CC BY
9OECD+WoS: 1.06+RQ (Mycology) https://doi.org/10.31993/2308-6459-2020-103-3-13331
Short communication
IDENTIFICATION OF SUNFLOWER PATHOGENIC FUNGUS PLENODOMUS LINDQUISTII USING PCR WITH SPECIES-SPECIFIC OLIGONUCLEOTIDE PRIMERS
М.М. Gomzhina*, Ph.B. Gannibal
All-Russian Institute of Plant Protection, St. Petersburg, Russia
*corresponding author, e-mail: [email protected]
Plenodomus lindquistii causes Phoma black stem of sunflower which is the most common stem disease of this crop in Russia. The diagnostics of both field specimens and pure cultures of P lindquistii is troublesome. Molecular methods involving the use of the PCR are rapid diagnostic express tests that can precisely identify and detect fungal species. The aim of this study was to develop species-specific oligonucleotide primers for selective amplification of P lindquistii DNA. The primers LepliF2/LepliR2 were designed on the basis of ITS region analysis and showed stable amplification of the target fungus DNA with no cross-reaction with other fungal species. The primers are recommended for express detection of the causative agent of Phoma black stem of sunflower. This is the first PCR assay that could be used to rapidly reveal and identify this pathogen.
Keywords: molecular diagnostic, Phoma black stem, sunflower Received: 06.05.2020 Accepted: 19.08.2020
Introduction
Plenodomus lindquistii (Frezzi) Gruyter, Aveskamp & Verkley (syn. Leptosphaeria lindquistii Frezzi, Revta, Phoma macdonaldii Boerema, Phoma oleraceae var. helianthi-tuberosi Sacc.) causes Phoma black stem of sunflower (Helianthus annuus L.). This is the most common stem disease of sunflower in Russia and worldwide (McDonald, 1964; Boerema et al., 1981; Acimovic, 1984; Donald et al., 1987; Maric et al., 1988; Sackston, 1992; Chandreshekar, 1993; Peres, Lefol, 1996; Gulya et al., 1997). In Australia (Chandrashekar, 1993) and China (Wu et al., 2012) the Phoma stem canker causal agent, P lindquistii, is of quarantine significance. In Russia this fungus is widespread in all sunflower producing regions, such as Krasnodar territory (Borodin, Kotlyarova 2006; Saukova et al., 2014), Tambov province (Vypritskaya et al., 2010), Volgograd province (Saukova et al., 2018), Belgorod province, Central Black Earth region, and North Caucasus (Yakutkin, 2001; 2005). Under favorable conditions the fungus can lead to yield losses up to 70 %.
The diagnostics of P. lindquistii under the field conditions is rather difficult because Phoma black stem can be confused with Phomopsis stem canker (causal agents are Diaporthe spp.). Identification of P lindquistii isolates is usually based on morphological criteria of asexual structures: pycnidia
and conidia, but it is often unreliable due to substantial morphological similarity of many related phoma-like species. Correct identification of P. lindquistii in pure culture is laborious, time consuming, and requires special conditions and different culture media.
Molecular methods based on PCR are rapid diagnostic express tests that can contribute to detection and precise identification of fungal species in vitro. Nuclear rDNAs particularly in the internal transcribed spacer (ITS) regions are good targets for phylogenetic analysis in fungi (Bruns et al. 1991). It was demonstrated that oligonucleotide specific primers targeting the ITS region selectively detect many agriculturally important fungi including sunflower pathogen Macrophomina phaseolina (Babu et al., 2007) and some Phoma-like fungi, e.g. P. lingam and P. biglobosus (Mahuku et al., 1996).
Currently there are no molecular techniques based on PCR for correct identification of P. lindquistii - the causal agent of Phoma black stem of sunflower. The aim of this study was to develop specific oligonucleotide primers and to subsequently evaluate their efficiency and specificity for identification and detection of P. lindquistii.
Materials and Methods
Fungal isolates. As a result of the extensive studies of fungal biodiversity on sunflower carried out in 2015-2019 in different geographical locations in Russia 177 P. lindquistii isolates were collected by authors from the surface of sterilized stems exhibiting typical symptoms of Phoma black stem. All isolates were stored in the collection of pure cultures of the All-Russian Institute of Plant Protection (VIZR, St. Petersburg).
DNA extraction, PCR and sequencing. Mycelium was obtained from cultures, incubated on potato sugar agar (PSA) and macerated with 0.3 mm glass sand on a MM400 mixer mill (Retsch, Germany). Genomic DNA was then extracted according to a standard CTAB/chloroform method (Doyle, Doyle, 1990).
Four isolates, i.e. one from Lipetsk region (MF Ha15-001) and three from Krasnodar territory (MF Ha16-001, MF Ha16-004, and MF Ha16-005), were selected for sequencing of ITS region. The primers ITS1 and ITS4 (White et al., 1990) were used to amplify the ITS region. The amplification reactions had a total reaction volume of 25 |il which was composed of dNTPs (200 ^M), each of the forward ITS1 and reverse ITS4 primers (0.5 ^M), Taq DNA-polymerase (5 U/^l), 10x PCR buffer with Mg2+ and NH4+ ions and total genomic DNA (approx. 1 ng). The PCR conditions were as follows: predenaturation of DNA at 95 °C for 5 min; 35 cycles of denaturation at 92 °C for 50 s, annealing at 55 °C, 40 s, and elongation at 72 °C for 75 s; followed by a final elongation step for 5 min at 72 °C.
Amplicons were purified according to the standard method with a DNA-binding silica matrix (Boyle, Lew, 1995). Visualization and concentration measurements of the purified PCR products were implemented by electrophoresis in 1 % agarose gel stained with ethidium bromide and MassRuler 1000 bp as a marker of concentration.
Amplicons were sequenced by Sanger's method (1977) on ABIPrism 3500 (Applied Biosystems - Hitachi, Japan), with the Big Dye Terminator v3.1 Cycle Sequencing Kit (ABI, Foster City, USA), according to the manufacturer's instructions. All sequences were deposited in the GenBank with the following accession numbers: MK495985, MK495986, MK495987, and MK495988.
Development of specific oligonucleotide primers. Four sequences obtained during this study, reference sequence of the ex-type culture of P. lindquistii CBS 381.67 and sequences
of other fungi were aligned using the ClustalX 1.8 (Thompson et al., 1997). The regions, which were conserved among the isolates and specific for P. lindquistii, were selected to design species specific oligonucleotide primers. Three pairs of primers were designed using Primer3plus online software with default options. The parameters such as percentage of G+C content and absence of self-complementarity were analyzed by Primer3plus. Sequences, annealing temperature and size of product are listed in the Table. The theoretical specificity of the primers set was checked with the sequences from the other fungi in GenBank by the BLASTn analysis.
The PCR conditions were as follows: predenaturation of DNA at 94 °C for 2 min; 30 cycles of denaturation at 92 °C for 50 s, annealing at according temperature (Table) for 30 s, and elongation at 72 °C for 75 s; followed by a final elongation step for 5 min at 72 °C.
Table. New oligonucleotide primers for species-specific amplification of ITS locus in rDNA Plenodomus lindquistii
Primer pair Primer name Nucleotide sequence, Annealing temperature, °C Expected amplicon size, b.p.
1 LepliF CTGGGTCTTTTGCTCCATGT 60.1 104
LepliR TTTTGTCCTATCGGCGGG 61.9
2 LepliF2 TGCTCCATGTACCAGCTCA 58.9 178
LepliR2 CGATGCCAGAACCAAGAGAT 60.2
3 LepliF3 TCCATGTACCAGCTCACCTC 58.7 250
LepliR3 TGTGCGTTCAAAGATTCGAT 59.3
Specificity evaluation of oligonucleotide primers was carried out by PCR with DNA of eight P lindquistii isolates (MF Ha16-001 - MF Ha16-008) as positive amplification control. As negative amplification control we used the DNA of the next 16 isolates representing various groups of fungi, including both ascomycetes and basidiomycetes, i.e. Alternaria atra (MF 150-011), Armillaria sp. (MF A1), Ascochyta kamchatica (MF 010-031), Boeremia exigua (MF 17-75), Colletotrichum fioriniae (MF Vm17-043), Diaporthe gulyae (MF Ha17-042),
D. eres (MF Vm17-001), Didymella glomerata (MF 32.38.1), D. pomorum (MF 9.232.1), Fusarium avenaceum (MF 60101), Ganoderma sp. (MF G), Plenodomus biglobosus (MF 4.105), P. lingam (MF 4.34), Paraphoma melnikiae (MF 9.88), Neopyrenochaeta acicola (MF 52.5), Stagonosporopsis inoxydabilis (MF 010-020). The most specific primer pair was tested with all 177 P. lindquistii isolates from the VIZR pure culture collection.
Results and Discussion
The primers LepliF/LepliR failed to amplify ITS region of eight tested P. lindquistii isolates. Whereas primers LepliF2/ LepliR2 and LepliF3/Lepli3R yielded single amplified product each of 250 and 180 bp respectively (Fig. 1). However, amplification with the primers LepliF3/LepliR3 generated the target product for six isolates out of eight. Amplification with primers LepliF2/LepliR2 was successful for all DNA samples (Fig. 1).
Both primer pairs, LepliF2/LepliR2 and LepliF3/LepliR3, were found to be specific for P. lindquistii as none of the other fungi tested could yield any amplification product under identical conditions of amplification (Fig. 2, 3).
Figure 2. Test for LepliF2/LepliR2 primers specificity for DNA of Plenodomus lindquistii isolates (lanes 1-4) and isolates of other fungi (lanes 5-20; fungal species are listed in Material and Methods section. M marks GeneRuler ladder 1000 bp.
i««i)|i 250 bp
Figure 1. Test for primers LepliF3/LepliR3 (left) and LepliF2/ LepliR2 (right) specificity for DNA of eight Plenodomus lindquistii isolates. M marks GeneRuler ladder 1000 bp.
Figure 3. Test for LepliF3/LepliR3 primers specificity for DNA of Plenodomus lindquistii isolates (lanes 1-4) and isolates of other fungi (lanes 5-20; fungal species are listed in Material and Methods section. M marks GeneRuler ladder 1000 bp.
The primer pair LepliF2/LepliR2 was preliminary verified as having the highest specificity for amplification of P. lindquistii ITS region. The PCR analysis has resulted in sustainable yield of single products of 250 bp for all 177 P. lindquistii isolates, collected from infected sunflower harvested in different years in various geographical locations in Russia
Thus, the use of LepliF2/LepliR2 primers resulted in more specific, reproducible and consistent amplification of rDNA of different P. lindquistii isolates than other two primer pairs. This is the first report on development of specific primers for the molecular identification and detection of P. lindquistii.
References
Acimovic M (1984) Sunflower diseases in Europe, the United
States and Australia. Helia 7:45-54 Babu KB, Saxena AK, Srivastava AK, Arora DK (2007) Identification and detection of Macrophomina phaseolina by using species specific oligonucleotide primers and probe. Mycologia 99(6):797-803 Boerema GH, van Kesteren HA, Loerakker WM (1981) Notes
on Phoma. Trans Br Mycol Soc 77:61-74 Borodin SG, Kotlyarova IA (2006) [Sunflower diseases in the Krasnodar territory]. Bolezni i vrediteli maslichnykh kultur 3-10 (In Russian) Boyle JS, Lew AM. (1995) An inexpensive alternative to
glassmilk for DNA purification. Trends Genet 11(1):8 Bruns TD, White TJ, Taylor JW (1991) Fungal molecular
systematicis. Ann Rev Ecol Syst 22:525-564 Chandrashekar M (1993) Evaluation of Seedborne Quarantinable Diseases of Oilseeds: Carthamus, Glycine, Helianthus, Linum and Ricinus. Department of Primary Industries and Energy Bureau of Resource Sciences. A review commissioned by the Australian Quarantine and Inspection Service (AQIS). Canberra Donald PA, Venette JR, Gulya TJ (1987) Relationship between Phoma macdonaldii and premature death of sunflower in North Dakota. Plant Disease 71:466-468 Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh
tissue. Focus 12:13-15. Gulya TJ, Rashid KY, Masirevic SM (1997) Sunflower diseases. In Sunflower Technology and Production. Madison, WI: American Society of Agronomy Mahuku GS, Hall R, Goodwin PH (1996) Co-infection and induction of systemic acquired resistance by weakly and highly virulent isolates of Leptosphaeria maculans in oilseed rape. Physiol Mol Plant Pathol 49:61-72 Maric A, Camprag D, Masirevic S (1988) Bolesti I Stetocine suncokreta. Belgrad, Yugoslavia: Injihovosuzbijanje Nolit. 37-45
McDonald WC (1964) Phoma black stem of sunflowers.
Phytopathology 54:492-493 Peres A, Lefol C (1996) Phoma macdonaldii Boerema: elements de biologie et mise au point d'une method de
Вестник защиты растений, 2020, 103(3), с. 207-210 OECD+WoS: 1.06+RQ (Mycology)
contamination artificielle en conditions controlees. Proc. 14th Intern. Sunfl. Conf. Beijing, China. 687-693 Sackston WE (1992) On a treadmill: Breeding sunflowers for
resistance to disease. Annu Rev Phytopathol 30:529-551 Samson RA, Hoekstra ES, Frisva DJC, Filtenborg O (2000) Introduction to food and airborne fungi, 6th edition. Centraal bureau voor schimmel cultures, Utrecht Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74(12):5463-5467 Saukova SL, Ivebor MV, Antonova TS, Araslanova NM (2014) [Causal agent of the Phoma black stem of sunflower in the Krasnodar territory]. Maslichnye kultury: nauch-tech byul VNIIMK 2(159-160):167-172 (In Russian) Saukova SL, Araslanova NM, Antonova TS, Ivebor MV (2018) [Phoma black stem (Phoma macdonaldii Boerema) in the sunflowers seeds]. Maslichnye kultury: nauch-tech byul VNIIMK 2(174):107-111 (In Russian) Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl Acids Res 24:4876-4882 Vypritskaya AA, Putchnin AM, Kuznetsov AA, Mustafin II (2010) [Species list and harmfulness of mycobiota of sunflower seeds in the Tambov region]. Maslichnye kultury: nauch-tech byul VNIIMK 1(142-143):62-67 (In Russian) White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: MA Innis, DH Gelfand, JJ Sninsky & TJ White (eds.): PCR Protocols: A guide to Methods and Applications. Academic Press, San Diego, USA. 315-322 Wu PS, Du HZ, Zhang XL, Luo F, Fang L (2012) Occurrence of Phoma macdonaldii, the causal agent of sunflower black stem disease, in sunflower Fields. Plant disease 96(11):1696 Yakutkin VI (2001) [Sunflower diseases and their control in Russia]. Zashchita i karantin rasteniy 10:26-28 (In Russian) Yakutkin VI (2005) [Forecast and control of sunflower diseases in Russia in 2005]. Zashchita i karantin rasteniy 5:41 (In Russian)
https://doi.org/10.31993/2308-6459-2020-103-3-13331
Краткое сообщение
ИДЕНТИФИКАЦИЯ ПАТОГЕННОГО ДЛЯ ПОДСОЛНЕЧНИКА ГРИБА PLENODOMUS LINDQUISTII С ИСПОЛЬЗОВАНИЕМ ПЦР С ВИДОСПЕЦИФИЧНЫМИ ПРАЙМЕРАМИ
М.М. Гомжина*, Ф.Б. Ганнибал
Всероссийский научно-исследовательский институт защиты растений, Санкт-Петербург
* ответственный за переписку, e-mail: [email protected]
Plenodomus lindquistii - возбудитель фомоза подсолнечника (чёрной стеблевой пятнистости) - заболевания, которое широко распространено в России во всех регионах, возделывающих эту культуру. Диагностика этого заболевания, как в полевых, так и в лабораторных условиях весьма затруднительна. Одним из методов молекулярной
диагностики фитопатогенных грибов является ПЦР с видоспецифичными праймерами. Такой метод позволяет проводить высокоточную детекцию и идентификацию целевых объектов. Цель данной работы заключалась в разработке видоспецифичных олигонуклеотидных праймеров, избирательно амплифицирующих ДНК гриба P. lindquistii. Праймеры LepliF2/LepliR2, разработанные на основе анализа ITS локуса, показали стабильную амплификацию ДНК целевого гриба при отсутствии кросс-реакции с другими видами грибов. Эти праймеры могут быть рекомендованы для проведения экспресс-диагностики возбудителя фомоза подсолнечника. Данная работа представляет собой первую разработку в области молекулярной экспресс-диагностики этого патогена.
Ключевые слова: молекулярная диагностика, фомоз, чёрная стеблевая пятнистость, подсолнечник Поступила в редакцию: 06.05.2020 Принята к печати: 19.08.2020
OECD+WoS: 4.01+AM (Agronomy) https://doi.org/10.31993/2308-6459-2020-103-3-4998
Short communication
FUNGAL PATHOGENS OF TOMATO IN SOUTH-WESTERN RUSSIA (KRASNODAR TERRITORY)
E.M. Chudinova1, T.A. Shkunkova1, S.N. Elansky12*
1 Peoples'Friendship University of Russia, Moscow, Russia 2 Moscow Lomonosov State University, Moscow, Russia
*corresponding author, e-mail: [email protected]
During a study of fungal diseases of tomato in the South of Russia (Krasnodar Territory) 56 fungal isolates associated with tomato fruits were obtained. Most of them belonged to the species Alternaria alternata. Alternaria solani, Fusarium equiseti, Phomopsisphaseoli, Chaetomium cochliodes, Clonostachys sp., Irpex lacteus, Colletotrichum coccodes were also identified. Laboratory experiments revealed that Clonostachys sp., C. cochliodes, P. phaseoli, I. lacteus, and F. equiseti developed well on the fruit's slices. Fusarium equiseti was the only species that can penetrate the tomato through epidermis and infect entire fruit. The most effective fungicide against F. equiseti was difenoconazole (EC50 = 0.08 mg/L); pencycuron was also effective (EC50 = 32.5 mg/L). Thiabendazole completely inhibited the growth of F. equiseti at the concentration 100 mg/L (EC50 = 47 mg/L).
Keywords: fungicides, tomato diseases, Fusarium equiseti, Phomopsis phaseoli, Chaetomium cochliodes, Clonostachys sp., Irpex lacteus, Alternaria solani
Received: 09.04.2020 Accepted: 22.07.2020
Introduction
Climatic conditions allow the cultivation of tomato in open ground in the southern regions of Russia. In the Krasnodar Territory (2018) farmers grow tomato in open fields on an area of 750 hectares; the total yield is about 9 thousand tons (ab-centre.ru, small private gardens and greenhouses are not accounted). When grown in open ground, tomatoes are severely affected by diseases and pests. The most common diseases in the south of Russia and adjacent countries are late blight (caused by Phytophthora infestans (Mont.) de Baiy), early blight (Alternaria spp.), Septoria leaf spot (Septoria lycopersici Mart.), Fusarium rot (Fusarium sp.), root and stem rot (Pythium ultimum Trow), powdery mildew (Erysiphe communis (Wallr.) Schltdl., Oidium lycopersici Cooke & Massee), white rot (Sclerotinia sclerotiorum (Lib.) de Baiy),
gray mold (Botrytis cinerea Pers.), leaf mold (Fulvia fulva (Cooke) Cif. = Cladosporium fulvum), black tomato fruit rot (Remotididymella destructiva (Plowr.) Valenz.-Lopez, Cano, Crous, Guarro & Stchigel = Phoma destructiva) (Agaev et al., 2014).
In addition to the aforementioned widespread phytopathogenic microorganisms, new ones are currently appearing. They can cause diseases similar in symptoms. These microorganisms may differ in pathogenicity and resistance to fungicides. The use of effective fungicide preparations is the basis of high-quality tomato protection. That is impossible without the monitoring of tomato pathogens. The aim of our work was to analyze tomato fungal pathogens to search for new species atypical for Southern Russia.
Materials and Methods
The paper represents the results of a study of mycobiota were many plants with lesions caused by insects consequently associated with affected tomato fruits in two studied fields of colonized by bacteria and fungi, as well as plants with fungal, the Krasnodar Territory (Slavyansk-na-Kubani district). There bacterial damage, mixed lesions, and lesions resulting from
