m .
v41 -
W3
rte * é
*
Y'> -r ■
25 f#i rm
iT
/2 1
tf /•J
1 »îrv^ • J V , *L C. • /T •''vv ALrV» v*
- î 4 *
i, V ™ ^ A£4 _ ra -- « . _ i f ^
a J' i^T *
4R ,
te ^ » rr>,
• <
Figure 7. Posterior Kidney of Oreochromis niloticus infected with Edwardsiella tarda showing leukocytic infiltration consistent mainly from macrophages-laden bacteria (Black arrow), H&E, bar=50^m, ><400
106
The histopathological findings in the experimentally infected Oreochromis niloticus in the present study were obviously seen in the kidney. The kidney showed multifocal interstitial nephritis accompanied with infiltration of mononuclear inflammatory cells and macrophages-laden bacteria (Figure 6 and figure 7). While the liver showed also multifocal necrotic areas associated with inflammatory cells infiltration. These findings were nearly similar to those reported by Darwish et al., 2000; Miwa and Mana, 2000; Shabaan, 2007 and Ibrahim et al., 2011. The findings of histopathological changes could be attributed to the potential virulence factors of E. tarda as cell adhesion factors, cell invasion activity, hemolysin, cytotoxin and enterotoxin which might induce the necrosis and degenerative changes in most organs as well as the hepatic and nephric virulence factors (Chen et al., 1996; Miwa and Mana, 2000 and Mathew et al., 2001).
CONCLUSION
E. tarda is a gram negative, rod-shaped, motile bacterium that exhibits a broad geographical distribution and host range, causing significant economic losses to the aquaculture industry. The results of the present work, the three tested virulence genes were correlated with E. tarda pathogenicity. The more the number of virulence genes the more the pathogenecity of E. tarda. This could be of importance in formulating novel therapeutics and in vaccine development to protect fish against systemic edwardsiella infection.
Acknowledgements
All authors are highly thankful to Prof. Dr. Mohamed Sayed Mohamed Marzouk, Professor of Fish Diseases and Management, Cairo University, Egypt for his valuable help and effort in writing and revising this manuscript.
Competing interests
Authors have declared that there is no competing interest. REFERENCES
Abd El-Kader MF (2015). Edwardsiellosis in Cultured Freshwater Fish at Kafr El-Sheikh Governorate. PhD thesis. Faculty of Veterinary Medicine, Kafr El-Sheikh University. Fish Diseases and Management Department.
Acharya M, Maiti NK, Mohanty S, Mishra P and Samanta M (2007). Genotyping of Edwardsiella tarda isolated from freshwater fish culture system. Comparative Immunology, Microbiology and Infectious Diseases, 30(1): 33-40.
Ainsworth AJ and Chen DX (1990). Difference in the Phagocytosis of Four Bacteria by Channel catfish Neutrophils. Developmental and Comparative Immunology, 14: 201-209.
Amandi A, Hiu SF, Rohovec JS and fryer JL (1982). Isolation and Characterization of Edwardsiella tarda from fall Chinook salmon (Oncorhynchus tshawytscha). Applied and Environmental Microbiology, 43(6):1380-1384.
Austin B and Austin DA (1999). Characteristic of the diseases. In: Bacterial Fish Pathogen: Diseases of Farmed and Wild Fish, 3rd Edition. Springer-Praxis Publishing, Chichester, pp. 81 85.
Austin B, Alsina M, Austin DS, Blanch AR, Grimont F and Grimont PAD (1997). A comparison of methods for the typing of fishpathogenic Vibrio spp. Systematic and Applied Microbiology: 20(1): 89-101.
Bancroft JD and Gamble M (2007). Theory and Practice of Histological Techniques. 5th edition; Churchill Livingstone, London, UK., pp. 125-138.
Baya AM, Romalde JL, Green DE, Navarro RB, Evans J, May EB and Toranzo AE (1997). Edwardsiellosis in wild striped bass from the Chesapeake Bay. Journal of Wildlife Diseases: 33(3): 517-525.
Buller BN (2004). Bacteria from Fish and Other Aquatic Animals: A Practical Identification manual, CABI publication, Oxford, UK. Pp. 83-116.
Carlos AI, Marlly G, Victor MT and Hugh WF (2012). Novel Brain Lesions caused by Edwardsiella tarda in a red tilapia (Oreochromis spp). Journal of Veterinary Diagnostic Investigations, 24(2): 446-449.
Castro N, Osorio CR, Bujan N, Fuentes JC, Rodriguez J, Romero M, Jimenez C, Toranzo AE and Magarinos B (2016). Insights into the virulence-related genes of Edwardsiella tarda isolated from turbot in Europe: genetic homogeneity and evidence for vibrioferrin production. Journal of Fish Diseases, 39: 565-576.
Chen JD, Lai SY and Huang SL (1996). Molecular cloning, characterization, and sequencing of the hemolysin gene from Edwardsiella tarda. Archieves of Microbiology, 165: 9-17.
Choresca JCH, Gomez DK, Shin SP, Kim JH, Han JE, Jun JW and Park SC (2011). Molecular detection of Edwardsiella tarda with gyrB gene isolated from pirarucu, Arapaima gigas which is exhibited in an indoor private commercial aquarium. African Journal of Biotechnolog, 10(5): 848-850.
Coles BM, Stroud RK and Sheggeby S (1978). Isolation of Edwardsiella tarda from three Oregon sea mammals. Journal of Wildlife Diseases, 14(3): 339-341.
Cruickshank R, Duguid JP, Marmion BP and Swain RH (1975). Medical Microbiology. The practical of Microbiology. Chucohill Livingstone 12th edition. (11), Edinburgh, London and New York.
107
Darwish A, Plumb JA and Newton JC (2000). Histopathology and pathogenesis of experimental infection with Edwardsiella tarda in channel catfish. Journal of Aquatic Animal Health, 12:255-266.
Das BK, Sahu I, Kumari S, Sadique M and Nayak KK (2014). Phenotypic and Whole Cell Protein Profiling of Edwardsiella tarda strains Isolated from Freshwater fishes. International Journal of Current Microbiology and Applied Sciences, 3(1):235-247.
Han HJ, Kim DH, Lee DC, Kim SM and Park SI (2006). Pathogenecity of Edwardsiella tarda to olive flounder, Paralichthys olivaceus (Temminck & Schlegel). Journal of Fish Diseases, 29 (10): 601-609.
Hirono I, Tange N and Aoki T (1997). Iron-regulated haemolysin gene from Edwardsiella tarda. Molecular Microbiology, 24(4): 851 856.
Holt JG, Krieg NR, Sneath PHA, Staley JT and Williams ST (1994). Family Enterobacteriaceae; in Bergeys manual of determinative bacteriology (editors), J. G. Holt (Baltimore: Williams & Wilkins). Pp. 175-194.
Hoshina T (1962). On a new bacterium, Paracolobactrum anguillimortiferum. Bulletin of Japaneese Social Science of Fisheries, 28(2): 162-164.
Hou JH, Zhang WW and Sun L (2009). Immunoprotective analysis of two Edwardsiella tarda antigens. Journal of General and Applied Microbiology, 55:57-61.
Ibrahim MD, Shahed IB, Abo El-Yazeed H and Korani H. (2011). Assessment of the susceptibility of poly culture reared African catfish and Nile Tilapia to Edwardsiella tarda. Journal of American Sciences, 7(3):779-786.
Janda JM, Abott SL, Kroske-Bystrom S, Cheung WKW, Powers C, Kokka RP and Tamura K (1991). Pathogenic properties of Edwardsiella species. Journal of Clinical Microbiology, 29: 1997-2001.
Kumari S (2011). Strain Differentiation and Virulence Study of Edwardsiella tarda. M.Sc. Thesis. Sikha OAnusandhan University, Bhubaneswar. Laemmli, U.K. 1970.Cleavage of structural proteins during the assembly of the head of bacteriophage T4.Nature, 227(5259): 680 685.
Ling SHM, Wang XH, Xie L, Lim TM and Leung KY (2000). Use of green fluorescent protein (GFP) to track the invasive pathways of Edwardsiella tarda in the in vivo and in vitro fish models. Microbe, 146: 7-19.
Maiti NK, Mandal A, Mohanty S and Mandal RN (2009). Phenotypic and genetic characterization of Edwardsiella tarda isolated from pond sediments. Comparative Immunology, Microbiology and Infectious Diseases, 32(1): 1-8.
Mathew JA, Tan YP, Srinivasa Rao PS, Lim TM and Leung KY (2001). Edwardsiella tarda mutants defective in siderophore production, motility, serum resistance and catalase activity. Microbiology, 147:449-457.
Meyer FP and Bullock GL (1973). Edwardsiella tarda, a new pathogen of channel catfish (Ictalurus punctatus). Applied Microbiology, 25(1):155-156.
Miwa S and Mana N (2000). Infection with Edwardsiella tarda causes hypertrophy of liver cell in the Japaneese flounder Paralichthys olivaceus. Diseases of Aquatic Organism, 28, 42(3). 227-231.
Miyazaki T and Kaige N (1985). Comparative histopathology of edwardsiellosis in fishes. Fish Pathology, 20:219-227.
Mohanty BR and Sahoo PK (2007). Edwardsiellosis in fish: a brief review. Journal of Biosciences, 32(7):1331-1344.
Okuda J, Kiriyama M, Suzuki E, Kataoke K, Nishibuchi M and Nakai T (2009). Characterization of proteins secreted from a type III secretion system of Edwardsiella tarda and their roles in macrophage infection. Diseases of Aquatic Organism, 84(2):115-121.
Padros F, Zarza C, Dopazo L, Cuadrado M and Crespo S (2006). Pathology of Edwardsiella tarda infection in turbot, Scophthalmus maximus (L.). Journal of Fish Diseases, 29(2): 87 94.
Park SW and Oh MJ (2008). Aquatic Life Diseases. Bioscience. Seoul, Korea, pp. 153-158.
Park SB, Aoki T and Jung TS (2012). Pathogenesis of and strategies for preventing Edwardsiella tarda infection in fish. Journal of Veterinary Research, 43(1):67.
Pitlik S, Berger SA and Huminer D (1987). Nonenteric infections acquired through contact with water. Reviews of Infectious Diseases: 9(1): 54-63.
Plumb JA (1993). Edwardsiella septicemia. In: Bacterial Diseases of Fish (editors)English V., Roberts R.J. and N.R.Bromage., Cambridge University Press, Cambridge. Pp. 61 79.
Plumb JA (1994). Health maintenance of cultured fishes: Principal microbial diseases. Boca Raton: CRC Press. Pp.231238.
Rao PSS, Lim TM and Leung KY (2003). Functional Genomics Approach to the Identification of Virulence Genes Involved in Edwardsiella tarda Pathogenesis. Infection and Immunity, 71(3):1343-1351.
Rao PSS, Yamada Y and Leung KY (2003). A major Catalase (KatB) that is required for Resistance to H2O2 and Phagocyte-mediated Killing in Edwardsiella tarda. Microbiology, 149: 2635-2644.
Rao PSS, Yamada Y, Tan YP and Leung KY (2004). Use of proteomics to identify novel virulence determinants that are
required for Edwardsiella tarda pathogenesis. Molecular Microbiology, 53 (2): 573-586.
108
Reed L and Muench H (1938). A simple method of estimating fifty percent end points. American Journal of Tropical medicine and Hygiene, 27: 493-497.
Shaaban MSE (2007). Studies on Edwardsiella bacteria in fish. MVSc thesis. Faculty of Veterinary Medicine, Kafr El-Sheikh University. (Bacteriology, Mycology and Immunology Department)
Shah D, Shiringi S, Besser T and Call D (2009). Molecular detection of food borne pathogens, Boca Raton: CRC Press, In Liu. (edition) Taylor & Francis group, Florida, USA., Pp. 369-389.
Shen YR and Chen JD (2005). Expresion of virulent genes of Edwardsiella tarda correlated with mortality of diseases-fish infection. Journal of the Fisheries Society of Taiwan, 32:80-81.
Srinivasa RPS, Lim TM and Leung KY (2001). Opsonized virulent Edwardsiella tarda strains are able to adhere to and survive and replicate within fish phagocytes but fail to stimulate reactive oxygen intermediates. Infection and Immunity, 69: 5689-5697.
Srinivasa Rao PS, Lim TM and Leung KY (2003). Functional genomics approach to the identification of virulence genes involved in Edwardsiella tarda pathogenesis. Infection and Immunity, 71:1343-1351.
Suprapto H, Nakai T and Muroga K (1995). Toxicity of extracellular products and intracellular components of Edwardsiella tarda in the Japaneese eel and flounder. Journal of Aquatic Animal Health, 7: 292-297.
Tan YP, Zheng J, Tung SL, Rosenshine I and Leung KY (2005). Role of type III secretion in Edwardsiella tarda virulence. Microbiology, 7: 2301-2313.
Tison DL, Nishibuchi M, Greenwood JD and Seidler RL (1982). Vibrio vulnificus biogroup 2: new biogroup pathogenic for eels. Applied Environmental Microbiology, 44(3): 640 646.
Ullah MA and Arai T (1983). Pathological activities of the naturally occurring strains of Edwardsiella tarda. Fish pathology, 18: 65-70.
Vasquez-Pineros MA, Rondon-Barragan IS, Restrepo-Batancur LF and Eslava-Moncha PR (2010). Clinical and Hematological study of experimental infection of Aeromonas hydrophila and Edwardsiella tarda on Tilapia Oreochromis spp. Orinoco Meta., 14(1): online version ISSN: 0121-3709.
Verjan N, Iregui C and Hirono I (2013). Adhesion and invasion-related genes of Edwardsiella tarda ETSJ54 Genes relacionados con la adhesion e invasion de Edwardsiella tarda ETSJ54. Revista Colombiana de Ciencia Animal, Vol. 6, No. 1. Pp. 26-35.
Walters GR and Plumb JA (1980). Environmental stress and bacterial infection in channel catfish, Ictalurus punctatus Rafiesque. Journal of Fish Biology, 17:177-185.
Wang K, Liu E, Song S, Wang X, Zhu Y, Ye J and Zhang H (2012). Characterization of Edwardsiella tarda rpoN: roles in family regulation, growth, stress adaptation and virulence toward fish. Archieves of Microbiology, 194(6):493-504.
Wei LS and Musa N (2008). Phenotyping, Genotyping and Whole Cell Protein Profiling of Edwardsiella tarda Isolated from Cultured and Natural Habitat Freshwater Fish. American- Eurasian Journal of Agricultural and Environmental Sciences, 3(5): 681-691.
Wyatt LE, Nickelson R and Vanderzabt C (1979). Edwardsiella tarda in freshwater catfish and their environment. Applied and Environmental Microbiology, 38(4): 710-714.
Xie HX, Lu JF, Rolhion N, Holden DW, Nie P, Zhou Y and Yu XJ (2014). Edwardsiella tarda induced cytotoxicity depends on its type III secretion system and flagellin. Infection and Immunity, 82(8): 3436-3445.
Zheng J, Tung SL and Leung KY (2005). Regulation of a type III and a putative secretion system in Edwardsiella tarda by EsrC is under the control of a two-component system, EsrA-EsrB. Infection and Immunity, 73:4127-4137.
109
