HYBRIDOGENIC ACTIVITY OF SOLIDAGO L. IN NORTH-EASTERN EUROPE Текст научной статьи по специальности «Биологические науки»

Трансформация экосистем Ecosystem Transformation www.ecosysttrans.com

Hybridogenic activity of Solidago L. in North-Eastern Europe

Maria A. Galkina*, Yulia K. Vinogradova

N.V. Tsitsin Main Botanical Garden, Russian Academy of Sciences, ul. Botanicheskaya 4, Moscow, 127276 Russia *mawa.galkina@gmail.com

Received: 29.04.2020 Accepted: 01.06.2020 Published online: 12.08.2020

DOI: 10.23859/estr-200429 UDC 575.858:582.998.1(470)8

ISSN 2619-094X Print ISSN 2619-0931 Online

Translated by S.V. Nikolaeva

Two invasive species of goldenrod of North American origin, Solidago canadensis and S. gigantea, widely spread in Europe, are known to be able to form hybrids with the native goldenrod S. virgaurea. In the Kaliningrad Region of Russia and in Lithuania, we found plants morphologically classified as the hybrids S. x snarskisii (= S. gigantea x S. virgaurea) and S. x niederederi (= S. canadensis x S. virgaurea). Analysis of the nuclear ribosomal internal transcribed spacer 1-2 (ITS 1-2) showed the ambiguity of the origin of the alleged hybrids. Thus, in S. x niederederi, the nucleotide substitutions that differentiate the parent species S. virgaurea and S. canadensis had ambiguous readings, indicating heterozygosity, which confirmed the hybridogenic origin of the individuals. However, for many specimens of S. x snarskisii, the hybridogenic origin was not confirmed. Occasionally, hybrids do occur, but appear to be soon absorbed by the maternal species. An analysis of the chloroplast non-coding intergenic spacer rpl32-trnL showed that in these rare cases, the maternal species is S. virgaurea, and the paternal one is S. gigantea.

Keywords: Solidago, invasive species, hybridization, Solidago x niederederi, Solidago x snarskisii, ITS 1-2, rpl32-trnL.

Galkina, M.A., Vinogradova, Yu.K., 2020. Hybridogenic activity of Solidago L. in North-Eastern Europe. Ecosystem Transformation 3 (3), 62-69.

Introduction

The North American species Solidago canadensis Linnaeus, 1753 and S. gigantea (Aiton, 1789) are among the top 100 most aggressive species in Russia (Dgebuadze et al., 2018; Vinogradova et al., 2015). Indeed, during the naturalization of alien species, they interact with native species, which can lead to the formation of hybrids. In European Russia, the proportion of hybrids reaches 10% of the total number of invasive plant species (Vinogradova and Mayorov, 2015). It is worth noting that one of the hypotheses explaining the success of plants in the new homeland is the assumption of increased hybridization in the secondary range (Ellstrand and Schierenbeck, 2000; Elton, 1958).

Populations of the hybrid S. x niederederi Khek, 1905, whose parent species are S. canadensis and

S. virgaurea Linnaeus, 1753, are widespread in Europe. It is widespread in Austria, Great Britain, Lithuania, and Poland (Pagitz, 2016), and in recent decades, the expansion of its range has continued intensively (Karpaviciene and Radusiene, 2016; Pliszko and Za-jac, 2016). Since most records of S. x niederederi are from Northeastern Europe, we also decided to conduct research in this region. Earlier, we studied the S. x niederederi population in the Pskov Region (Galkina and Vinogradova, 2019) and confirmed the hybridogenic origin of these plants, however, data on a single population are insufficient for a reliable result.

Regarding characteristic morphological characters, S. x niederederi has panicled inflorescence, pubescent shoots and small heads, like S. canadensis, and large leaves at the base of the shoot, like S. virgau-

rea. The second hybrid, S. x snarskisii Gudzinskas & Zalneravicius, 2016, differs from S. x niederederi in unshaven shoots and larger heads (Fig. 1). The inflorescences of this hybrid are also paniculate, while actively branching, with characteristic erect branches (Gudzinskas and Zalneravicius, 2016). S. x snarskisii is much less common. It is described on the basis of sampling in Lithuania (Gudzinskas and Zalneravicius, 2016), although earlier one specimen of this tax-on was discovered by S.R. Mayorov in the Moscow Region in the Losiny Ostrov National Park (2011) and two specimens were found on the outskirts of Kaluga (2012). An ISSR analysis of the DNA of these plants and parent taxa does not refute their hybrido-genic origin (Vinogradova and Galkina, 2019). We

decided to collect plants with morphological characters of S. x snarskisii in the population described by Z. Gudzhinskas and E. Zalneravicius (2016), as well as in the populations closest to this point (Za-barauskai, Lithuania) to confirm the hybridogenic origin of the data plants by molecular genetic methods.

Materials and methods

DNA was isolated from silica gel dried leaves of various Solidago taxa (27 samples in total) using the Extran kit (manufactured by Synthol CJSC). Plant samples were collected in the Kaliningrad region of Russia and in Lithuania in August - September 2019 (Table 1). We also analyzed data on plants from the Pskov Region obtained in 2018. Polymerase chain

m >> № • P5«

mMj^MMsm,

m

Lithuania, ZabarauskaiS

MMMnHMKUMMH

S. x snarskisii

S. x niederederi

is tr is is

«(Sfvf» ® ■

S. gigantea

Fig. 1. Hybrids and parental species within the genus Solidago

Lithuania, side of the road Trakai-Vilnius' [Lithuania, S. virgaurea

S. canadensis

Table 1. Samples of various Solidago taxa (purported hybrids and parental species) used for molecular genetic analysis.

Sequence number in Genbank

Sample no. ITS1-2 rp/32-trnL Taxon Collection point and habitat

Sc_1B MT376752 МТ385316 Lithuania, meadow along the highway Aukstadvaris - Trakai N 54.59° E 24.77°

Sc_4T Sc_5T MT376753 MT376754 МТ385317 МТ385318 Lithuania, meadow along the highway Trakai - Vilnius N 54.63° E 25.13°

Sc_17Z MT376755 МТ385319 S. canadensis Lithuania, vicinity of the village of Zarabauskai, sparse pine forest N 54.55° E 24.51°

Sc_W MT376756 МТ385320 Russia, Kaliningrad region, village of Shatrovo, roadside N 54.85° E 20.52°

Sc_P_20a Sc_P_20b Sc_P_20c MK491854 MK491855 MK491856 MK474085 MK474086 MK474087 Russia, Pskov Region, unused field in the vicinity of Pskov N 57.80° E 28.25°

Sn_3B MT376757 МТ385321 Lithuania, meadow along the highway Aukstadvaris - Trakai N 54.59° E 24.77°

Sn_1T Sn_6T MT376758 МТ385322 МТ385323 Lithuania, meadow along the highway Trakai - Vilnius N 54.63° E 25.13°

Sn_W MT376759 МТ385324 S. x niederederi Russia, Kaliningrad region, village of Shatrovo, roadside N 54.85° E 20.52°

Sn_P_21a Sn_P_21b Sn_P_21c MK491852 MK491853 MK474082 MK474083 MK474084 Russia, Pskov Region, unused field in the vicinity of Pskov N 57.80° E 28.25°

Sv_2T Sv_10T MT376760 MT376761 МТ385328 Lithuania, meadow along the highway Trakai - Vilnius N 54.63° E 25.13°

Sv_2Z MT376762 - Lithuania, vicinity of the village of Zarabauskai, sparse pine forest N 54.55° E 24.51°

Sv_1-2C Sv_2-2C Sv_3-2C MT376763 MT376764 MT376765 МТ385325 МТ385326 МТ385327 S. virgaurea Russia, Kaliningrad region, vicinity of the village of Tsvetnoe, sparse pine forest N 54.77° E 20.07°

Sv_W MT376766 МТ385329 Russia, Kaliningrad region, illage of Shatrovo, roadside N 54.85° E 20.52°

Sv_P_19a Sv_P_19b Sv_P_19c MK491849 MK491850 MK491851 MK474079 MK474080 MK474081 Russia, Pskov Region, unused field in the vicinity of Pskov N 57.80° E 28.25°

Sample no.

Sequence number in Genbank ITS1-2 rp!32-trnL

Taxon

Collection point and habitat

Ssn_5Z

Ssn_6Z

Ssn_10Z

Ssn_12Z

Ssn_13Z

Ssn_1-2C

Ssn_2-2C

Ssn 3-2C

MT376767 MT376768 MT376769 MT376770

MT376771 MT376772

MT385332 MT385333 MT385334 MT385335

MT385330 MT385331

S. x snarskisii

Lithuania, vicinity of the village of Zarabauskai, sparse pine forest N 54.55° E 24.51°

Russia, Kaliningrad region, vicinity of the village of Tsvetnoe, sparse pine forest N 54.77° E 20.07°

Sg_1-2C Sg_2-2C Sg_3-2C

MT376773 MT376774 MT376775

MT385336 MT385337 MT385338

S. gigantea

Russia, Kaliningrad region, vicinity of the village of Tsvetnoe, sparse pine forest N 54.77° E 20.07°

reaction (PCR) was run in a DNA Engine Dyad Peltier Thermal Cycler amplifier (Biorad, USA). For the nuclear ribosomal internal transcribed spacer 1-2 (ITS 1-2), we used primers nnc18s10 (forward) and c26A (reverse) at an annealing temperature of 58° C. For the chloroplast highly variable non-coding inter-genic spacer rpl32-trnL, the primers rpl32F (forward) and trnL UAG (reverse) were used at the annealing temperature from 0.3 to 65° C according to J. Shaw's method (Shaw et al., 2007). The PCR product for sequencing was purified in a mixture of ammonium acetate with ethanol. The DNA was sequenced using an automatic sequencer at CJSC Syntol. Further processing of the nucleotide sequences was performed in the BioEdit program. The data obtained were placed in the GenBank database (NCBI), in which these nucleotide sequences can be found by the additional numbers assigned to them (Table 1). Further data processing and the construction of haplotype networks were carried out in the TCS 1.21 program.

Results and discussion

Analysis of the nuclear ITS 1-2 showed the ambiguity of the origin of hybrids within the genus Solidago.

For most samples of S. x niederederi, alignment positions corresponding to nucleotide substitutions that differentiate the parent species S. virgaurea and S. canadensis had ambiguous readings indicating heterozygosity (Table 2). This ambiguity in the chro-matograms represents double peaks that may indicate the hybridogenic origin of individuals (Fig. 2). In addition, this is also indicated by the fact that in some cases (in the absence of ambiguous readings), some of the samples have at a certain position (for example, at 579) nucleotides as in one of the parent species, and part as in the other (Table 2). Analysis of the rpl32-trnL loci did not provide sufficient evi-

dence as to which of the parental species is maternal and which is the paternal. Our samples showed the variability of this chloroplast fragment within all three taxa: S. x niederederi, S. virgaurea, and S. canadensis (Table 3). A similar situation was observed for the S. x niederederi population in an unused field in the vicinity of Pskov (Galkina and Vinogradova, 2019).

Regarding the second hybrid, it is possible to state that an individual of S. x snarskisii from the vicinity of the village of Tsvetnoe in the Kaliningrad Region (Ssn_2-2C) has ambiguous readings of the sequence at the sites of nucleotide substitutions of the ITS 1-2 locus, differentiating the parent species (Table 2).

Other specimens identified based on morphological characters as S. x snarskisii, have ITS 1-2 nu-cleotide sequences identical to those of indigenous goldenrod S. virgaurea (Table 2). It is likely that these plants are a sustainable ecological form of S. virgaurea. The rpl32-trnL chloroplast sequences are identical in S. virgaurea and putative S. x snarskisii (Table 3). For rare hybrids of S. x snarskisii, this means that S. virgaurea is the maternal plant and S. gigantea is the paternal plant. Apparently, hybrids are very unstable and are quickly absorbed by the maternal species. We can also assume that not all forms of S. virgaurea can occasionally interbreed with S. gigantea, but only a form with a broad paniculate inflorescence with elongated and multi-flowered branches (listed as f. genuina Fiori (Flora SSSR, 1959)).

We built haplotype networks on the nuclear and chloroplast DNA sections of the studied plants (Fig. 3) taking into account the previously studied S. x niederederi, S. virgaurea, and S. canadensis from the vicinity of Pskov. As for the ITS 1-2 site, all hybrids entered the same haplotype with S. virgaurea (Fig. 3A), with the exception of sample Sc_P_20c.

Sc 4T

560

G A GT С Г CTGTTG A CGGG С

agi с y ctgttg a cggg

a g t с с ctgttg a cggg

Fig. 2. Fragments of chromatograms of sequences of specimens of Solidago canadensis (Sc_4T), S. x niederederi (Sn_6T) and S. virgaurea (Sv_2T) from Lithuania.

Table 2. Polymorphism of nucleotide sequences ITS 1-2 in putative hybrids of Solidago (in comparison with parent taxa). The symbols of nucleotides are given according to the IUPAC nomenclature.

Sample no. Alignment position

230 358 405 417 438 465 482 490 523 552 579 580 581

Sc_1B T C С A C T T C G G G T G

Sc_4T T C С A C T T C G G G T G

Sc_5T T C С A C T T C G G G T G

Sc_17Z T C С A C T T C G G G T G

Sc_W T C С A C T T C G G G T G

Sn_3B T Y M A C T Y C R G T C R

Sn_6T T T M A C T Y C R G G C G

Sn_W T Y M A Y Y Y C A G T C R

Sv_2T T T A A C T C C A G T C A

Sv_10T T T A A C T C C A G T C A

Sv_2Z T T A A C T C C A G T C A

Sv_1-2C T T A A C T C C A G T C A

Sv_2-2C T T A A C T C C A G T C A

Sv_3-2C T T A A C T C C A G T C A

Sv_W T T A A C T C C A G T C A

Ssn_6Z W T A A C T C C A G T C A

Ssn_10Z T T A M C T C Y A K T C A

Ssn_12Z T T A A C T C Y A G T C A

Ssn_13Z T T A A C T C Y A G T C A

Ssn_2-2C T Y M A C T C C A G T C A

Ssn_3-2C T T A A C T C C A G T C A

Sg_1-2C T C C A T Y C C G G G T G

Sg_2-2C T C C A Y T C C G G G T G

Sg_3-2C T C C A Y T C C R G G T G

Fig. 3. The haplotype network of specimens of Solidago from Lithuania and Kaliningrad Region, Russia. A - locus ITS 1-2, B - locus rpl32-trnL.

Table 3. Polymorphism of nucleotide sequences rp!32-trnL in putative hybrids of Solidago and parent taxa. The symbols of nucleotides are given according to the IUPAC nomenclature.

Sample no. 166 184-189 207-228 Alignment position 268-304 378 686-690 843

Sc_1B C - - - T TTTTT A

Sc_4T C - TATGTCTAAAGAATCTTAATGT TGTCTAAAAGAATAATTCTTGTATTTTCTGAATTCTA c T A

Sc_5T C - TATGTCTAAAGAATCTTAATGT TGTCTAAAAGAATAATTCTTGTATTTTCTGAATTCTA c T A

Sc_17Z C - - - c TTTT A

Sc_W C - - - c TTTT C

Sn_3B C - - - c T C

Sn_1T C - - TGTCTAAAAGAATAATTCTTGTATTTTCTGAATTCTA c T C

Sn_6T C - - TGTCTAAAAGAATAATTCTTGTATTTTCTGAATTCTA c T A

Sn_W C - - - c TTTT C

Sv_1OT A - - TGTCTAAAAGAATAATTCTTGTATTTTCTA c T C

Sv_1-2C A - - TGTCTAAAAGAATAATTCTTGTATTTTCTA c T C

Sv_2-2C C - - TGTCTAAAAGAATAATTCTTGTATTTTCTGAATTCTA c T C

Sv_3-2C C - - TGTCTAAAAGAATAATTCTTGTATTTTCTA c T C

Sv_W C - - TGTCTAAAAGAATAATTCTTGTATTTTCTGAATTCTA c T C

Ssn_5Z A - - TGTCTAAAAGAATAATTCTTGTATTTTCTA c T C

Ssn_6Z C - - TGTCTAAAAGAATAATTCTTGTATTTTCTGAATTCTA c T C

Ssn_10Z A - - TGTCTAAAAGAATAATTCTTGTATTTTCTA c T c

Ssn_12Z C - - TGTCTAAAAGAATAATTCTTGTATTTTCTGAATTCTA c T c

Ssn_1-2C A - - TGTCTAAAAGAATAATTCTTGTATTTTCTA c TT c

Ssn_2-2C A - - TGTCTAAAAGAATAATTCTTGTATTTTCTA c TT c

Sg_1-2C C - - - c TTTT A

Sg_2-2C C - - - c - A

Sg_3-2C C TAATAT - - c TTTT A

The sample Sc_P_20c, from our point of view, is also a hybrid, but not F1, but the result of introgression (Galkina and Vinogradova, 2019). The rpl32-trnL chloroplast intergenic spacer is very variable in almost all studied taxa (except S. gigantea), and hybrids are almost evenly distributed across several haplotypes (Fig. 3B).

Conclusions

Thus, S. x niederederi plants in Northeast Europe are true hybrids, while the S. x snarskisii hybrid is very rare and quickly absorbed by the mother species S. virgaurea. Most of the described hybrids of S. x snarskisii can be called "false", this is the ecological form of S. virgaurea, which probably has weak hybridogenic activity and can rarely form hybrids with invasive S. gigantea.

Acknowledgments

This work was carried out as part of the State Assignment to the main Botanical Garden, Russian Academy of Sciences (no. 19-119080590035-9) with partial support from the Russian Foundation for Basin Research, project no. 18-04-00411.

References

Dgebuadze, Yu.Yu, Petrosyan, V.G., Khlyap, L.A., 2018. Samye opasnye invasionnye vidy Rossii (T0P-100) [Most dangerous invasive species of Russia (T0P-100)]. KMK, Moscow, Russia, 688 p. (In Russian).

Ellstrand, N.C., Shierenbeck, K.A., 2000. Hybridization as a stimulus for the evolution of invasiveness in plants? Proceedings of the American Society of Naturalists 97 (13), 7043-7050.

Elton, C.S., 1958. The ecology of invasions by animals and plants. Methuen, London, UK, 212 p.

Flora SSSR. T. XXV [Flora of USSR. Vol. XXV], 1959. Komarov, V.L. (ed.). USSR Academy of Sciences, Moscow - Leningrad, USSR, 630 p. (In Russian).

Galkina, M.A., Vinogradova, Yu.K., 2019. Invasive taxa of the genus Solidago L. in the vicinity of the city of Pskov. Ecosystem Transformation 2 (2), 1218. https://doi.org/10.23859/estr-190311

Gudzinskas, Z., Zalneravicius, E., 2016. Solidago xsnarskisii nothosp. nov. (Asteraceae) from Lithuania and its position in the infrageneric classification of the genus. Phytotaxa 253 (2), 147-155.

Karpaviciene, B., Radusiene, J., 2016. Morphological and anatomical characterization of Solidago x niederederi and other sympatric Solidago species. Weed Science 64 (1), 61-70.

NCBI. Nucleotide. The Nucleotide database is a collection of sequences from several sources, including GenBank, RefSeq, TPA and PDB. Genome, gene and transcript sequence data providethe foundation for biomedical research and discovery. Web page. URL: https://www.ncbi.nlm.nih.gov/nu-ccore (accessed 24.04.2019).

Pagitz, K., 2016. Solidago x niederederi(S. canadensis x s. virgaurea ssp. virgaurea) in the Eastern Alps. Abstracts of Conference "Neobiota 2016". Fond faune-flore, Vianden, Luxembourg, 194.

Pliszko, A., Zajac, M., 2016. Current and potential distribution of Solidago x niederederi (Asteraceae) in Poland. Abstracts of Conference "Neobiota 2016". Fond faune-flore, Vianden, Luxembourg, 163.

Shaw, J., Lickey, E.B., Schilling, E.E., Small, R.L., 2007. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylo-genetic studies in Angiosperms: the tortoise and the hare III. American Journal of Botany 94 (3), 275-288.

Vinogradova, Yu.K., Mayorov, S.R., 2015. Dlitelnost lag-fazy kak otrazhenie mikroevolutsii rasteniy vo vtorichnom areale [Period of lag-phase as mirror of plant microevolution in the secondary distribution range]. Materialy XIII Moskovskogo soveshaniya po filogenii rasteniy "50 let bez K.I. Meyera" [Abstracts of XIII Moscow Conference about Plant Phylogeny "50 years without K.I. Meyer"]. Max Press, Moscow, Russia, 70-74. (In Russian).

Vinogradova, Yu.K., Abramova, L.M., Akatova, T.V. et al., 2015. "Chernaya sotnya" invazionnykh rasteniy Rossii ["Black hundred" of invasive plants of Russia]. Informatsionnyi bulleten soveta botanicheskih sadov stran SNG [Informational Bulletin of the Council of Botanical Gardens of CIS countries] 4 (27), 85-89. (In Russian).

Vinogradova, Yu.K., Galkina, M.A., 2019. Gibridizat-siya kak factor invazonnoy aktivnosti chuzherodnyh vidov zolotarnika (Solidago) [Hybridization as a factor of invasive activity alien species of Goldenrods (Solidago)]. Zhurnal obshey biologii [Journal of General Biology] 80 (1), 43-56. (In Russian).