Identification of aminoglycoside phosphotransferases of clinical bacterial isolates in the microbiota of Russians

Kovtun A.S.; Alekseeva M.G.; Averina O.V.; Danilenko V.N.

IDENTIFICATION OF AMINOGLYCOSIDE PHOSPHOTRANSFERASES OF CLINICAL BACTERIAL ISOLATES IN THE MICROBIOTA OF RUSSIANS

Kovtun AS1,2, Alekseeva MG1, Averina OV1, Danilenko VN'^3H

1 Laboratory of bacterial genetics, Department of genetics and biotechnology, Vavilov Institute of General Genetics of RAS, Moscow, Russia

2 Department of biological and medical physics,

Moscow Institute of Physics and Technology (State University), Dolgoprudny, Russia

3 Scientific Research Center for Biotechnology of Antibiotics "BIOAN", Moscow, Russia

Antibiotic resistance is one of the biggest threats to modern medicine. Response to antimicrobial treatment is seriously disrupted by aminoglycoside phosphotransferases (Aph) — enzymes produced by bacteria. The aph genes were annotated in many bacterial species, including commensals of the gut microbiota that can transfer these genes to clinically important strains. For this study we prepared a catalog of 21 aph genes. The in silico analysis of 11 intestinal microbiomes of healthy Russians revealed the presence of 3 cataloged aph genes in 7 microbiota samples, namely aph(3")-Ib, aph(3')-IIIa and aph(2")-Ia. The most frequent was the aph(3')-IIIa gene detected in 6 metagenomes. Of note, this gene was first discovered in Enterococcus faecalis, but in this study we observed it in sequences typical for commensal Ruminococcus obeum and opportunistic Enterococcus faecium, Roseburia hominis, Streptococcus pyogenes and Staphylococcus epidermidis. Similarly, aph(2")-Ia originally present in E. faecalis was detected in a sequence typical for Clostridium difficile. Our findings are consistent with the reports on the strong association between the geographical origin of the individual and frequency of aph genes. We suggest that clinical examination should include antibiotic sensitivity tests run not only on the causative agent, but also on the gut microbiota, for a better treatment outcome.

Keywords: antibiotic resistance, aminoglycoside phosphotransferase (Aph), clinical isolates of bacteria, human gut microbiota

Acknowledgements: authors thank Professor Sergey Sidorenko of North-West State Medial University for his comments on the article.

[><] Correspondence should be addressed: Valery Danilenko ul. Gubkina, d. 3, Moscow, Russia, 119991; [email protected]

Received: 29.03.2017 Accepted: 07.04.2017

ИДЕНТИФИКАЦИЯ АМИНОГЛИКОЗИДФОСФОТРАНСФЕРАЗ КЛИНИЧЕСКИХ ШТАММОВ БАКТЕРИЙ В МИКРОБИОТЕ ЖИТЕЛЕЙ РОССИИ

А. С. Ковтун1*2, М. Г. Алексеева1, О. В. Аверина1, В. Н. Даниленко1*2*3 н

1 Лаборатория генетики микроорганизмов, отдел генетических основ биотехнологии, Институт общей генетики имени Н. И. Вавилова РАН, Москва

2 Факультет биологической и медицинской физики,

Московский физико-технический институт (государственный университет), Долгопрудный

3 Научно-исследовательский центр биотехнологии антибиотиков «БИОАН», Москва

Устойчивость бактерий к антибиотикам является одной из самых серьезных проблем в современной медицине. Эффективность антимикробной терапии снижается вследствие работы бактериальных ферментов — аминогликозид-фосфотрансфераз (Aph). Гены aph аннотированы в геномах многих бактерий, в том числе комменсалов микробиоты кишечника, из геномов которых они могут попадать в геномы клинически значимых штаммов. Анализ in silico 11 ме-тагеномов кишечника здоровых людей из России показал наличие в 7 образцах микробиоты 3 генов aph из 21, включенного в каталог, составленный для исследования: aph(3")-Ib, aph(3')-IIIa и aph(2")-Ia. Наиболее распространенным оказался ген aph(3')-IIIa, найденный в 6 исследованных метагеномах. Важно, что этот ген впервые был обнаружен у Enterococcus faecalis, но в данной работе он был идентифицирован в генетическом окружении, характерном для ком-менсальной бактерии Ruminococcus obeum и условно-патогенных бактерий Enterococcus faecium, Roseburia hominis, Streptococcus pyogenes и Staphylococcus epidermidis. То же наблюдали для гена aph(2")-Ia: он был обнаружен для Clostridium difficile, а не для E. faecalis. Полученные результаты согласуются с литературными данными, указывающими на значимое влияние географического происхождения людей на распространенность aph-генов. Также, учитывая данные исследования, представляется обоснованным при клиническом обследовании пациентов с инфекционными заболеваниями и назначении антибиотиков для их лечения анализировать антибиотикорезистентность не только бактерии-возбудителя, но и микробиоты пациента.

Ключевые слова: устойчивость к антибиотикам, антибиотикорезистентность, аминогликозидфосфотрансферазы, Aph, клинические штаммы бактерий, микробиом, микробиота, кишечник человека

Благодарности: авторы благодарят профессора Сергея Сидоренко из Северо-Западного государственного медицинского университета имени И. И. Мечникова за обсуждение

123 Для корреспонденции: Даниленко Валерий Николаевич ул. Губкина, д. 3, г Москва, 119991; [email protected]

Статья получена: 29.03.2017 Статья принята к печати: 07.04.2017

At least 2 million people in the USA become infected with antibiotic-resistant bacteria every year, and at least 23,000 people die of these bacterial infections [1]. The growing antibiotic resistance of human pathogens is a serious threat to global health and has a significant impact on the environment. According to Antibiotic Resistance Genes Database (ARDB) [2], 13,293 antibiotic resistance genes of microorganisms have been discovered so far. Transfer of genetic elements between bacteria through intricate routes in mixed microbial communities promotes dissemination of resistance genes [3].

The human gut is home to about 1014 microbial cells and approximately 1000 microorganisms [4]. It is a dynamic reservoir of antibiotic resistance genes termed the resistome [5]. Antibacterial treatment has a significant impact on the gut resistome: it stimulates horizontal gene transfer and exerts selective pressure on its members [6]. Studies of gut microbiota residents resistant to antibiotics show that commensals of the human gut can also be a source of resistance genes for other bacteria, including pathogenic strains [7].

Studies of antibiotic resistance employ various cutting-edge technologies and methods, such as next generation sequencing, bioinformatic analysis, or analytical chemistry, making it possible to identify up to 30 gene clusters associated with antibiotic resistance [8]. Researchers of the Center for Genome Sciences and Systems Biology, Washington University School of Medicine, analyzed genes responsible for resistance to 18 clinically relevant antibiotics across ecologies. The bioinformatic analysis identified genes conferring resistance to two antibiotics widely used in the clinical setting and agriculture: P-lactams and tetracyclines [9].

Antimicrobial therapies can be seriously disrupted by aminoglycoside phosphotransferases (Aph) [10]. Genes that encode these enzymes were first discovered in plasmids and mobile elements of clinical strains of gram-positive and gram-negative bacteria [11]. As demonstrated by the phylogenetic analysis of Aph of clinical strains and strains producing aminoglycoside antibiotics [12], aminoglycoside phosphotransferases can be organized in 7 groups depending on the enzyme-modified position of the hydroxyl group of the antibiotic: Aph(2"), Aph(3'), Aph(3"), Aph(4), Aph(6), Aph(7") and Aph(9).

Aph-encoding genes have been annotated in many bacterial genomes, including non-pathogenic strains of the gut microbiota from where they can transfer to clinical strains [13]. Metagenomic DNA isolated from the human neonatal gut was shown to carry multiple genes conferring resistance to aminoglycosides and P-lactams [14].

A comparative study of 832 human gut metagenomes obtained from the residents of 10 different countries (England, Finland, France, Italy, Norway, Scotland, USA, Japan, China, and Malawi) established that the diversity of resistance genes was largely dependent on the geographical origin of the participant [15].

The spread of aph genes was studied in many laboratories worldwide. The aac(6')-Ie-aph(2")-Ia gene was found to be the most prevalent gene of enterococcal aminoglycoside resistance; it was detected in 26 out of 27 isolates obtained from patients of an Iranian hospital [16]. The epidemiologic study of 543 clinical strains isolated from Japanese patients showed that of 12 studied genes of aminoglycoside-modifying enzymes, one — the aph(2")-Ie gene- was isolated from 3 strains of Enterococcus faecium and another one -ant(9)-la — was detected in E. faecalis, E. faecium and E. avium. Nucleotide sequences of ant(9)-la in these 3 enterococci were identical to those of Staphylococcus aureus and were harbored

on transposon Tn554 [17]. Because aminoglycosides are often used to treat staphylococcal infections, a study was carried out to estimate the prevalence of aminoglycoside resistance among methicillin-resistant strains of S. aureus isolated from patients of an Iranian hospital. Genes aac(6')-le-aph(2"), aph(3')-llla and ant(4')-la were detected in 134 (77.0 %), 119 (68.4 %) and 122 (70.1 %) isolates, respectively [18].

In light of the above, identification of aminoglycoside phosphotransferases in the gastrointestinal metagenomes of Russian residents becomes a pressing issue.

METHODS

Sample preparation and DNA sequencing

We studied the gut microbiota of 11 healthy individuals of different sex and age, all residents of Moscow and Tver, Russia. Stool samples were collected using standard techniques [19]. Samples were frozen at -80 °C until further analysis.

DNA was extracted from weighted amounts of frozen stools using the QIAamp Fast DNA Stool Mini kit (Qiagen, Germany) according to the vendor's protocol with optimized lysis conditions for microbial DNA extraction (Isolation of DNA from Stool for Pathogen Detection, Qiagen, USA). The concentration of the obtained DNA was measured using the Qubit Fluorometer (Invitrogen, USA). The obtained genomic DNA was fragmented using the Covaris M220 focused ultrasonicator (Covaris, USA) to achieve fragment length between 100 and 700 b. p. (average size was ~350 b. p.).

Libraries for further sequencing were prepared using the NEBNext Ultra DNA Library Prep Kit for Illumina (NEB, UK). Fragments ranging from 250 to 500 b. p. (adapter sequences included) were selected for further sequencing. Quality control of the obtained libraries was performed on the Agilent TapeStation (Agilent Technologies, Germany); the libraries were mixed in equimolar amounts. Adapter sequences used at library prep step were as follows: Read1 (AGATCGGAAGAGCACACGTCTGAA CTCCAGTCACNNNNNNATCT CGTATGCCGTCTTCTGCTTG) and Read2 (AGATCGGAAGAGCGTCGTGTAGGGAAAGAG TGTAGATCTCG GTGGTCGCCGTATCAT), where NNNNNN is a 6-nucleotide index unique for each sample. After quality control was performed and library molecules were counted by quantitative PCR, the libraries were sequenced on one lane of Illumina HiSeq 4000 (101 cycles per each fragment's end) using the HiSeq 4000 SBS sequencing kit ver. 1 (Illumina, USA). FASTQ files were obtained using bcl2fastq v2.17.1.14 Conversion Software (Illumina). Quality scores were encoded as Phred 33. The obtained metagenomes were uploaded to the Sequence Read Archive (SRA) NCBI. They are presented in Table 1.

Quality control of metagenomic libraries and read assembly

Quality control of the resulting metagenomic libraries was performed using FastQC [20]. Read trimming was done using trimmomatic [21]. Contaminating host DNA was filtered by aligning the metagenomic reads against the human genome. Alignment was performed using Bowtie2 [22]. The metagenomic reads were assembled into contigs using SPAdes [23]. Description of the assembled reads is provided in Table 2.

Compiling a catalog of aminoglycoside phosphotransferases-encoding genes

Drawing upon the literature [12], we compiled a catalog of aminoglycoside phosphotransferase-encoding genes

isolated from the clinical strains of Acinetobacter baumannii, Alcaligenes faecalis, Bacillus circulans, Burkholderia pseudomallei, Campylobacter jejuni, Enterococcus faecalis, Escherichia coli, Enterococcus casseliflavus, Enterococcus faecium, Legionella pneumophila, and Pseudomonas aeruginosa. The catalog listed 21 gene. We also compiled a catalog of amino acid residues encoded by the selected Aph genes.

Metagenomic analysis

A Perl script was written to run the BLASTX search for aminoglycoside phosphotransferase genes in the assembled contigs and to filter the results by 2 parameters: homology and relative alignment length. The search was performed in the catalog of 31 amino acid sequences prepared in advance. Sequence alignments generated by BLASTIX were filtered by homology and relative alignment length. Relative alignment length was calculated as

L _ Lalignment

relative _ l

sequence

where L is the length of the obtained alignment and

alignment

L is the length of the reference amino acid sequence

sequence

from the catalog. We did not intend to screen the samples for new aminoglycoside phosphotransferase genes, therefore for homology the minimal value was set to 90 %, and the minimal alignment length was set to 80 %. To profile the species present in the studied samples, MetaPhlAn2 was used [24].

RESULTS

Compiling a catalog of aminoglycoside phosphotransferase genes of clinically relevant strains

Depending on the position of the enzyme-modified hydroxyl group of the antibiotic, aminoglycoside phosphotransferases were distributed into 7 subgroups: Aph(2''), Aph(3'), Aph(3''), Aph(4), Aph(6), Aph(7''), and Aph(9). The catalog of genes of clinical strains was prepared by summing up the data from the review [12]. The catalog of aminoglycoside phosphotransferase-encoding genes of clinically relevant bacterial strains is provided in Table 3.

Screening Russian metagenomes for aminoglycoside phosphotransferase genes

Using the Perl script, we analyzed gut metagenomes of 11 healthy Russian individuals. The results are presented in Table 4. It total, we identified 3 aph genes in 7 metagenomes. All genes were identified with 100 % homology. Of these 3 genes, the most prevalent was gene aph(3')-IIIa: it was missing in only one metagenome (D5F). Two aph genes, namely aph(2")-IIa and aph(3')-IIIa, were present only in metagenome D12F. Gene aph(3")-Ib was detected in only one metagenome (D5F).

The studied metagenomes were profiled for species diversity using MetaPhlAn2. Reads unambiguously assigned to bacterial species were aligned against metagenomic contigs using Bowtie2. Thus, contigs that carried aminoglycoside

Table 1. The studied metagenomes

№ Sample Sex Age, years Region GenbankID

1 4B_S2 F 34 Tver, Russia SRX1870055

2 12_S1 F 28 Tver, Russia SRX1878777

3 D3F М 15 Moscow, Russia SRX2672491

4 D4F М 15 Moscow, Russia SRX2672492

5 D5F М 15 Moscow, Russia SRX2672493

6 D6F М 15 Moscow, Russia SRX2672494

7 D11F М 15 Moscow, Russia SRX2672495

8 D12F F 15 Moscow, Russia SRX2672496

9 D13F F 15 Moscow, Russia SRX2672497

10 DG_S1 F 28 Tver, Russia SRX1869842

11 HG550 F 6 Tver, Russia SRX1869839

Table 2. Description of the assembled reads

№ Sample Contlg length, MBases Maximal contlg length, b. p. N50, b. p.

1 4B_S2 73 50917 2790

2 12_S1 160 111721 3800

3 D3F 106 855598 9284

4 D4F 237 433763 5677

5 D5F 140 517131 21016

6 D6F 238 544506 5742

7 D11F 46 1671967 7207

8 D12F 147 545374 7999

9 D13F 317 643760 12617

10 DG_S1 208 125246 2621

11 HG550 82 69816 3121

phosphotransferase genes [Kovtun AS, unpublished] could be assigned to certain species. Results of the bioinformatic analysis are presented in Table 5.

DISCUSSION

The in silico analysis of 11 gut metagenomes of healthy Russians revealed the presence of aminoglycoside phosphotransferases in 7 metagenomes. Of 21 aph genes previously isolated from the clinical strains of Acinetobacter baumannii, Alcaligenes faecalis, Bacillus circulans, Burkholderia pseudomallei, Campylobacter jejuni, Enterococcus faecalis, Escherichia coli, Enterococcus casseliflavus, Enterococcus faecium, Legionella

pneumophila, and Pseudomonas aeruginosa listed in our aph catalog (Table 3), only 3 were found in the studied samples. Those are: aph(3'')-lb, aph(3')-llla and aph(2'')-la. The most frequently occurring gene was aph(3')-llla (CAA24789) detected in 6 samples. This gene was previously discovered in E. faecalis and confers resistance to kanamycin. Gene aph(3'')-Ib (AAA26442) previously isolated from E. coli and associated with streptomycin resistance and gene aph(2'')-Ia (AAA26865) previously isolated from E. faecalis and associated with tobramycin resistance were observed in only one studied metagenome (Table 3).

Interestingly, the analysis of contigs that harbor aminoglycoside phosphotransferase-encoding genes revealed

Table 3. The catalog of aminoglycoside phosphotransferase-encodlng genes of clinically relevant bacterial strains

Gene name GenBank entry Bacteria* Gene location Aminoglycoside resistance

aac(6')-Ie-aph(2")-Ia AAA26865 Enterococcus faecalis Chromosome Tobramycin

aph(2'')-IIa AAK63040 Escherichia coli Chromosome Kanamycin, gentamicin

aph(2'')-IIIa AAB49832 Enterococcus gallinarum Chromosome Gentamicin

aph(2'')-IVa AAC14693 Enterococcus casseliflavus Chromosome Gentamicin

aph(2!!)-Ie AAW59417 Enterococcus faecium Chromosome Gentamicin

aph(3')-Ia CAA23656 Escherichia coli Transposon Tn903 Kanamycin

aph(3')-Ib AIL00451 Pseudomonas aeruginosa Chromosome

aph(3')-IIa CAA23892 Escherichia coli Transposon Tn5 Neomycin

aph(3')-IIb AAG07506 Pseudomonas aeruginosa Chromosome Kanamycin, neomycin, butirosin, seldomycin

aph(3')-IIIa CAA24789 Enterococcus faecalis Chromosome Kanamycin

aph(3')-IVa P00553 Bacillus circulans Transposons Tn5 and Tn903 Kanamycin, neomycin

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

aph(3')-VIa CAA30578 Acinetobacter baumannii Chromosome Kanamycin, amikacin

aph(3')-VIb CAF29483 Alcaligenes faecalis Transposon Tn5393 Kanamycin, streptomycin, amikacin

aph(3')-VIIa P14508 Campylobacter jejuni Chromosome Kanamycin, neomycin

aph(3')-VIIIa P14509 Escherichia coli Plasmid RP4 Kanamycin, neomycin

aph(3'')-Ib AAA26442 Escherichia coli Plasmid RSF1010 Streptomycin

aph(4)-Ia P00557 Escherichia coli Plasmid pJR225 Hygromycin

aph(4)-Ib CAA52372 Burkholderia pseudomallei Chromosome Hygromycin

aph(6)-Ic CAA25854 Escherichia coli Transposon Tn5 Streptomycin

aph(6)-Id AAA26443 Escherichia coli Plasmid RSF1010 Streptomycin

aph(9)-Ia AAB58447 Legionella pneumophila Chromosome Spectinomycin

Gene name Metagenome ID

4B_S2 12_S1 D3F D4F D5F D6F D11F D12F D13F DG_S1 HG550

aph(2'')-Ia - - - - - - - + - - -

aph(3'')-Ib - - - - + - - - - - -

aph(3')-IIIa - - + + - + - + + - +

Table 5. Diversity of species in the studied metagenomes with identified aminoglycoside phosphotransferase genes

Metagenome Contlg length, b.p. aph(2'')-Ia aph(3'')-Ib aph(3')-IIIa

D3F 3389 - - Enterococcus faecium

D4F 6439 - - Ruminococcus obeum

D5F 1422 - Escherichia coli -

D6F 979 - - Enterococcus faecium

D12F 5607 (для гена aph(3')-IIIa); 4407 (для гена aph(2")-Ia) Clostridium difficile - Roseburia hominis

D13F 4356 - - Streptococcus pyogenes

HG550 2242 - - Staphylococcus epidermidis

Note. * — a microorganism the gene was first isolated from.

Table 4. Aminoglycoside phosphotransferase genes identified in the studied metagenomes

the presence of the latter in the genomes of other bacterial species. For example, the aph(3')-IIIa gene was detected in a sequence typical for commensal Ruminococcus obeum and opportunistic E. faecium, Roseburia hominis, Streptococcus pyogenes and Staphylococcus epidermidis, but not for E. faecalis. Gene aph(2")-Ia was detected in Clostridium difficile, but not in E. faecalis (Tables 3, 5). Although this gene was the most prevalent in enterococci in the study [16], we observed it in only one studied sample in the non-enterococcal sequence. Genes aph(2")-Ia and aph(3')-IIIa were previously reported in methicillin-resistant strains of Staphylococcus aureus [17]. However, in the studied Russian metagenomes aph(3')-IIIa was present in the sequence typical for Staphylococcus epidermidis, while aph(3")-Ib was detected in E. coli.

These results are consistent with the results of comparative analyses conducted worldwide: age, sex and health do not have any significant impact on the antibiotic resistance of the gut microbiota, while the geographic origin does [15]. Rare occurrence and poor diversity of aph genes in Russian metagenomes may indicate that gut microbiota composition is specific to a particular region and that individuals whose microbiomes were analyzed in our study rarely resort to aminoglycoside therapies. On the other hand, missing aph genes in anaerobic bacteria that dominate the gut microbiota

may be explained by the absence of cytochrome-mediated transport [25]. It is also important that the microbiome of a healthy individual harbors opportunistic bacteria carrying aph genes.

CONCLUSIONS

Previously isolated from clinical bacterial strains, genes aph(3")-Ib, aph(3')-IIIa and aph(2")-Ia were found in 7 microbiota samples of 11 healthy Russians. Gene aph(3')-IIIa prevailed. The genes detected in the samples are carried by opportunistic bacteria: Enterococcus faecium, Roseburia hominis, Clostridium difficile, Escherichia coli, Streptococcus pyogenes, and Staphylococcus epidermidis. Two of them — E. coli and E. faecium — belong to a group of 12 highly dangerous bacteria, according to the World Health Organization. Therefore, we believe it reasonable to run antibiotic resistance tests on both the causative agent and patient's microbiota before deciding on the antibiotic treatment for patients with bacterial infections.

This work is the first to study the spread of antibiotic resistance genes of the gut microbiota of Russians. Further PCR-based search should be conducted to identify other clinically relevant resistance genes.

References

1. Hossion AM, Sasaki K. Novel quercetin glycosides as potent anti-MRSA and anti-VRE agents. Recent Pat Antiinfect Drug Discov. 2013 Dec; 8 (3): 198-205.

2. McArthur AG, Waglechner N, Nizam F, Yan A, Azad MA, Baylay AJ, et al. The comprehensive antibiotic resistance database. Antimicrob Agents Chemother. 2013 Jul; 57 (7): 334857.

3. Wooldridge M. Evidence for the circulation of antimicrobial-resistant strains and genes in nature and especially between humans and animals. Rev Sci Tech. 2012 Apr; 31 (1): 231-47.

4. Schloissnig S, Arumugam M, Sunagawa S, Mitreva M, Tap J, Zhu A, et al. Genomic variation landscape of the human gut microbiome. Nature. 2013 Jan 3; 493 (7430): 45-50.

5. Elbehery AH, Aziz RK, Siam R. Antibiotic Resistome: Improving Detection and Quantification Accuracy for Comparative Metagenomics. OMICS. 2016 Apr; 20 (4): 229-38.

6. Blair JM, Webber MA, Baylay AJ, Ogbolu DO, Piddock LJ. Molecular mechanisms of antibiotic resistance. Nat Rev Microbiol. 2015 Jan; 13 (1): 42-51.

7. Willmann M, El-Hadidi M, Huson DH, Schütz M, Weidenmaier C, Autenrieth IB, et al. Antibiotic Selection Pressure Determination through Sequence-Based Metagenomics. Antimicrob Agents Chemother. 2015 Dec; 59 (12): 7335-45.

8. Perry JA, Westman EL, Wright GD. The antibiotic resistome: what's new? Curr Opin Microbiol. 2014 Oct; 21: 45-50.

9. Gibson MK, Forsberg KJ, Dantas G. Improved annotation of antibiotic resistance determinants reveals microbial resistomes cluster by ecology. ISME J. 2015 Jan; 9 (1): 207-16.

10. Shakya T, Wright GD. Nucleotide selectivity of antibiotic kinases. Antimicrob Agents Chemother. 2010 May; 54 (5): 1909-13.

11. Wright GD. Molecular mechanisms of antibiotic resistance. Chem Commun (Camb). 2011 Apr 14; 47 (14): 4055-61.

12. Shakya T, Stogios PJ, Waglechner N, Evdokimova E, Ejim L, Blanchard JE, et al. A small molecule discrimination map of the antibiotic resistance kinome. Chem Biol. 2011 Dec 23; 18 (12): 1591-601.

13. Jandhyala SM, Talukdar R, Subramanyam C, Vuyyuru H, Sasikala M, Reddy DN. Role of the normal gut microbiota. World J Gastroenterol. 2015 Aug 7; 21 (29): 8787-803.

14. Fouhy F, Ogilvie LA, Jones BV, Ross RP, Ryan AC, Dempsey EM, et al. Identification of aminoglycoside and ß-lactam resistance genes from within an infant gut functional metagenomic library.

PLoS One. 2014 Sep 23; 9 (9): e108016.

15. Forslund K, Sunagawa S, Coelho LP, Bork P. Metagenomic insights into the human gut resistome and the forces that shape it. Bioessays. 2014 Mar; 36 (3): 316-29.

16. Emaneini M, Khoramian B, Jabalameli F, Beigverdi R, Asadollahi K, Taherikalani M, et al. Prevalence of high-level gentamicin-resistant Enterococcus faecalis and Enterococcus faecium in an Iranian hospital. J Prev Med Hyg. 2016 Dec; 57 (4): E197-E200.

17. Mahbub Alam M, Kobayashi N, Ishino M, Sumi A, Kobayashi K, Uehara N, et al. Detection of a novel aph(2") allele (aph[2"]-Ie) conferring high-level gentamicin resistance and a spectinomycin resistance gene ant(9)-Ia (aad 9) in clinical isolates of enterococci. Microb Drug Resist. 2005 Fall; 11 (3): 239-47.

18. Mahdiyoun SM, Kazemian H, Ahanjan M, Houri H, Goudarzi M. Frequency of Aminoglycoside-Resistance Genes in Methicillin-Resistant Staphylococcus aureus (MRSA) Isolates from Hospitalized Patients. Jundishapur J Microbiol. 2016 Jul 26; 9 (8): e35052.

19. Standard operating procedure for fecal samples DNA extraction. The International Human Microbiome Standards (IHMS) project [Internet]. [cited 2017 Apr 3]. Available from: http://www. microbiome-standards.org/index.php#SOPS

20. Andrews S. FastQC: A quality control tool for high throughput sequence data. Version 0.11.5 [software]. Babraham Bioinformatics group. 2016 Mar 8 [cited 2017 Apr 3]. Available from: http://www.bioinformatics.babraham.ac.uk/projects/fastqc

21. Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014 Aug 1; 30 (15): 2114-20.

22. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012 Mar 4; 9 (4): 357-9.

23. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing. J Comput Biol. 2012 May; 19 (5): 455-77.

24. Truong DT, Franzosa EA, Tickle TL, Scholz M, Weingart G, Pasolli E, et al. MetaPhlAn2 for enhanced metagenomic taxonomic profiling. Nat Methods. 2015 Oct; 12 (10): 902-3.

25. Mättö J, Suihko ML, Saarela M. Comparison of three test media for antimicrobial susceptibility testing of bifidobacteria using the Etest method. Int J Antimicrob Agents. 2006 Jul; 28 (1): 42-8.

Литература