Научная статья на тему 'Индуктор регенерации тетрадекапептид (TEKKRRETvEREKE) активирует MAPK-киназный сигнальный путь в NIH/3T3 фибробластах'

Индуктор регенерации тетрадекапептид (TEKKRRETvEREKE) активирует MAPK-киназный сигнальный путь в NIH/3T3 фибробластах Текст научной статьи по специальности «Биология»

CC BY
7
1
Поделиться
Журнал
Иммунология
Scopus
ВАК
CAS
RSCI
Область наук
Ключевые слова
ФИБРОБЛАСТЫ / FIBROBLASTS / TGF-β1 / ГЕПОН / SMAD2 / ERK1/2 / ЯДЕРНАЯ ТРАНСЛОКАЦИЯ ERK / ERK1/2 NUCLEAR TRANSLOCATION / SYNTHETIC TETRADECAPEPTIDE / WOUND-HEALING DRUG / ERK1/2 PHOSPHORYLATION / GENE TRANSCRIPTION

Аннотация научной статьи по биологии, автор научной работы — Чулкина М.М., Лебедева Е.С., Пичугин А.В., Холмухамедов Э.Л., Атауллаханов Равшан Иноятович

Ранее мы сообщали, что индуктор заживления эрозий, язв и ран тетрадекапептид TEKKRRETVEREKE (иммуномодулирующий препарат Гепон) вызывает дифференцировку фибробластов в миофибробласты, а также увеличивает подвижность клеток в модели повреждения монослоя [1]. В данной работе мы сравнили сигнальные события в фибробластах линии NIH/3T3 при их активации тетрадекапептидом и естественным стимулятором фибробластов TGF-β1. В клетках линии NIH/3T3 мы исследовании активацию канонического (SMAD) и неканонического (МАРК) сигнальных путей, а также изменение транскрипции генов α-sma, col1α1, tgf-β1, связанных с дифференцировкой фибробластов. Показано, что тетрадекапептид так же, как цитокин TGF-β1, активирует транскрипцию генов α-sma и col1α1. В отличие от TGF-β1, тетрадекапептид не индуцировал транскрипцию мРНК гена tgf-β1. TGF-β1 индуцировал в NIH/3T3 фибробластах фосфорилирование транскрипционного фактора SMAD2. Напротив, тетрадекапептид TEKKRRETVEREKE не активировал канонический сигнальный путь, фосфорилирования SMAD2 не происходило. Оба активатора фибробластов TGF-β1 и тетрадекапептид индуцировали сильную и быструю активацию неканонического МАРК-киназного сигнального пути, что проявлялось в фосфорилировании ERK1/2 киназы в первые минуты и последующей её транслокации в ядро. Таким образом, индуктор заживления эрозий, язв и ран тетрадекапептид TEKKRRETVEREKE активирует фибробласты иначе, нежели цитокин TGF-β1. Оба индуктора активируют MAPK-киназный сигнальный путь и транскрипцию генов α-sma и col1α1, но только TGF-β1 активирует канонический SMAD-сигнальный путь и транскрипцию гена tgf-β1.

Похожие темы научных работ по биологии , автор научной работы — Чулкина М.М., Лебедева Е.С., Пичугин А.В., Холмухамедов Э.Л., Атауллаханов Равшан Иноятович,

REGENERATION-INDUCING TETRADECAPEPTIDE TEKKRRETVEREKE ACTIVATES MAPK-KINASE SIGNALING IN NIH/3T3 FIBROBLASTS

We previously reported that the erosion, ulcer and wound healing tetradecapeptide TEKKRRETVEREKE (immunomodulatory preparation «Gepon») induces the fibroblast-tomyofibroblast differentiation and also enhances cell motility in the scratch-test [1]. In this study we compared intracellular signaling events in NIH/3T3 fibroblasts after their activation with TEKKRRETVEREKE tetradecapeptide or TGF-β1 cytokine, a natural fibroblast-activating compound. Activation of the canonical (SMAD) and non-canonical (MAPK) signaling pathways was measured. Also transcription levels for α-sma, col1α1 and tgf-β1 genes associated with a differentiation of fibroblasts were estimated. It was shown that the tetradecapeptide activates a transcription of α-sma and col1α1 genes in a manner similar to that of TGF-β1. In opposite to TGF-β1, the tetradecapeptide TEKKRRETVEREKE did not induce a transcription of tgf-β1 gene. TGF-β1 induced SMAD2-phosphorylation in NIH/3T3 fibroblasts, while the tetradecapeptide did not. In few minutes after application to NIH/3T3 cell cultures, both TGF-β1 and tetradecapeptide TEKKRRETVEREKE strongly activated the non-canonical MAPK-pathway with a prominent activation of ERK1/2-phosphorylation and its translocation into cell nucleus. Thus, a wound healing tetradecapeptide TEKKRRETVEREKE and TGF-β1 cytokine differently activate fibroblasts. Both compounds induce activation of the MAPK-kinase signaling pathway and also α-sma and col1α1 genes transcription, but only TGF-β1 activates canonical SMAD-signaling pathway and transcription of tgf-β1 gene.

Текст научной работы на тему «Индуктор регенерации тетрадекапептид (TEKKRRETvEREKE) активирует MAPK-киназный сигнальный путь в NIH/3T3 фибробластах»

ОРИГИНАЛЬНЫЕ СТАТЬИ

МОЛЕКУЛЯРНАЯ ИММУНОЛОГИЯ И ИММУНОГЕНЕТИКА

© КОЛЛЕКТИВ АВТОРОВ, 2017 УДК 615.275.4.011

Чулкина М.М.1, Лебедева Е.С.1, Пичугин А.В.1, Холмухамедов Э.Л.2, Атауллаханов Р.И.1

ИНДУКТОР РЕГЕНЕРАЦИИ ТЕТРАДЕКАПЕПТИД (TEKKRRETVEREKE) АКТИВИРУЕТ МАРК-КИНАЗНЫЙ СИГНАЛЬНЫЙ ПУТЬ В NIH/3T3 ФИБРОБЛАСТАХ

1 Государственный научный центр «Институт иммунологии» Федерального медико-биологического агентства, 115478, Москва, Россия;

2 Институт теоретической и экспериментальной биофизики РАН, 142290, Пущино, Россия

Ранее мы сообщали, что индуктор заживления эрозий, язв и ран тетрадекапептид TEKKRRETVEREKE (иммуномо-дулирующий препарат Гепон) вызывает дифференцировку фибробластов в миофибробласты, а также увеличивает подвижность клеток в модели повреждения монослоя [1]. В данной работе мы сравнили сигнальные события в фибробластах линии NIH/3T3 при их активации тетрадекапептидом и естественным стимулятором фибробластов TGF-pi. В клетках линии NIH/зТз мы исследовании активацию канонического (SMAD) и неканонического (МАРК) сигнальных путей, а также изменение транскрипции генов a-sma, collal, tgf-/31, связанных с дифференциров-кой фибробластов. Показано, что тетрадекапептид так же, как цитокин TGF-pi, активирует транскрипцию генов a-sma и collal. В отличие от TGF-pi, тетрадекапептид не индуцировал транскрипцию мРНК гена tgf-fil. TGF-pi индуцировал в NIH/3T3 фибробластах фосфорилирование транскрипционного фактора SMAD2. Напротив, тетрадекапептид TEKKRRETVEREKE не активировал канонический сигнальный путь, фосфорилирования SMAD2 не происходило. Оба активатора фибробластов — TGF-pi и тетрадекапептид — индуцировали сильную и быструю активацию неканонического МАРК-киназного сигнального пути, что проявлялось в фосфорилировании ERKi/2 ки-назы в первые минуты и последующей её транслокации в ядро. Таким образом, индуктор заживления эрозий, язв и ран тетрадекапептид TEKKRRETVEREKE активирует фибробласты иначе, нежели цитокин TGF-pi. Оба индуктора активируют MAPK-киназный сигнальный путь и транскрипцию генов a-sma и collal, но только TGF-pi активирует канонический SMAD-сигнальный путь и транскрипцию гена tgf-/31.

Ключевые слова: фибробласты; TGF-^1; Гепон; SMAD2; ERK1/2; ядерная транслокация ERK.

Для цитирования: Чулкина М.М., Лебедева Е.С., Пичугин А.В., Холмухамедов Э.Л., Атауллаханов Р.И. Индуктор регенерации тетрадекапептид (TEKKRRETVEREKE) активирует MAPK-киназный сигнальный путь в NIH/3T3 фибробластах. Иммунология. 2017; 38(4): 172-179. DOI: http://dx.doi.org/10.18821/0206-4952-2017-38-4-172-179

Chulkina M.M.1, Lebedeva E.S.1, Pichugin A.V.1, Holmuhamedov E.L.2, Ataullakhanov R.I.1 REGENERATION-INDUCING TETRADECAPEPTIDE TEKKRRETVEREKE ACTIVATES MAPK-KINASE SIGNALING IN NIH/3T3 FIBROBLASTS

1 FRC Institute of Immunology, FMBA, Russia

2 Institute of Theoretical and Experimental Biophysics, Russian Academy of Sciences, Pushchino, Russia

We previously reported that the erosion, ulcer and wound healing tetradecapeptide TEKKRRETVEREKE (immunomodulatory preparation «Gepon») induces the fibroblast-to- myofibroblast differentiation and also enhances cell motility in the scratch-test [i]. In this study we compared intracellular signaling events in NIH/3T3 fibroblasts after their activation with TEKKRRETVEREKE tetradecapeptide or TGF-pi cytokine, a natural fibroblast-activating compound. Activation of the canonical (SMAD) and non-canonical (MAPK) signaling pathways was measured. Also transcription levels for a-sma, coliai and tgf-pi genes associated with a differentiation of fibroblasts were estimated. It was shown that the tetradecapeptide activates a transcription of a-sma and coliai genes in a manner similar to that of TGF-pi. In opposite to TGF-pi, the tetradecapeptide TEKKRRETVEREKE did not induce a transcription of tgf-pi gene. TGF-pi induced SMAD2-phosphorylation in NIH/3T3 fibroblasts, while the tetradecapeptide did not. In few minutes after application to NIH/3T3 cell cultures, both TGF-pi and tetradecapeptide TEKKRRETVEREKE strongly activated the non-canonical MAPK-pathway with a prominent activation of ERKi/2-phosphorylation and its translocation into cell nucleus.

Thus, a wound healing tetradecapeptide TEKKRRETVEREKE and TGF-pi cytokine differently activate fibroblasts. Both compounds induce activation of the MAPK-kinase signaling pathway and also a-sma and coliai genes transcription, but only TGF-pi activates canonical SMAD-signaling pathway and transcription of tgf-pi gene.

Keyword: fibroblasts, TGF-01, synthetic tetradecapeptide, wound-healing drug, SMAD2, ERK1/2 phosphorylation,

ERK1/2 nuclear translocation, gene transcription For citation: Chulkina M.M., Lebedeva E.S., Pichugin A.V., Holmuhamedov E.L., Ataullakhanov R.I. Regeneration-inducing tetradecapeptide TEKKRRETVEREKE activates MAPK-kinase signaling in NIH/3T3 fibroblasts. Immunologiya. 2017; 38(4): 172-179. DOI: http://dx.doi.org/10.18821/0206-4952-2017-38-4-172-179

For correspondence: Ravshan I. Ataullakhanov, MD, PhD, Prof., Head of the Department of Immune Biotechnology, NRC Institute of Immunology FMBA, Russia, E-mail: ravshan.ataullakhanov@gmail.com

Для корреспонденции: Атауллаханов Равшан Иноятович, д-р мед. наук, проф., руководитель отдела иммунной биотехнологии ГНЦ «Институт иммунологии» ФМБА России, E-mail: ravshan.ataullakhanov@gmail.com

ORIGINAL ARTICLE

conflict of interest. The authors declare no conflict of interest.

Acknowledgments. The study had no sponsorship.

Received 19.12.16 Accepted 14.04.17

введение

В последнее время при разработке новых методов лечения ряда заболеваний большое внимание уделяют направленному регулированию сигнальных механизмов в клетках, определяющих патогенез. В процессах регенерации и заживления одним из ключевых естественных регуляторов оказывается цитокин TGF-P1, однако его применение в качестве лекарственного препарата для лечения эрозий, язв и ран ограничено из-за токсических и иммунодепрессивных нежелательных эффектов.

Основным типом клеток в процессах заживления являются фибробласты, которые под действием TGF-P1 направленно мигрируют в очаг воспаления, активно пролиферируют и реорганизуют внеклеточный матрикс [2, 3]. При этом фибро-бласты дифференцируются в миофибробласты, особый тип клеток, характеризующийся усиленным синтезом полимеров внеклеточного матрикса — коллагена и фибронектина, а также особым типом микрофиламент, содержащих a-SMA-актин [4, 5]. Естественный индуктор заживления TGF-P1 включает процесс дифференцировки фибробластов в миофибробла-сты, сопровождающийся транскрипцией генов, кодирующих синтез a-SMA и коллагена [6].

Активный TGF-P связывается с димерами рецептора TGF-pRII, которые связываются с димерами TGF-pRI и формируют тетрамерный рецепторный комплекс. TGF-pRII затем фосфорилирует цитоплазматический домен TGF-pRI, который активирует киназную активность TGF-pRI. Ре-цепторные киназы TGF-pRI могут затем фосфорилировать транскрипционные факторы SMAD2 и/или SMAD3, которые впоследствии образуют комплекс с SMAD4 или TIFly. Эти комплексы транспортируются в ядро, где модулируют экспрессию генов (рис. 1) [7].

Активация TGF-P рецептора может также вызвать независимые от SMAD сигнальные события, например через МАРК-киназы, Rho-GTPазы или PD-киназы, что приводит к регуляции экспрессии генов и, как следствие, функциональным изменениям в клетках. TGF-P может активировать MAPK-сигнальный путь через Raf/MEK/ERK каскад. Фосфо-рилирование Ras в ответ на TGF-P в эпителиальных клетках рекрутировало Raf — MAP3K к плазматической мембране и

вызывало активацию ERK через MEK1. Быстрая активация ERK при действии TGF-P была описана для эпителиальных клеток, опухолевых линий и фибробластов [8]. Как показано на рис. 2, рецепторные тирозин-киназы (RTK) при активации рекрутируют SOS, которые фосфорилируют Ras. Ras — активатор Raf, который активирует MEK1 и MEK2. MEK активирует ERK1 и ERK2, фосфорилируя мотив Thr-Glu-Thy. ERK затем фосфорилирует факторы транскрипции, например SRF. Этот сигнальный путь связан с белками цитоске-лета и другими субстратами (более 150 белков), с которыми ERK взаимодействует как в ядре, так и в цитоплазме [9].

Сигнальный путь Raf/MEK/ERK регулирует такие важные клеточные события, как пролиферация, дифференциация, апоптоз, миграция [10]. Известно, что интенсивность и длительность активации ERK сигналов влияют на реализацию ответов в фибробластах [9]. Длительная активация ER необходима для активации пролиферации [11]. Однако про-

Рис. 2. Raf/MEK/ERK сигнальный путь [9].

^Myosin

ERKp^

^ (^CalpairT^)

FAK

Изменения в клеточной адгезии и динамике цитоскелета

Рис. 1. Активация канонического SMAD-сигнального пути TGF-ß1 (X.M. Meng и соавт., 2016).

Рис. 3. Сигнальный путь клеточной миграции, опосредованный ERK [13].

ОРИГИНАЛЬНЫЕ СТАТЬИ

должительная активация ERK может приводить к клеточному старению и апоптозу [12]. Важной функцией фибробластов, находящейся под контролем ERK, является клеточная миграция (рис. 3). ERK регулирует движение клеток путем фосфорилирования киназы легкой цепи миозина (myosin light chain kinase (MLCK)), калпаина или FAK [13].

В процессах клеточной дифференцировки фибробластов ERK служит важным регуляторным звеном. Так, было показано, что киназы ERK, в особенности ERK2, опосредуют фосфорилирование SMAD2 и усиливают транскрипцию гена коллагена [14]. Использование ингибитора киназ ERK в моделях in vitro и in vivo показало снижение пролиферации, синтеза коллагена и a-SMA [15].

В настоящее время процесс дифференцировки фибробла-ста в миофибробласт рассматривают как сложный многофакторный процесс, в котором в дополнение к SMAD-сигнальному пути альтернативные сигнальные механизмы участвуют в ре-гулянии дифференцировки клетки [16, 17]. Эти пути включают в себя МАРК-киназный путь, Wnt- и Notch-сигнальные пути, и вовлеченность этих путей зависит от типа клеток, внеклеточного окружения и других регуляторных факторов, таких как механическая регуляция внеклеточных рецепторов клетки через связь с субстратом. Так, связывание с интегринами белков внеклеточного матрикса приводит к активированию различных тирозин-киназ, включая FAK — киназу фокальной адгезии, киназ Src, а также Rho GTPазу [18]. Более того, происходит кластеризация интегринов в сайтах адгезии и фосфорилиро-вание FAK, что опосредует запуск MAPK-фосфорилирования [19]. Представляется, что все эти различные сигнальные пути в клетке согласованы, что в конечном счете выражается в регуляции работы генов, связанных с дифференцировкой фибро-бластов [16]. Таким образом, в процессе дифференцировки фибробластов активация МАРК-сигнального пути может либо приводить к усилению SMAD-опосредованной транскрипции генов, связанных с дифференцировкой, либо, участвуя в других сигнальных каскадах, влиять на транскрипцию этих генов через иные сигнальные механизмы.

В предыдущем исследовании мы показали, что индуктор заживления эрозий, язв и ран тетрадекапептид TEKKRRETVEREKE вызывает дифференцировку фибро-бластов в миофибробласты, а также увеличивает подвижность фибробластов в модели повреждения монослоя [1]. В данной работе мы сравнили сигнальные события в фибро-бластах линии 3T3/NIH при их активации тетрадекапепти-дом или естественным стимулятором фибробластов TGF-ß1. В клетках линии 3T3/NIH мы показали, что тетрадекапептид TEKKRRETvEREKE активирует фибробласты иначе, нежели цитокин TGF-ß1. Оба индуктора активируют неканонический MAPK-киназный сигнальный путь и транскрипцию генов a-sma и collai, но только TGF-ß1 дополнительно активирует канонический SMAD-сигнальный путь и транскрипцию гена tgf-ßl.

Материал и методы

Для исследования молекулярных механизмов дифференцировки фибробластов при действии цитокина TGF-ß1 и пептида Гепон методом ПЦР в режиме реального времени (ПЦР-РВ) исследовали изменение транскрипции генов a-sma, collal, tgf-ßl, связанных с процессами дифференцировки. Для исследования сигнальных процессов активации рецептора TGF-ß1 и проверки гипотезы участия препарата Гепон в этом пути активации фибробластов исследовали канонический SMAD —зависимый путь активации рецептора и неканонический, MAPK-киназный RAF/MEK/ERK-сигнальный путь. Методами конфокальной и эпифлуоресцентной микроскопии, и Вестерн-блоттингом на фибробластах линии NIH/3T3 исследовали динамику фосфорилирования транскрипционного фактора SMAD2 и киназы ERK1/2, а также транслокацию общей формы киназ ERK1/2 в ядро.

Микроскопия. Клеточные препараты для визуализации общей и фосфорилированной форм киназ ERK1/2 готовили согласно протоколу производителя антител. Фибробласты линии NIH/3T3 были посажены на слайд-камеры со стеклянной поверхностью (SPL Life Sciences Co., Корея), обработанной коллагеном 1-го типа (rat tail collagen, Sigma № С3867, США) (10 мкг/см2), в плотности 50 000 клеток/см2 в среде DMEM с содержанием глюкозы 4 мг/мл, 10% фетальной бычьей сыворотки (ФБС). Через 18 ч, после адгезии клеток среду убирали, клетки промывали теплым буфером PBS/BSA и проводили старвинг 24 ч в среде DMEM с 2% ФБС. После старвинга среду отбирали, добавляли свежую среду с активаторами Гепон (10 мкг/мл) (ООО «Иммафарма», Россия) или TGF-ß1 (5 нг/мл) (Sigma Cat № T7039, США), в контрольные лунки активатор не добавляли. По завершении эксперимента клетки промывали теплым PBS, фиксировали 4% PFA 37°C 20 мин, промывали PBS двукратно 500 мкл, премеабилизи-ровали ледяным 96% метанолом на льду 20 мин, после чего клетки промывали PBS двукратно 500 мкл и инкубировали 1 ч в PBS, содержащем 0,5% BSA. Фиксированные и пре-меабилизированные клетки инкубировали 18 ч при +40°C с моноклональными антителами anti-p44/42 MAPK (Erk1/2) (137F5) или anti-phospho-p44/42 MAPK (Erk1/2) (Thr202/ Tyr204) (D13.14.4E) XP (CST, Cat № 4695; Cat № 4370, США) в буфере для забивки (разведение антител 1: 200). После чего клетки отмывали трижды по 5 мин на шейкере в 500 мкл PBS/BSA, затем окрашивали вторичными антителами goat anti-rabbit IgG (H + L), конъюгированными с флуоресцентной меткой Alexa Fluor 488 в разведении 1: 300 (Life technologies № A11034, США). Инкубировали 1 ч при комнатной температуре и двукратно промывали 500 мкл PBS/BSA. К полученным образцам добавляли протектор окрашивания Prolong Gold Anti-Fade Reagent (CST, Cat № 8961, США), содержащий краситель DAPI для окрашивания ядер, закрывали препарат покровным стеклом и проводили визуализацию клеток на конфокальном микроскопе Carl Zeiss Axio Observer Z.1. для исследования распределения общей формы киназ ERK1/2 либо на микроскопе Olypus IX71S8F-3 (Olympus, Япония) для получения эпифлуоресцентного изображения клеток.

Количественный анализ изображений. Для каждого экспериментального варианта проводили съемку 10—15 полей при Ув. 20. Изображения сохранялись в формате tiff и использовали для анализа в программе ImageJ 1.48v. Для анализа фосфорилирования киназ ERK1/2 проводили измерение среднего значения флуоресценции. Для этого предварительно вычитали фоновое значение флуоресценции для каждого изображения с помощью макро ImageJ-macro Intensity Ratio Nuclei Cytoplasm Tool, используя параметры настройки: radius = 1; offset = 1; iterations = 1, затем автоматически вычисляли среднее значение интенсивности для всего изображения, как описано [20]. Было проведено 3 независимых эксперимента, в поле съемки просчитывалось 35—50 клеток, приведено среднее значение для экспериментов. Значение флуоресценции опытных образцов нормировали на значение флуоресценции контрольных образцов для каждого эксперимента. Для анализа перераспределения общей формы ERK1/2 между ядром и цитоплазмой клеток использовали Индекс флуоресценции — отношение зеленой флуоресценции в зоне ядра (FN) к значению флуоресценции в цитоплазме (FC) [21]. Для этого при помощи макро ImageJ-macro Intensity Ratio Nuclei Cytoplasm Tool предварительно вычитали фоновое значение флуоресценции для всех изображений, используя параметры настройки: radius = 1; offset = 1; iterations = 1, затем в канале Dapi получали маску для ядер клеток. На следующем этапе программно получали значение флуоресценции в области маски ядер (FN) и в области цитоплазмы (FC). Было проведено 2 независимых эксперимента, приведено среднее значение для экспериментов.

Вестерн-блоттинг. Для анализа динамики экспрес-

ORIGINAL ARTICLE

Таблица 1

Последовательности праймеров и зондов для ПЦр-рв

Ген

Последовательность олигонуклеотидов 5'-3'

Длина продукта, п. н.

Учетный номер последовательности

P-actm (FORWARD) AGAGGGAAATCGTGCGTGAC 138

(REVERSE) CAATAGTGATGACCTGGCCGT (PROBE) FAM-CACTGCCGCATCCTCTTCCTCCC-RTQ a-sma (FORWARD) TCAGGGAGTAATGGTTGGAATG 112

(REvERSE) GGTGATGATGCCGTGTTCTA (PROBE) FAM-CCTCTCTTGCTCTGGGCTTCATC-RTQ collal (FORWARD) GAGCGGAGAGTACTGGATCG 173

(REvERSE) TACTCGAACGGGAATCCATC (PROBE) FAM-AACTGGTACATCAGCCCGAA-RTQ tgf-fil (FORWARD) TGACGTCACTGGAGTTGTACGG 140

(REvERSE) GGTTCATGTCATGGATGGTGC (PROBE) FAM-TTCAGCGCTCACTGCTCTTGTGACAG-RTQ

NM 007393

NM 007392

NM 007742

NM 011577

сии фосфорилированной и общей формы белков SMAD2 и ERK1/2 в культуре фибробластов NIH/3T3 при активации ци-токином TGF-ß1 и пептидом Гепон клетки были посажены в плотности 50 см2 в среде DMEM с содержанием глюкозы 4 мг/ мл, 10% фетальной бычьей сыворотки (ФБС) в 6-луночный плейт (LUX tissue culture), обработанный коллагеном. Через 18 ч, после адгезии клеток, среду убирали, клетки промывали теплым буфером PBS/BSA и проводили старвинг 24 ч в среде DMEM с 2% ФБС. После старвинга, среду отбирали, добавляли свежую среду с активаторами Гепон (10 мкг/мл) (ООО «Иммафарма», Россия) или TGF-ß1 (5 нг/мл) (Sigma №T7039, США), в контрольные лунки активатор не добавляли. По завершении эксперимента культуральную среду удаляли, промывали клетки на льду холодным раствором DPBS 3 раза, убирали остатки буфера и лизировали клетки в 100 мкл буфера (Invitrogen, Cell Extraction Buffer, FNN0011, США) в присутствии ингибиторов протеаз (Sigma, P2714-1BTL) 30 мин при 4°C. Клеточные экстракты осаждали на центрифуге (Eppendorf 5424R, Германия) (14 000 rpm, 10 мин, 4°C), отбирали супернатанты и измеряли в них концентрацию белка с использованием коммерческого набора (Pierce, Protein Assay Reagent, 23225). Полученную смесь клеточных белков (10—50 мкг) разделяли в 8% SDS-PAGE и переносили на PVDF-мембрану (Amersham Hybond-P). Для детекции целевых белков мембрану последовательно в течение 18 ч инкубировали с первичными антителами к pSMAD2/3 (Phospho-Smad2 (Ser465/467)/Smad3 (Ser423/425) CTS, Cat №8828,США), pErk1/2 (T202/204) (CST, Cat №2 4370, США), в разведении 1: 1000 и GAPDH (Abcam, ab8245, США) в разведении 1: 2000, а затем со вторичными антителами, конъюги-рованными с пероксидазой хрена, в разведении 1: 1 000 000 (Sigma, A0545-1ML, США). Визуализацию результатов осуществляли методом хемилюминесценции (Pierce, SuperSignal West Femto Maximum sensitivity, 34095, США). Анализ интенсивности белковых полос проводили с помощью программы ImageJ 1.48v. Для этого в полученных изображениях в формате tiff разрешением 8-bit выделяли анализируемые белковые полосы, затем, используя макро Analyze Gels, получали пики интенсивности для каждой белковой полосы и вычисляли площади пиков. Полученные значения для целевого белка приводили в отношении к значениям нормировочного белка GAPDH. Для каждого экспериментального варианта было исследовано 2 лунки, всего было 3 независимых эксперимента — приведено среднее по экспериментам.

ПЦР-РВ. Клетки NIH/3T3 были посажены на обработанный коллагеном 96-луночный плейт в плотности 3000/см2, их

культивировали 18 ч в полной среде ДМЕМ 10% ФБС, затем меняли среду на ДМЕМ 2% ФБС и проводили старвинг 24 ч. После старвинга среду отбирали, добавляли свежую среду с активаторами Гепон (10 мкг/мл) (ООО «Иммафарма», Россия) или TGF-P1 (5 нг/мл) (Sigma Cat №T7039, США), в контрольные лунки активатор не добавляли. Клетки инкубировали 24 ч в культуральном термостате при 37°C и 5% CO2. По окончании эксперимента убирали среду, добавляли 100 мкл лизирующего буфера, содержащего гуанидин изотиоцианат, в каждую лунку плейта, после чего лизат 3 лунок объединяли в одну пробу. Затем проводили выделение РНК коммерческим набором «РНК-Экстран» (производство «Синтол», Россия) согласно инструкции производителя. Принцип выделения РНК основан на кислой фенольной экстракции и спиртовой преципитации по Хомчинскому. Осадок нуклеиновых кислот растворяли в 10 мкл mQ, обработанной DEPC, далее проводили обработку ДНКазой (производство Thermo Scientific, США) (1 мкл 30 мин при 37°C, инактивировали ДНКазу 1 мкл 25 mM EDTA 10 мин при 65°C). Отжиг праймера для ОТ проводили при 65°C 5 мин, после чего пробы немедленно охлаждали на льду. Реакцию обратной транскрипции проводили со специфическими праймерами для каждого гена (обратный праймер), используя коммерческий набор реагентов для проведения обратной транскрипции (производство «Синтол», Россия), реакцию проводили согласно инструкции производителя. Полученную кДНК использовали для проведения ПЦР в режиме реального времени. Постановку ПЦР проводили в дублях, в анализе выбирали среднее значение порогового цикла (Cp) дублей. Последовательности прайме-ров и зондов (синтез «Синтол», Россия), использованных в исследовании, приведены в табл. 1.

Для проведения ПЦР и детекции флуоресценции использовали детектирующий амплификатор DTprime 4 (ООО «НПО ДНК-Технология», Россия) с программным обеспечением, предоставляемым производителем прибора (Real-Time_PCR v.7.3). Программа амплификации:

94°C — 5 мин

94°C — 10 с

62°C — 20 с* 40 циклов

72°C — 5 с

10°C — хранение

* — на этом этапе производится измерение флуоресценции.

ОРИГИНАЛЬНЫЕ СТАТЬИ

Уровень относительной экспрессии мРНК целевых генов вычисляли, используя AACp метод [22], по формуле: ср (норм.гена)

N= 2 ср(иссл.гена), где

Cp (норм. гена) — значение порогового цикла нормировочного гена, автоматически определяемое прибором, (среднее по дублям);

Cp (иссл. гена) — значение порогового цикла исследуемого гена, автоматически определяемое прибором, (среднее по дублям).

В качестве нормировочного гена использовали ß-actin. Для каждого опыта вычисляли отношение значения экспрессии исследуемого гена в активированных образцах к контрольному значению.

Было проведено 6 независимых экспериментов, приведено среднее по экспериментам.

результаты

Исследовано изменение транскрипции генов, связанных с дифференцировкой фибробластов, — a-sma, collal, tgf-ßl. Предварительные эксперименты показали, что максимум транскрипции этих генов приходится на 18—24 ч действия активатора (цитокин TGF-ß1), что согласуется с данными других исследований по кинетике транскрипции этих генов, поэтому для исследования транскрипции использовали временную точку 24 ч после активации. Как показано на рис. 4, при действии тетрадекапептида достоверное увеличение транскрипции наблюдалось для генов a-sma — в 1,6 ± 0,05 раза и гена collal — в 1,5 ± 0,03 раза, а для гена tgf-ßl достоверных отличий от контроля обнаружено не было. При действии цитокина TGF-ß1 было показано увеличение транскрипции всех исследованных генов a-sma в 3,2 ± 0,22, collal в 2,1 ± 0,14, tgf-ßl в 2,3 ± 0,52 раза соответственно. Следовательно, под влиянием тетрадекапептида активируется транскрипция генов a-sma и collal, связанных с дифференцировкой фи-бробластов, но количественное увеличение транскрипции этих генов ниже, чем при действии цитокина TGF-ß1. В отличие от тетрадекапептида, цитокин TGF-ß1 вызывал также усиление транскрипции гена tgf-ßl, что лежит в основе ау-токринной стимуляции пролиферации и дифференцировки фибробластов. Тетрадекапептид не оказывал такого действия на фибробласты. Для исследования ранних этапов активации фибробластов при действии обоих активаторов был исследован канонический сигнальный каскад от рецептора TGF-ß1 на SMAD-сигнальный путь. Временная динамика изменения фосфорилирования SMAD2 была проанализирована методом Вестерн-блоттинга в первый час действия активатора (рис. 5 а, б). При активации фибробластов тетрадекапептидом на-

-sma соИа1 tgf-ß1

I Контроль И Гепон Щ TGF-ß1

Рис. 4. Изменение экспрессии генов a-sma, collal, tgf-ßl в фибробластах линии NIH/3T3 при активации пептидом Гепон (10 мкг/мл) и цитокином TGF-ß1 (5 нг/мл) через 12 ч (n = 6, p < 0,05).

Рис. 5. Временная кинетика экспрессии общей и фосфорилирован-ной формы белка SMAD2 в фибробластах линии NIH/3T3 при активации пептидом Гепон (10 мкг/мл) и цитокином TGF-ß1 (5 нг/мл). Денситограмма Вестерн-блота экстрактов контрольных и активированных образцов (а); Количественный анализ нормированного на GAPDH содержания белка pSMAD в определенных временных точках (n = 3, p < 0,05) (б).

блюдалось незначительное увеличение фосфорилирования SMAD2 в 1,4 ± 0,1 раза (p > 0,05) при часовой экспозиции в присутствии препарата. Под влиянием цитокина TGF-ß1 через 30 и 60 мин содержание фосфорилированного SMAD2 увеличилось в 2,4 ± 0,1 (p < 0,05) и 2,8 ± 0,1 (p < 0,05) раза соответственно. Таким образом, нами было показано, что тетрадекапептид не активирует SMAD-сигнальный каскад по классическому пути от рецептора TGF-ß, тогда как цитокин TGF-ß1 вызывает фосфорилирование транскрипционного фактора SMAD2 в течение 1-го часа активации.

Далее было исследовано участие тетрадекапептида и ци-токина TGF-ß1 в активации МАРК-киназного пути. Исследование кинетики фосфорилирования киназ ERK1 и ERK2 в Вестерн-блоте показало, что как при действии TGF-ß1, так и при действии тетрадекапептида происходит фосфорилиро-вание обеих киназ, причем для обоих активаторов это очень быстрые процессы. Максимальное значение фосфорили-рования обеих киназ при активации фибробластов тетраде-капептидом или цитокином TGF-ß1 наблюдалось в первые

5 мин после внесения активаторов в культуру клеток. Содержание фосфорилированной формы ERK1 повысилось под влиянием тетрадекапептида в 2,1 ± 0,3, а TGF-ß1 — в 2,2 ± 0,1 раза. Содержание фосфорилированной формы ERK2 возрастало при действии тетрадекапептида и TGF-ß1 в 1,6 ± 0,3 и 1,8 ± 0,4 раза соответственно. В течение последующего 1ч содержание фосфорилированных ERK-киназ снижалось до фоновых значений в неактивированных клетках (рис. 6 а, б, в). Методом оценки среднего значения эпифлуоресценции мы проанализировали изображения контрольных и активированных клеток, окрашенных моноклональными антителами к фосфорилированным ERK1/2, при 5 мин экспозиции с активаторами. При действии тетрадекапептида среднее значение флуоресценции было увеличено в 1,2 ± 0,05 раза, а при

ORIGINAL ARTICLE

Рис. 6. Временная кинетика экспрессии фосфорилированной формы киназ ERK1 и ERK2 в фибробластах линии NIH/3T3 при активации пептидом Гепон (10 мкг/мл) и цитокином TGF-01 (5 нг/мл).

Денситограмма Вестерн-блота экстрактов контрольных и активированных образцов (а); Количественный анализ нормированного на GAPDH содержания белков pERK1 (б) и pERK2 (в) в определенных временных точках; микрофотографии эпифлуоресценции pERK1/2 в контрольных и активированных образцах во временной точке 5 мин (г); количественный анализ эпифлуоресценции pERK1/2 (д) (n = 3, p < 0,05).

действии TGF-pi в 1,5 ± 0,1 раза (рис. 6 г, д). Микроскопия позволяла нам оценивать фосфорилирование обеих киназ, в то время как Вестерн-блоттинг показывал изменение для каждого белка отдельно. Результаты обоих методов согласуются между собой — через 5 мин после активации фибробла-стов тетрадекапептидом или TGF-P1 происходит фосфорилирование киназ ERK1 и ERK2.

Также мы исследовали перераспределение общей формы киназ ERK1 и ERK2 между цитоплазмой и ядром. Методом анализа конфокальных изображений мы измеряли отношение (индекс) содержания ERK-киназ в ядре к таковому в цитоплазме клеток. В контрольных неактивированных фибро-бластах 3T3/NIH это отношение составило 0,3 ± 0,13, а через 15 мин после активации клеток тетрадекапептидом или TGF-Р1 оно возрастало до 0,6 ± 0,06 и 0,73 ± 0,22 соответственно, что свидетельствовало об активации транслокации ERK1/2 в ядро (рис. 7, а, б). При действии обоих активаторов киназы ERK1 и ERK2 транспортируются в ядро, что приводит к наблюдаемым изменениям в транскрипции генов и дифферен-цировке фибробластов.

Обсуждение

Направленная дифференцировка фибробластов под действием цитокина TGF-P1 включает ряд хорошо описанных сигнальных механизмов от рецептора данного цитокина до активации генов, участвующих в ремоделировании внеклеточного матрикса, а также генов, контролирующих клеточный цикл и пролиферацию. Ранее мы показали, что тетраде-капептид TEKKRRETVEREKE так же, как TGF-P1 приводит к синтезу белка a-SMA и включению его в структурные элементы цитоскелета [1]. В данной работе мы исследовали изменение транскрипции гена a-sma, а также гена коллагена 1-го типа (collai) и tgf- fil. Максимум транскрипции данных генов наблюдается через 18—24 ч после активации и связан с дифференцировкой клеточной популяции фибробластов [23]. В наших экспериментах цитокин TGF-P1 через сутки после активации вызывал усиление транскрипции всех исследованных нами генов: a-sma, collai и tgf- fil. Это согласуется

с работами других авторов, выполненных как на клеточных линиях фибробластов, так и на первичных фибробластах, а также в экспериментах in vivo [23, 24]. Исследуя транскрипцию данных генов при действии тетрадекапептидом, мы наблюдали усиление экспрессии генов a-sma и collal. Изменение транскрипции гена a-sma приводит к синтезу данного белка и включению этого белка в микрофиламенты, что служит характерным признаком дифференцировки фибро-бластов в миофибробласты. Изменение транскрипции гена collal тоже тесно связано с дифференцировкой фибробла-стов в миофибробласты, которые отличаются активным синтезом полимеров матрикса, в частности, коллагена [17, 25]. Цитокин TGF-pi и тетрадекапептид TEKKRRETVEREKE по-разному действуют на фибробласты, в частности, TGF-pi активирует, а тетрадекапептид не влияет на транскрипцию гена tgf-fil. Нам не удалось зарегистрировать отличие от контроля в транскрипции гена tgf-fil при действии тетраде-капептида. Известно, что фибробласты синтезируют этот ци-токин самостоятельно, а при активации и дифференцировке под действием ростовых факторов запускается петля положительной обратной связи в синтезе этого цитокина [26].

Интересно, что усиление транскрипции генов a-sma и collal при отсутствии изменения транскрипции гена tgf-fil было показано для фибробластов печени [27]. Также выявлено, что некоторые ростовые факторы, такие как IGF, обладают способностью активации генов a-sma и collal [28, 29].

Принимая во внимание важность цитокина TGF-pi как главного регулятора функций фибробластов и фактора, определяющего дифференцировку этого типа клеток, мы проверили возможность использования канонического сигнального пути (от рецепторов TGF-pi через SMAD2/3) в активации фибробластов тетрадекапептидом. Наши эксперименты показали, что SMAD-сигнальный путь не активируется в фи-бробластах при воздействии тетрадекапептидом. Напротив, неканонический MAPK-сигнальный путь быстро и сильно активируется.

Протеинкиназа ERK1/2 участвует во многих сигнальных каскадах, реализуя сложную сеть внутриклеточной сигнализации

Иммунология. 2017; 38(4)

DOI: http://dx.doi.org/10.18821/0206-4952-2017-38-4-172-179 ОРИГИНАЛЬНЫЕ СТАТЬИ

следствие, более низкая, чем под действием цитокина, транскрипция белка a-SMA и степень дифференцировки культуры фибробластов. При активации фибробластов тетрадекапептидом отсутствие усиления транскрипции гена tgf-ß1 не приводит к аутокринной/паракринной стимуляции синтеза TGF-ß, как это происходит под действием цитокина TGF-ß. Это отличие тетрадекапептида от TGF-ß1 можно рассматривать как достоинство пептидного препарата, который активирует фибробласты и активирует заживление, но не индуцирует гиперэкспрессии TGF-ß1 и не способствует избыточному фиброзированию заживающей ткани.

Финансирование. Исследование не имело спонсорской поддержки.

Конфликт интересов. Авторы заявляют об отсутствии конфликта интересов.

Рис. 7. Внутриклеточное перераспределение общей формы ERK1/2 в фибробластах линии ШН/3Т3 при активации пептидом Гепон (10 мкг/мл) и цитокином TGF-P1 (5 нг/мл) через 15 мин активации. Конфокальные изображения контрольных и активированных клеток, снятых в канале FITC для визуализации общей формы ERK1/2 и в канале DAPI для определения области ядра (а); гистограмма отношения ядерного ERK1/2 к цитоплазматическому (б) (п = 2, р < 0,05).

[30]. Согласно нашим данным, активация MAPK-сигнального каскада тетрадекапептидом и цитокином TGF-ß1 происходит очень быстро — пик фосфорилирования обеих киназ детектировался при 5-минутной экспозиции обоих активаторов. Кроме того, при действии тетрадекапептида, как и под влиянием ци-токина TGF-ß1, происходит транслокация киназ ERK в ядро. Транслокация активированного ERK1/2 в ядро приводит к активации экспрессии ряда генов, транскрипционные факторы которых активирует эта киназа, например Elk-1, Myc, Myb и cAMP-response element [30]. Показана важность транслокации активированных киназ erk1/2 при дифференцировке фибробластов [31]. Более того, выявлено, что для фибробластов транслокация ERK1/2 в ядро и транскрипция генов связаны с адгезией клеток — взаимодействием интегринов с матриксом [32]. Наши данные согласуются с исследованиями M. Costa и соавт., показавшими, что при активации значения отношения ядерного ERK1/2 к цитоплазматическому в фибробластах NIH/3T3 увеличиваются в 2 раза. По литературным данным, транслокация общей формы ERK1/2 — очень быстрый процесс. Так, в течение 10 мин после активации FGF достигался максимум, и уровень плато сохранялся до 1,5 ч [21].

Заключение

Данные наших исследований показывают, что при действии тетрадекапептида TEKKRRETVEREKE (лекарственный препарат Гепон) происходит активация MAPK-киназного пути, в частности фосфорилирование киназ ERK1/2, их транслокация в клеточное ядро и связанные с этим изменения в транскрипции генов a-sma и collai, что приводит к дифференцировке фибробластов в миофибробласты. Морфологические изменения клеток под действием тетрадека-пептида и изменения в синтезе белка a-SMA были показаны нами в предыдущем исследовании [1]. В данной работе мы установили, что действие тетрадекапептида не затрагивает SMAD-сигнальный путь, что выражается в отсутствии фосфорилирования транскрипционного фактора SMAD2. По механизму действия на фибробласты тетрадекапептид явно отличается от TGF-ß1. Кроме отсутствия активации SMAD2, мы отметили то, что тетрадекапептид не инициирует транскрипцию гена tgf-ßl. Различиями в механизмах действия тетрадекапептида и цитокина TGF-ß1 могут объясняться более низкие значения в транскрипции генов a-sma и collal и, как

литература

1. Чулкина М.М., Лебедева Е.Л., Холмухамедов Э.Л., Атауллаха-нов Р.И. Гомолог шарнирной области эзрина тетрадекапептид (TEKKRRETVEREKE) активирует дифференцировку фибробластов линии NIH/3T3. Иммунология. 2017; 38(1): 4—11.

references

1. Chulkina M.M., Lebedeva E.S., Holmuhamedov E.L., Ataullakhanov R.I. Ezrin hinge region peptid TEKKRRETVEREKE mediated fibroblast to myofibroblast differentiation in NIH/3T3 cells. Immunology, 2017; 38(1): 4—11. (in Russian).

2. Clark R.A.F. Wound repair: overview and general considerations, In:The molecular and cellular biology of wound repair, Clark, Ed. New York: Plenum Press; 1996: 3—50.

3. Martin P. Wound healing — aiming for perfect skin regeneration. Science. 1997; 276: 75—81

4. Hinz B., Celetta G., Tomasek J.J., Gabbiani G., Chaponnier C. Alpha-smooth muscle actin expression upregulates fibroblast contractile activity. Mol. Biol. Cell. 2001; 12: 2730—41.

5. Gabbiani G. The myofibroblast in wound healing and fibrocontractive disease. J. Pathol. 2003; 200: 500—3.

6. Tomasek J.T., Gabbiani G., Hinz B., Chaponnier C., Brown R.A. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat. Rev. Mol. Cell Biol. 2002; 3: 349—63.

7. Moustakas A., Souchelnytskyi S., Heldin C.H. Smad regulation in TGF-beta signal transduction. J. Cell Sci. 2001; 114: 4359—69.

8. Zhang Y.E. Non-Smad pathways in TGF-ß signaling. Cell research. 2009; 19(1): 128-39.

9. Wellbrock C., Karasarides M., Marais R. The Raf proteins take centre stage. Nat. Rev. Molecular Cell Biol. 2004; 5: 875—86.

10. Lovric J., Dammeier S., Kieser A., Mischak H., Kolch W. Activated Raf Induces the Hyperphosporylation of Stathmin and the Reorganization of Microtubule Network. J. Biol. Chem., 1998; 273(35): 22848—55.

11. Weber J.D., Raben D.M., Phillips P. J. and Baldassare J.J. Sustained activation of extracellular-signal-regulated kinase 1 (ERK1) is required for the continued expression of cyclin D1 in G1 phase. Biochemistry. 1997; 326: 61—8.

12. Martin C., Chen S., Helios D., Suer G., Hunt J., ShawA.G., Sims P.F.G., Jackson D.A., Lovric J. Changed Genome Heterochromatization Upon Prolonged Activation of the Raf/ERK Signaling Pathway. PLoS ONE. 2010; 5(10): e13322.

13. Huang C., Jacobson K., Schaller M.D. MAP kinases and cell migration. J. Cell Sci. 2004, 117: 4619—28.

14. Wang J., Zohar R., McCulloch C.A. Multiple roles of alpha-smooth muscle actin in mechanotransduction. Exp. Cell Res. 2006; 312(3): 205—14.

15. Gao Y., Wang Y., Li Y., Xia X., Zhao S., Che Y. et al. TGF-ß1 promotes bovine mammary fibroblast proliferation through the ERK 1/2 signalling pathway. Cell Biol. Int. 2016; 40(7): 750—60.

16. Hinz B., Phan S.H., Thannickal V.J., Prunotto M., Desmouliere A., Varga J. et al. Recent developments in myofibroblast biology: paradigms for connective tissue remodeling. Am. J. Pathol. 2012; 180(4): 1340—55.

17. Yang G., Crawford R.C., Wang J.H. Proliferation and collagen production of human patellar tendon fibroblasts in response to cyclic uniaxial stretching in serum-free conditions. J. Biomech. 2004; 37: 1543—50.

18. Guan J.L., Shalloway D. Regulation of focal adhesion-associated protein tyrosine kinase by both cellular adhesion and oncogenic transformation, Nature. 1992; 358: 690—2.

19. Wang H.B., Dembo M., Hanks S.K., Wang Y. Focal adhesion kinase is involved in mechanosensing during fibroblast migration. Proc. Natl. Acad. Sci. U.S.A. 2001; 98: 11295— 300.

20. Webb D.J., Brown C.M. Epi-Fluorescence Microscopy. Meth. Mol. Boil. (Clifton, NJ). 2013; 931: 29—59.

21. Costa M., Marchi M., Cardarelli F., Roy A., Beltram F., Maffei L., Michele G. Ratto Dynamic regulation of ERK2 nuclear translocation and mobility in living cells. J. Cell Sci. 2006; 119: 4952—63.

22. Bustin S.A., Benes V., Nolan T., and Pfaffl M.W. Quantitative realtime RT-PCR — a perspective. J. Mol. Endocrinol. 2005; 34(3): 597—601.

23. Hinz B. Formation and function of the myofibroblast during tissue repair. J. Invest. Dermatol. 2007; 127(3): 526—37.

24. Wang J.H., Thampatty B.P., Lin J.S., Im H.J. Mechanoregulation of gene expression in fibroblasts. Gene. 2007; 391(1-2): 1—15.

25. Ghosh A.K., Yuan W., Mori Y., Chen S., Varga J. Antagonistic regulation of type I collagen gene expression by interferon-gamma and transforming growth factor-beta. Integration at the level of p300/CBP transcriptional coactivators. J. Biol. Chem. 2001; 276: 11041—8.

26. Blanchette F., Day R., Dong W., Laprise M.-H., Dubois C.M. TGF-

ORIGINAL ARTICLE

beta-1 regulates gene expression of its own converting enzyme furin. J. Clin. Invest. 1997; 99: 1974-83.

27. D'Ambrosio D.N., Walewski J.L., Clugston R.D., Berk P.D., Rippe R.A., Blaner W.S. Distinct populations of hepatic stellate cells in the mouse liver have different capacities for retinoid and lipid storage. PLoS One. 2011; 6(9): e24993.

28. Grotendorst G.R., Duncan M.R. Individual domains of connective tissue growth factor regulate fibroblast proliferation and myofibroblast differentiation. FASEB J. 2005; 19(7): 729—38.

29. Simmons J.G., Pucilowska J.B., Keku T.O., Lund P.K. IGF-I and TGF-beta1 have distinct effects on phenotype and proliferation of intestinal fibroblasts. Am. J. Physiol. Gastrointest. Liver Physiol. 2002; 283(3): 809—18.

30. Chuderland D., Seger R. Protein-protein interactions in the regulation of the extracellular signal-regulated kinase. Mol. Biotechnol. 2005; 29: 57—74.

31. Cowley S., Paterson H., Kemp P., Marshall C.J. Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiation and for transformation of NIH 3T3 cells. Cell. 1994; 77: 841—52.

32. Conner S.R., Scott G., Aplin A.E. Adhesion-dependent activation of the ERK1/2 cascade is by-passed in melanoma cells. J. Biol. Chem. 2003; 278(36): 34548—54.

Поступила 19.12.16 Принята в печать 14.04.17

КЛЕТОЧНАЯ ИММУНОЛОГИЯ

© КОЛЛЕКТИВ АВТОРОВ, 2017 УДК 612.018.2:577.175.327].08

Заморина С.А13, Литвинова Л.С.2, Юрова К.А.2, Дунец Н.А.2, Хазиахматова О.Г.2, Тимгано-ва В.П.1, Бочкова М.С.1, Храмцов П.В.13, Раев М.Б.13

ХОРИОНИЧЕСКИЙ ГОНАДОТРОПИН КАК ФАКТОР, РЕГУЛИРУЮЩИЙ ФУНКЦИОНАЛЬНУЮ АКТИВНОСТЬ Т-КЛЕТОК ИММУННОЙ ПАМЯТИ

1 ФГБУН «Институт экологии и генетики микроорганизмов» Уральского отделения Российской Академии наук, 614081, г Пермь, Россия;

2 ФГАОУ ВО «Балтийский федеральный университет им. И. Канта», 236016, г Калининград, Россия

3 ФГБОУ ВПО «Пермский государственный национальный исследовательский университет», 614990, г Пермь, Россия

Изучали роль хорионического гонадотропина (ХГ) в регуляции процессов, определяющих функциональную активность наивных Т-клеток, и Т-клетки памяти в системе in vitro. Показано, что ХГ в концентрациях, соответствующих физиологической беременности (10 и 100 МЕ/мл), угнетал экспрессию активационных маркеров CD28 и CD25 как наивными Т-клетками (CD45RA+), так и Т-клетками памяти (CD45RO+). Депрессивные эффекты ХГ реализовались только на уровне CD4+-лимфоцитов, не затрагивая субпопуляцию CD8+. В то же время ХГ не влиял на экспрессию маркера пролиферации CD71 наивными Т-клетками и Т-клетками памяти. Таким образом, впервые установлена роль ХГ в регуляции активности Т-клеток иммунной памяти, ассоциированная с подавлением экспрессии акти-вационных маркеров CD28 и CD25. Полученные данные расширяют представления о роли ХГ в формировании иммунной толерантности в период беременности.

Ключевые слова: хорионический гонадотропин; иммунная толерантность; Т-клетки памяти; беременность. Для цитирования: Заморина С.А., Литвинова Л.С., Юрова К.А., Дунец Н.А., Хазиахматова О.Г., Тимганова В.П., Бочкова М.С., Храмцов П.В., Раев М.Б. Хорионический гонадотропин как фактор, регулирующий функциональную активность Т-клеток иммунной памяти. Иммунология. 2017; 38(4): 179-184. DOI: http://dx.doi.org/10.18821/0206-4952-2017-38-4-179-184

Zamorina S.A. 13, Litvinova L.S.2, Yurova K.A.2, Dunets N.A.2, Khaziakhmatova O.G.2, Timganova V.P.1, Bochkova M.S.1, Khramtsov P. V.2, Rayev M.B.1,3.

HUMAN CHORIONIC GONADOTROPIN AS A FACTOR REGULATING FUNCTIONAL ACTIVITY OF IMMUNE MEMORY T-CELLS

Для корреспонденции: Заморина Светлана Анатольевна, д-р биол. наук, вед. научн. сотр. лаборатории экологической иммунологии, E-mail: mantissa7@mail.ru.