CC BY
8
Tcruwr-i
:"*•;"*•; jf-Th"*!
Представлено результати виявлення бакте-piü Cronobacter spp. i3 сирого молока Kopie та з oб'eктiв молочних ферм. З дослиджених проб було видтено та вiдiбpанo 25 iзoлятiв для ПЛР з 16SрРНК геном. Результати доводять, що сере-довище молочних ферм е потенцшним джере-лом цих мiкpoopганiзмiв в сирому молощ. Дат е корисними для ощнки мiкpoбioлoгiчнoгo ризику щодо бактерш Cronobacter spp
Ключoвi слова: ргд Cronobacter (Enterobacter sakazakii), молочт ферми, сире молоко кopiв,
ПЛР, 16S рРНК
□-□
Представлены результаты выявления бактерий Cronobacter spp. из сырого молока и объектов молочных ферм. Из исследованных проб было выделено и отобрано 25 изолятов для ПЦР с 16S рРНК геном. Результаты показывают, что объекты молочных ферм являются потенциальным источником этих микроорганизмов в сыром молоке. Эти данные будут полезны для оценки микробиологического риска относительно Cronobacter spp
Ключевые слова:род Cronobacter (Enterobacter sakazakii), молочные фермы, сырое молоко коров, ПЦР, 16SрРНК
UDC 637.075
|DOI: 10.15587/1729-4061.2017.114637
IDENTIFICATION OF CRONOBACTER SPP (ENTEROBACTER SAKAZAKII) FROM RAW MILK AND ENVIRONMENTAL SAMPLES OF DAIRY FARMS
O. Berhilevych
Doctor of Veterinary Sciences, Professor* Е-mail: o.bergylevych@med.sumdu.edu.ua V. Kasianchuk Doctor of Veterinary Sciences, Professor* Е-mail: v.kasyanchuk@med.sumdu.edu.ua *Department of Public Health Sumy State University Rymskoho-Korsakova str., 2, Sumy, Ukraine, 40007
1. Introduction
In recent years, researchers have focused on studying Cronobacter genus (formerly Enterobacter sakazakii that has been reclassified into Cronobacter spp in 2007) from Entero-bacteriaceae family [1, 2]. This is a pathogenic Gram-negative, motile, non-spore forming, facultative anaerobic bacterium that causes fatal infection in newborns and infants up to the age of one year, and is transmitted through the consumption of dry infant formula. It can cause necrotizing enterocolitis, bacteraemia and meningitis, predominantly in neonates, particularly those who are premature or immu-nocompromised, resulting in mortality from 40 % to 80 % [3-5]. Ways of transferring this microorganism into dry infant formula are varied. According to the World Health Organization (WHO), there are three basic routes:
a) poor quality of raw milk and other ingredients or their contamination with bacteria from Enterobacteriaceae family;
b) contamination of raw milk and other ingredients from the environment (air, equipment) during processing or after heat treatment with these bacteria, or contamination of ready product during packaging and storage;
c) inadequate hygiene practice during the preparation of powdered infant formula at home [6].
Cronobacter spp is recognized internationally as a dangerous pathogen, and its definition is required for the production of dry infant formula. Therefore, control of Cronobacter
should be carried out at all levels of the food chain, including the microbiological safety of raw milk for preparation of dry infant formula [6].
Cronobacter genus (formerly Enterobacter sakazakii) has been frequently isolated from different environmental sources, including soil, water, various foods (meat and dairy products, vegetables, grains, herbs, spices, and other), facilities of food industry factories [7-11]. After performing systematic review and meta-analysis of published articles, it was reported that Cronobacter genus is more prevalent in plant-related sources with an overall prevalence rate of 20.1 % than the animal-originated sources with an overall prevalence rate of 8 % [12]. Some scientists tend to believe that the gastrointestinal tract of the humans, animals, insects and rodents is the natural harborage site for Cronobacter genus. Fecal-carriage bacteria can survive in soil and water for up to 120 days [13, 14].
Therefore, contamination of raw materials and finished products with water, dust and other objects from the environment can occur. Thus, the potential for product contamination exists throughout the food production chain, including dairy farms and milk processing plants [6, 15].
Although Cronobacter genus has been isolated from a variety of food, food ingredients, food production environments, animal feed and other environmental sources in different countries, there is a lack of information about the presence of Cronobacter in raw cow's milk and facilities in dairy farms in Ukraine.
2. Literature review and problem statement
Prevalence data for Cronobacter genus from raw milk are varied. The first report of isolation of these bacteria from raw milk was published in 1990 [16]. In later research, it was reported that 63 % of raw milk collected from different dairy farms were positive for Cronobacter spp [17]. Several authors [15] also isolated microorganisms of the family En-terobacteriaceae including bacteria Enterobacter sakazakii from raw cow's milk. As others have highlighted, 10.7 % of market milks were contaminated with Enterobacter species, including Enterobacter gergoviae, Enterobacter sakazakii and Enterobacter cancerogenus [18]. In contrast, same researchers were unable to isolate Enterobacter sakazakii (Cronobacter genus) from raw cow's milk [10]. Related results about the occurrence of Cronobacter spp. in raw milk were mentioned in research of other authors [19]. Other observations indicate cases of detection of Cronobacter spp. in different foods including milk powders and infant formula manufactured and marketed in the Netherlands [20]. There is still considerable uncertainty with regard to the presence of Cronobacter spp. in raw milk. Some investigators published their data about the presence of Enterobacteriaceae and especially Cronobacter spp. in products other than milk powders and infant formula. A total of 100 raw milk samples were tested for the presence of Cronobacter spp. but a variety of members of the Enterobacteriaceae family were observed in samples except Cronobacter spp. These bacteria were isolated from milk powder only [21]. As others have highlighted, Cronobacter spp. was isolated from the facilities of the dairy farm [22]. They investigated the objects of livestock farms where cattle and pigs were kept and it was established that these animals were sources of above-mentioned microorganisms in products of animal origin [22, 23]. According to their data, bacteria Cronobacter spp. were not isolated from the feces of cattle, the soil of the farm and water, but they were isolated from other objects such as animal feed, indicating a possible source of the pathogen in the animal's body. A number of studies have found that bacteria Cronobacter spp were identified from the udder of cows with mastitis, and from dairy equipment for the production of dairy products [24].
As seen from the above, there is a large number of scientific reports on the detection of bacteria Cronobacter spp. (E. sakazakii) from various environmental samples and from a wide range of foods.
Methods of isolating Cronobacter spp are based on isolating typical yellow colonies on Trypticase Soy Agar and to confirm its by biochemical properties. Cronobacter genus has broad phylogenetic relationships (Gram-negative, oxidase-negative, catalase-positive, nonspore-forming rods that, in general, are motile, able to reduce nitrate to nitrite and to produce acetoin (Voges-Proskauer test), and negative for the methyl red test) with other members of the genus Enterobacter (E. cloacae, E. herbicola, E. agglomerans) and genus Pantoea (P. agglomerans). The foregoing indicates that classical methods do not always allow to do clear differentiation of representatives of this type of bacteria. The most reliable at present are considered molecular genetic methods based on detecting specific properties of microorganisms that are encoded in their genes. These methods include polymerase chain reaction [1, 3, 4]. According to international scientific literature, several target genes (16SrRNA, gluA, ompA, dnaG, gyrB; MMS atpD, fusA, glnS, gltB, gyrB infB,
ppsA, operon (dnaG, rpsU, rpoD)) are used for molecular typing and identification of this pathogen [25, 26].
Due to the fact that the study of bacteria Cronobacter spp. in Ukraine was recently launched, in the arsenal of national laboratory methods there are no modern diagnostic tests to detect them.
3. The aim and objectives
The aim of this study was to identify the presence of the Cronobacter spp in bulk tank milk and facilities of dairy farms of Sumy region (Ukraine) as a potential source or transmission routes of this pathogen from animals or environment of dairy farms to the raw material.
The following objectives were pursued in this study:
- to investigate the distribution and level of contamination of Cronobacter spp in bulk tank milk and dairy farms facilities in Sumy Region of Ukraine;
- to establish morphological, cultural, biochemical properties of isolates;
- to confirm strains by identification in PCR with amplification of 16S rRNA gene.
4. Materials and methods of isolation and identification of Cronobacter spp
4. 1. Samples collection for investigation
A total of 418 samples were obtained from 5 dairy farms in Ukraine (Sumy region) between 2008 and 2015. The following samples were tested: bulk tank milk (175), secret of udder of cows with a subclinical form of mastitis (53) and environmental samples (50 swabs of milking machines, 43 swabs of milk tanks, 41 swabs from the surface of cow udder, 11 samples of animal feed, 45 swabs from the floor of livestock buildings.
All samples were collected in sterile conditions and carried at 4 °C to the laboratory.
Swabs of milking machines were taken from the inside part of the rubber which can have microorganisms in micro-cracks. Swabs from the surface of cow udder were taken after washing the udder before milk processing.
4. 2. Methods of isolation and identification of Crono-bacter spp. from samples
All these samples were analyzed by a standard isolation method as outlined by the FDA [28]. In brief, the samples were first enriched in Enterobacteriaceae enrichment broth at 36 °C overnight; a loopful of enriched cultures was streaked on VRBG agar (violet red bile glucose agar; Himedia M581) plates and incubated overnight at 36 °C. Five presumptive Cronobacter spp colonies producing yellow pigmentation were picked and re-streaked on TSA (Trypticase Soy Agar; Himedia M290) and incubated at 25 °C for 48-72 h. Typical yellow colonies were picked from TSA, resuspended in physiological saline and subjected to subsequent biochemical characterization using API 20E test strips (BioMerieux, France) according to the manufacturer's instructions.
4. 3. PCR reaction conditions for confirmation of Cronobacter spp. isolates
Twenty isolates of Cronobacter representing five isolates of bulk tank milk, nine environment isolates, one animal
feed, and five udder isolates of cows with a subclinical form of mastitis were verified by PCR amplification of 16S rRNA gene. All oligonucleotide primers derived from the genome of Cronobacter spp strain BAA-894 (Genbank accession number CP000783-5) that flank the gene fragments 16S rRNA were calculated using the VectorNTI, v.11.0.1 software (In-vitrogen) and synthesized by ThermoHybaid Biosciences (Germany). To analyze the DNA nucleotide sequence homol-ogy, Cronobacter genes from other bacteria were compared using e-service BLAST 2.0 (NCBI) and the US module AlignX Software VectorNTI (Fig. 1).
d16SsakF3 (100.0%) d16SsakR (100.0%)
d16sakF1 (100.0%) 2d16S-F (100.0%) rRNA 1 2d16S-R (100.0%)
NR 102490 16S 1542 bp
Fig. 1. Characteristics of homology of oligonucleotide primers at gene 16S rRNA Cronobacter spp (genome of Cronobacter sakazakii strain BAA-894): 16sakF1 - TAACTCCGTGCCAGCAGCC (451 bp), d16SsakR - TAAACCACATGCTCCACCGCT (451 bp), d16SsakF3 - GGCAGGCTTGAGTCTCGTAG (314 bp), 2d16S-F - AGCTAATACCGCATAACGTCTACG (863 bp), 2d16S-R - AGGCACTCCCGCATCTCTG (863 bp)
detection of mastitis in cows. The results were confirmed by the counting of somatic cells13366-1(IDF 148-1:2008).
Table 1
Detection of Cronobacter spp from raw cow milk samples
Farms Ranges of total bacterial counts (CFU ml -1) Class of milk No. of investigated samples No. of positive samples Percentages, %
Farm 1 7.8x104 Extra 13 1 7.7
Farm 2 8.3x104 Extra 15 2 13.3
2.8x105 Higher 57 13 22.8
Farm 3 9.5x104 Extra 17 3 17.6
2.7x105 Higher 43 9 20.9
Farm 4 9.3x104 Extra 15 2 13.3
Farm 5 9.4x104 Extra 15 2 13.3
- - Extra 75 12 16
- - Higher 100 22 22
Total 175 34 19.4 %
Table 2
Results of detection of Cronobacter spp from secret of udder of cows with a subclinical form of mastitis
For amplification, reaction mixtures containing primers were prepared by using Taq reaction mixture as before (reference or given details including the amount of template DNA, primers, dNTPs, and other components). Thermal cycling was carried out by using an initial denaturation step of 94 °C for 3 min (1 cycle), followed by 35 cycles of denatur-ation at 94 °C for 30 sec, annealing at (given temperature) for 1 min, and elongation at 72 °C for 1 min 30 sec. Cycling was completed by a final elongation step at 72 °C for 4 min. The reaction products were resolved on a 1.5 % agarose gel followed by ethidium bromide staining and examination under UV light.
5. Research findings on isolation and identification of Cronobacter spp
All presumptive Cronobacter spp colonies produce yellow pigment on VRBG and exhibited positive glucosidase activity when tested in API 20E test strips. Ukraine has established national standards for raw milk that are intended for dry infant formula production. The raw milk should be of grade (class) Extra or Higher and the total microbial counts in Extra and Higher grades should not exceed 1x106 CFU ml-1, 3x106 CFU ml-1, respectively. Here we analyzed 175 samples of raw cow's milk that are graded Extra class and Higher class. The total microbial counts in these milk samples varied from 7.8*104 CFU ml-1 to 2.7x105 CFU ml-1. Analysis of 75 grade Extra milk revealed that 12 samples (16 %) were positive for Cronobacter spp, while 22 (22 %) samples from 100 Higher grade milk samples were positive. Altogether, 19.4 % of raw milk samples were positive for Cronobacter spp, as shown in Table 1.
A total of 53 samples of the secret of the udder of cows with a subclinical form of mastitis were analyzed, and 17 (32.1 %) of them were positive, as shown in Table 2. Rapid mastitis test (California mastitis test, CMT) was used for
Farms No. of investigated samples No. of positive samples Percentages, %
Farm 1 7 1 14.7
Farm 2 10 3 30.0
Farm 3 14 5 35.7
Farm 4 10 4 40.0
Farm 5 12 4 33.3
Total 53 17 32.1
A total 190 environmental samples (50 swabs of milking machines, 43 swabs of milk tanks, 41 swabs from the surface of cow udder, 11 samples of animal feed, 45 swabs from the floor of livestock buildings) were examined. As shown in Table 3, 73 samples (38.4 %) were positive.
Table 3
Results of detection of Cronobacter spp from environmental samples
Farms No. of investigated samples No. of positive samples Percentages, %
Farm 1 30 5 16.7
milking machines 8 0 0
milk tanks 6 0 0
skin of the cow udder 5 0 0
animal feed 2 0 0
floor of livestock buildings 9 5 55.6
Farm 2 37 12 32.4
milking machines 12 2 16.7
milk tanks 7 0 0
skin of the cow udder 6 2 33.3
Initially, 20 isolates were identified as suspected isolates with typical cultural and biochemical properties (5 from milk, 1 from the udder and 14 from the milk production facility) (Fig. 2, a, b, Fig. 3, a, b).
9-
V v
20.00kV xlO.Ok
b
Fig. 2. Bacteria cells of Cronobacter spp (Enterobacter sakazakii): a — cell cluster; b — measurements of cells (canning electron microscope)
b
Fig. 3. Typical colonies of Cronobacter spp (Enterobacter sakazakii): a — on Violet Red Bile Glucose Agar (the left half of Petri dish has typical dark red colonies, the right half of Petri dish has no typical colonies); b — on Trypticase Soy Agar
Several pairs of oligonucleotide primers specific for different domains of gene 16SrRNA were developed and used in PCR for identifying bacteria Cronobacter spp. (Enterobacter sakazakii) by polymerase chain reaction. Some positive results with 20 isolates of bacteria were obtained (Fig. 4).
b
Fig. 4. The results of electrophoretic analysis of PCR products with primers d16sakF1/d16SsakR: a — M-marker "100 bpPlusDNALadder" (Fermentas); 1, 2 - deposited strain of Cronobacter spp; 3 — isolate (milk); 4 — isolate (udder); 5 — isolate (animal feed); C(-) — negative control; b — M-marker "100 bpPlusDNALadder" (Fermentas);
1 — 18 — selected isolates of Cronobacter spp; K1, K2 — heterologous negative controls (B. subtilis, E. coli)
As shown in Fig. 4, a, b, Cronobacter spp (formerly Enterobacter sakazakii) can be detected from samples with using 16SrRNA gene in PCR.
6. Discussion of the research findings on isolation and identification of Cronobacter spp
Quality and safety of raw milk depend on the quantity and qualitative composition of the microflora that get into it during production. It is known that microflora of raw milk affects the health of dairy cows, sanitary conditions of farms and milking equipment [7, 10, 13, 15, 18, 25]. In recent years, special attention of researchers has been focused on studying new pathogens. New pathogens include bacteria of Cronobacter genus (formerly Enterobacter sakazakii), which is especially dangerous for babies up to a year. These microorganisms are opportunistic pathogens that can cause serious infections (necrotizing colitis and meningitis) in neonates after consumption of PIF and mortality ranges from 40 % to 80 % [2, 5, 11, 23, 24].
a
a
The natural reservoir of Cronobacter genus and way of transmission are still not clear but infant formula has been epidemiologically implicated in several clinical cases. There are mixed reports of Cronobacter genus presence in raw milk. There were unsuccessful attempts to isolate this bacterium from raw milk [16]. Later, the same investigations reported that 63 % of raw milk samples from dairy farms were positive [17]. The aim of our study was to establish the presence of Cronobacter genus in bulk tank milk. Also, our aim was to examine possible sources of these bacteria in dairy farms. With this, 190 environmental samples (swabs of milking machines, milk tanks, from the surface of cow udder, from the floor of livestock buildings and samples of animal feed) were collected from 5 dairy farms in Sumy Region, Ukraine. They were investigated for establishing their role in the transmission of Cronobacter spp. Samples of bulk tank milk were obtained from cows that are kept on 2 types of dairy farms. In one type of farms (2 farms), milking of cows was conducted in stalls in the milk line with portable milking machines. In the second type of farms, milking of cows was conducted in milking parlors by using two-stroke milking machines (DeLaval). The average milk yield for a cow is 8-9.5 thousand litters. A wide range of samples (n=418) was collected and examined for the presence of Cronobacter spp. using the FDA method and then confirmed by PCR targeting of the 16S rRNA gene. The cultural method helped to isolate presumptive positive colonies and API 20E test helped to identify the organism.
PCR assay targeting of the 16S rRNA gene sequence has been used for Cronobacter identification before [21, 24, 23]. In this study, we tested 20 isolates with PCR and all were accurately identified. It was determined that 19.4 % of raw milk samples were positive for Cronobacter spp and the pathogen is widespread in the dairy environment. We also isolated the pathogen from the udder secretion of cows (32 %) that were suffering from subclinical mastitis. Not all dairy farms in Ukraine have indicators of subclinical mastitis in milk equipment. Therefore, subclinical mastitis in cows in Ukraine is determined once a week with using rapid mastitis test (CMT) and confirmed by the microscopic method for the counting of somatic cells in cows' milk. Unfortunately, milk from cows with a subclinical form of mastitis may fall into the total bulk milk.
Similar results were also reported by researchers who were able to isolate this bacterium from the secretions of the affected mammary gland in heifers [28]. Cronobacter spp enters the milk through the udder, when the cattle are reared in the unhygienic condition. This bacterium is also isolated
from mastitis infected raw milk around the Chikmagalur District in India [25]. Several other researchers failed to isolate the pathogen from raw cow's milk [16, 19, 21].
Same research data indicate that the environment of livestock could be a source of this pathogen in animal origin products [13]. They determined that the feces of cattle, farm soil and water were negative while the animal feed was positive, which may be the possible source of the microorganism in animal body. Other observations indicate the presence of the bacteria in animal feed [28]. Several researchers found Cronobacter genus (formerly Enterobacter sakazakii) from various objects in the dairy farm [13, 29]. Although several reports have been published describing the prevalence of Cronobacter spp in food and environmental samples, a similar study on the prevalence of these bacteria in raw cow's milk and dairy farm environment has not been undertaken to date in Ukraine.
7. Conclusions
1. The results indicate that the dairy farm environments are a potential source of Cronobacter in raw milk. It was found that detection of these bacteria from raw cow's milk on average is 19.4 %.
2. Several pairs of oligonucleotide primers specific for different domains of gene 16SrRNA were developed and used in PCR for identifying bacteria Cronobacter spp. (Enterobacter sakazakii) by polymerase chain reaction. Positive results with 20 isolates of bacteria were obtained.
3. We suggest that control of bacteria Cronobacter spp should be carried out at all levels of the food chain, including the process of obtaining raw milk, which as a raw material for dry infant formula may be a potential contaminant of the finished products. These data will be valuable for microbiological risk assessment and help authorities to develop strategies to mitigate health risk.
Acknowledgements
We would like to convey gratitude to our colleague Prof. Arun K. Bhunia from Purdue University (USA) for his consultations and assistance in preparing this article. The authors also express their gratitude to O. Deryabin from State Scientific Control Institute of Biotechnology and Strains of Microorganisms (Kyiv, Ukraine) for the help in conducting the gene-molecular research.
References
1. Iversen, C. Cronobacter gen. nov., a new genus to accommodate the biogroups of Enterobacter sakazakii, and proposal of Cronobacter sakazakii gen. nov., comb. nov., Cronobacter malonaticus sp. nov., Cronobacter turicensis sp. nov., Cronobacter muytjensii sp. nov., Cronobacter dublinensis sp. nov., Cronobacter genomospecies 1, and of three subspecies, Cronobacter dublinensis subsp. dublinensis subsp. nov., Cronobacter dublinensis subsp. lausannensis subsp. nov. and Cronobacter dublinensis subsp. lactaridi subsp. nov. [Text] / C. Iversen, N. Mullane, B. McCardell, B. D. Tall, A. Lehner, S. Fanning et. al. // International Journal of Systematic and Evolutionary Microbiology. - 2008. - Vol. 58, Issue 6. - P. 1442-1447. doi: 10.1099/ ijs.0.65577-0
2. Joseph, S. Cronobacter condimenti sp. nov., isolated from spiced meat, and Cronobacter universalis sp. nov., a species designation for Cronobacter sp. genomospecies 1, recovered from a leg infection, water and food ingredients [Text] / S. Joseph, E. Cetinkaya, H. Drahovska, A. Levican, M. J. Figueras, S. J. Forsythe // International Journal of Systematic and Evolutionary Microbiology. -2011. - Vol. 62, Issue Pt 6. - P. 1277-1283. doi: 10.1099/ijs.0.032292-0
3. Mullane, N. R. Enterobacter sakazakii: an emerging bacterial pathogen with implications for infant health [Text] / N. R. Mullane, C. Iversen, B. Healy, C. Waish, P. Whyte, P. G. Wall, T. Quinn, S. Fanning // Minerva Pediatrica. - 2007. - Vol. 59, Issue 2. -P. 137-148.
4. Yan, Q. Q. Cronobacter species (formerly known as Enterobacter sakazakii) in powdered infant formula: a review of our current understanding of the biology of this bacterium [Text] / Q. Q. Yan, O. Condell, K. Power, F. Butler, B. D. Tall, S. Fanning // Journal of Applied Microbiology. - 2012. - Vol. 113, Issue 1. - P. 1-15. doi: 10.1111/j.1365-2672.2012.05281.x
5. Hunter, C. J. Cronobacter: an emerging opportunistic pathogen associated with neonatal meningitis, sepsis and necrotizing enterocolitis [Text] / C. J. Hunter, J. F. Bean // Journal of Perinatology. - 2013. - Vol. 33, Issue 8. - P. 581-585. doi: 10.1038/ jp.2013.26
6. Enterobacter sakazakii and other microorganisms in powdered infant formula [Electronic resource]. - Available at: http:// www.who.int/foodsafety/publications/micro/es.pdf
7. Shaker, R. Isolation of Enterobacter sakazakii and other Enterobacter sp. from food and food production environments [Text] / R. Shaker, T. Osaili, W. Al-Omary, Z. Jaradat, M. Al-Zuby // Food Control. - 2007. - Vol. 18, Issue 10. - P. 1241-1245. doi: 10.1016/j.foodcont.2006.07.020
8. Friedemann, M. Enterobacter sakazakii in food and beverages (other than infant formula and milk powder) [Text] / M. Friedemann // International Journal of Food Microbiology. - 2007. - Vol. 116, Issue 1. - P. 1-10. doi: 10.1016/j.ijfoodmicro.2006.12.018
9. Molloy, C. Surveillance and characterisation by Pulsed-Field Gel Electrophoresis of Cronobacter spp. in farming and domestic environments, food production animals and retail foods [Text] / C. Molloy, C. Cagney, S. O'Brien, C. Iversen, S. Fanning, G. Duffy // International Journal of Food Microbiology. - 2009. - Vol. 136, Issue 2. - P. 198-203. doi: 10.1016/j.ijfoodmicro. 2009.07.007
10. Baumgartner, A. Detection and frequency of Cronobacter spp. (Enterobacter sakazakii) in different categories of ready-to-eat foods other than infant formula [Text] / A. Baumgartner, M. Grand, M. Liniger, C. Iversen // International Journal of Food Microbiology. - 2009. - Vol. 136, Issue 2. - P. 189-192. doi: 10.1016/j.ijfoodmicro.2009.04.009
11. Healy, B. Cronobacter(Enterobacter sakazakii): An Opportunistic Foodborne Pathogen [Text] / B. Healy, S. Cooney, S. O'Brien, C. Iversen, P. Whyte, J. Nally et. al. // Foodborne Pathogens and Disease. - 2010. - Vol. 7, Issue 4. - P. 339-350. doi: 10.1089/ fpd.2009.0379
12. Norrakiah, A. S. Occurrence and prevalence of Cronobacter spp. in plant and animal derived food sources: a systematic review and meta-analysis [Text] / A. S. Norrakiah, O. A. Odeyemi // SpringerPlus. - 2015. - Vol. 4, Issue 1. - P. 545-555. doi: 10.1186/ s40064-015-1324-9
13. Molloy, C. Examination of cattle faeces, dairy farm and food environs for the presence of E. sakazakii [Text] / C. Molloy, C. Cagney, S. Fanning // 21st International Committee for Food Microbiology and Hygiene Symposium, Evolving Microbial Food Quality and Safety. - Aberdeen, 2008. - P. 504.
14. Molloy, C. Surveillance and characterisation by Pulsed-Field Gel Electrophoresis of Cronobacter spp. in farming and domestic environments, food production animals and retail foods [Text] / C. Molloy, C. Cagney, S. O'Brien, C. Iversen, S. Fanning, G. Duffy // International Journal of Food Microbiology. - 2009. - Vol. 136, Issue 2. - P. 198-203. doi: 10.1016/ j.ijfoodmicro.2009.07.007
15. Bergilevich, O. The level of contamination raw cow's milk by microorganisms of the family Enterobacteriaceae including bacteria Enterobacter sakazakii at farms of Ukraine [Text] / O. Bergilevich, V. Kasianchuk, A. Marchenko // Food Hygiene and Technology. 43st Lenfeld's and Hökl's Days. - 2013. - P. 100-103.
16. Muytjens, H. L. Enterobacter sakazakii meningitis in neonates [Text] / H. L. Muytjens, L. A. A. Kollee // The Pediatric Infectious Disease Journal. - 1990. - Vol. 9, Issue 5. - P. 372. doi: 10.1097/00006454-199005000-00016
17. Norrakiah, A. S. Cronobacter (Enterobacter) sakazakii. Enterobacteriaceae and aerobic plate count in raw and pasteurized milk [Text] / A. S. Norrakiah // 1st International Conference on Cronobacter. - 2009.
18. Salman, A. M. A. Enumeration and identification of Coliform bacteria from raw milk in Khartoum State, Sudan [Text] / A. M. A. Salman, I. M. Hamad // Journal of Cell and Animal Biology. - 2011. - Vol. 5, Issue 7. - P. 121-128.
19. Baumgartner, A. Occurrence of Cronobacter spp. in raw milk [Text] / A. Baumgartner, I. Niederhauser // Journal für Verbraucherschutz und Lebensmittelsicherheit. - 2010. - Vol. 5, Issue 2. - P. 253-253. doi: 10.1007/s00003-010-0589-8
20. Kandhai, M. C. A study into the occurrence of Cronobacter spp. in The Netherlands between 2001 and 2005 [Text] / M. C. Kandhai, A. E. Heuvelink, M. W. Reij, R. R. Beumer, R. Dijk, J. J. H. C. van Tilburg et. al. // Food Control. - 2010. - Vol. 21, Issue 8. -P. 1127-1136. doi: 10.1016/j.foodcont.2010.01.007
21. Lehner, A. Identification of Enterobacteriaceae and Cronobacter spp. in raw milk, milk concentrate and milk powder: prevalence and genotyping [Text] / A. Lehner, C. Fricker-Feer, K. Gschwend, R. Stephan // Archiv für Lebensmittelhygiene. - 2010. - Issue 61. -P. 22-26.
22. Buma, R. Isolation and characterization of pathogenic bacteria, including Escherichia coli O157: H7,from flies collected at a dairy farm field [Text] / R. Buma, H. Sanada, T. Maeda, M. Kamei, H. Kourai // Medical Entomology and Zoology. - 1999. - Vol. 50, Issue 4. - P. 313-321. doi: 10.7601/mez.50.313
23. Bergilevich, O. Identification of Cronobacter spp. (Enterobacter sakazakii) using PCR [Text] / O. Bergilevich, V. Kasianchuk, O. Deriabin // Food Hygiene and Technology 45th Lenfeld's and Hökl's Days. - Brno, 2015. - P. 5-8. - Available at: https:// cit.vfu.cz/konference/lh2015/4download/sbornik.pdf
24. Salmon, S. A. Minimum Inhibitory Concentrations for Selected Antimicrobial Agents Against Organisms Isolated from the Mammary Glands of Dairy Heifers in New Zealand and Denmark [Text] / S. A. Salmon, J. L. Watts, F. M. Aarestrup, J. W. Pankey, R. J. Yancey // Journal of Dairy Science. - 1998. - Vol. 81, Issue 2. - P. 570-578. doi: 10.3168/jds.s0022-0302(98)75610-3
25. Lehner, A. Comparison of two chromogenic media and evaluation of two molecular based identification systems for Enterobacter sakazakii detection [Text] / A. Lehner, S. Nitzsche, P. Breeuwer, B. Diep, K. Thelen, R. Stephan // BMC Microbiology. - 2006. -Vol. 6, Issue 1. doi: 10.1186/1471-2180-6-15
26. Vineeth, B. Isolation and partial characterization of Cronobacter sakazakii by 16S rRNA sequence analysis isolated from milk of dairy cows with mastitis in Chikmagalur, Karnataka, India [Text] / B. Vineeth, B. Priyanka, B. S. Ramesh, K. Makari Hanumanthappa, M. N. Vinay Suvarna // International Journal of Scientific and Engineering Research. - 2014. - Vol. 5, Issue 4. - P. 671-680.
27. Seo, K. H. Rapid, Specific Detection of Enterobacter sakazakii in Infant Formula Using a Real-Time PCR Assay [Text] / K. H. Seo, R. E. Brackett // Journal of Food Protection. - 2005. - Vol. 68, Issue 1. - P. 59-63. doi: 10.4315/0362-028x-68.1.59
28. Isolation and enumeration of Enterobacter sakazakii from dehydrated powdered infant formula [Electronic resource]. - FDA. -2002. - Available at: https://www.fda.gov/
29. Liu, Y. PCR and oligonucleotide array for detection of Enterobacter sakazakii in infant formula [Text] / Y. Liu, Q. Gao, X. Zhang, Y. Hou, J. Yang, X. Huang // Molecular and Cellular Probes. - 2006. - Vol. 20, Issue 1. - P. 11-17. doi: 10.1016/ j.mcp.2005.08.004
30. Friedemann, M. Epidemiology of invasive neonatal Cronobacter (Enterobacter sakazakii) infections [Text] / M. Friedemann // European Journal of Clinical Microbiology & Infectious Diseases. - 2009. - Vol. 28, Issue 11. - P. 1297-1304. doi: 10.1007/s10096-009-0779-4
