Научная статья на тему 'Геномная нестабильность и неканонические структуры ДНК'

Геномная нестабильность и неканонические структуры ДНК Текст научной статьи по специальности «Биологические науки»

CC BY
983
165
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
ISSR-PCR МАРКЕРЫ / КВАДРУПЛЕКСЫ / ШПИЛЕЧНЫЕ СТРУКТУРЫ / ДВУЦЕПО-ЧЕЧНЫЕ РАЗРЫВЫ ДНК / РЕКОМБИНАЦИИ / ЭНДОГЕННЫЕ РЕТРОВИРУСЫ / ГЕЛИКАЗЫ / ISSR-PCR MARKERS / QUADRUPLEX / HAIRPINS / DOUBLE-STRANDED BREAK OF DNA / RECOMBINATION / ENDOGEN RETROVIRUSES / HELICASE

Аннотация научной статьи по биологическим наукам, автор научной работы — Зыбайлов Борис Леонидович, Глазко Валерий Иванович

Рассмотрены источники генетической нестабильности, связанные с неканоническими формами ДНК (квадруплексы, шпилечные структуры) и их распределение в секвенированных последовательностях ISSR-PCR маркеров домашней лошади и крупного рогатого скота. Показана относительно повышенная частота локализации квадруплексов в исследованных ДНК фрагментах, представленных участками гомологии к эндогенным ретровирусам. Обсуждается участие квадруплексов в процессах стабилизации/дестабилизации геномной ДНК

i Надоели баннеры? Вы всегда можете отключить рекламу.
iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

GENOME INSTABILITY AND NON CANONIC DNA STRUCTURES

The sources of genetic instability connected with non canonical DNA structure of DNA (qua-druplex, hairpins) and their distribution in sequences of horse and cattle ISSR-PCR markers have been considered. The increased frequency ofquadruplex localization in studied DNA fragments presented by homologous fragments to endogen retroviruses is shown. Participation ofquadruplexes in processes of stabilization/destabilization ofgenomic DNA is discussed.

Текст научной работы на тему «Геномная нестабильность и неканонические структуры ДНК»

ПРОБЛЕМЫ НАУКИ

Известия ТСХА, выпуск 5, 2012 год

УДК 577.213.6

ГЕНОМНАЯ НЕСТАБИЛЬНОСТЬ И НЕКАНОНИЧЕСКИЕ СТРУКТУРЫ ДНК

Б. Л. ЗЫБАЙЛОВ1, В. И. ГЛАЗКО2

О Медицинский университет Арканзаса (UAMS);

2 РГАУ-МСХА имени К.А. Тимирязева)

Рассмотрены источники генетической нестабильности, связанные с неканоническими формами ДНК (квадруплексы, шпилечные структуры) и их распределение в секвенированных последовательностях №8Я-РСЯ маркеров домашней лошади и крупного рогатого скота. Показана относительно повышенная частота локализации квадруплексов в исследованных ДНК фрагментах, представленных участками гомологии к эндогенным ретровирусам. Обсуждается участие квадруплексов в процессах стабилизации/дестабилизации геномной ДНК.

Ключевые слова: №8Я-РСЯ маркеры, квадруплексы, шпилечные структуры, двуцепочечные разрывы ДНК, рекомбинации, эндогенные ретровирусы, геликазы.

Н.И. Вавилов был одним из первых ученых, который привлек внимание к проблеме научных основ селекционной работы, он считал, что селекция представляет собой эволюцию, направляемую волей человека, а одним из важнейших условий для управления этим процессом является выяснение источников генетической изменчивости [2]. Изучение закономерностей мутационной изменчивости на уровне фенотипических признаков привело его к выявлению гомологических рядов в наследственной изменчивости [1].

Одной из центральных задач руководимых им научно-исследовательских коллективов была разработка методов индуцированного мутагенеза с целью увеличения исходного генетического разнообразия для увеличения эффективности селекционной работы. В то же время высокий уровень генетической изменчивости необходим для отбора и подбора носителей желательных признаков, после получения планируемого сочетания которых следующей задачей становится необходимость их сохранения и, значит, снижения генетической изменчивости. С этой точки зрения селекционная работа подразделяется на два качественно разных этапа: на первом — использование методов увеличения геномной нестабильности, на конечном — поиск способов геномной стабилизации.

Источники геномной нестабильности

К настоящему времени описано множество источников геномной нестабильности на разных уровнях организации генетического аппарата [26]. Единственной общей характеристикой для большинства из них является участие в геномной дестабилизации двуцепочечных разрывов ДНК (DSBs) [15]. В последние годы накапливаются данные о тесной связи между повышенной частотой DSBs и присутствием неканонических структур ДНК. Чаще всего к таким структурам относят квадруплек-

сы. Квадруплексы исследуются особенно активно в связи с тем, что последовательности, потенциально способные к их формированию, выявлены в таких структурнофункционально важных участках ДНК, как промоторы, теломеры, участки повышенной ломкости ДНК [10]. Квадруплексы формируют четырехцепочечные структуры, в которых гуанины образуют плоскость за счет своих поперечных связей и отличаются повышенной термоустойчивостью. Разработан ряд компьютерных программ, позволяющих вести поиск в секвенированных последовательностях участки, потенциально способные к образованию таких квадруплексов [32].

Накапливаются экспериментальные данные, свидетельствующие об участии квадруплексов в различных типах геномной нестабильности. К наиболее распространенным типам относят изменчивость по копийности хромосом (нарушение прохождения митоза, работы анафаза-промотирующего комплекса), хромосомные транслокации, формирование химерных белков за счет хромосомных транслокаций, мутации в генах-супрессорах опухолей, транспозиции и рекомбинации мобильных генетических элементов SINE Alu в опухолях у человека. Оказалось, что все перечисленные типы геномной дестабилизации тесно связаны с последовательностями, способными образовывать квадруплексы. Особое внимание к квадруплексам обусловлено еще и тем, что квадруплексы могут быть стабилизированы рядом определенных молекул (например, замещенными порфиринами или теломестатином), что позволяет влиять на геномную нестабильность, связанную с нарушением работы таких структур. Некоторые примеры геномной нестабильности, связанной с формированием квадруплексов, представлены ниже.

Стабилизаторы G квадруплексов рассматриваются как новые блокаторы перехода G2/M [29]. К естественным стабилизаторам относят теломестатин, синтезируемый макроцикл, выделенный из Streptomyces anulatus. Искусственно синтезированы структурно похожие на теломестатин макроциклы, из которых HXDV, гексаокзазоло-новый макроцикл, показал высокую специфичность к связыванию с G квадруплексами in vitro и проявлял антипролиферативную активность. HXDV индуцирует острый апоптоз в клетках млекопитающих через 16 ч после обработки и останавливает прохождение митоза. Таким образом, HXDV, действие которого зависит от связывания с G квадруплексами, является новым блокатором митоза.

Другой синтетический аналог теломестатина, близкий по структуре к HXDV, но не способный связываться с G квадруплексами, не обладает антипролифератив-ной активностью и не индуцирует апоптоз. Полученные данные свидетельствуют о том, что все наблюдаемые клеточные эффекты HXDV являются следствием его связывания с G квадруплексами.

Не исключено, что одним из факторов, принимающим участие во всех клеточных процессах, связанных с нарушением сегрегации хромосом, индукции апоп-тоза, являются события, обусловленные балансом изоформ известного опухолевого супрессора, р53. Ген TP53 имеет несколько вариантов сплайсинга. Полностью сплай-сированный транскрипт p53 (FSp53) кодирует канонический p53 белок. Альтернативно сплайсированный p53I2 транскрипт сохраняет интрон 2 и кодирует D40p53 (или DNp53), изоформа, утрачивающая первые 39 аминокислот N-участка, соответствующего трансактивации. Показано формирование G квадруплекса (G4) в G обогащенной области интрона 3, который влияет на сплайсинг интрона 2. Обработка лимфобластоидных клеток синтетическим лигандом, связывающимся с одноцепочечной G4 структурой, увеличивает формирование канонической mRNA p53 и уменьшает изоформу с альтернативным сплайсингом. Эти результаты указыва-

ют на то, что структуры G4 в интроне 3 регулируют сплайсинг интрона 2, приводя к дифференциальной экспрессии транскриптов, кодирующих различные изоформы белка p53 [22].

Известно, что хромосомные транслокации типичны для большинства онкологических заболеваний, в случае лимфом и миелом они тесно связаны с созреванием генов иммуноглобулинов и Т рецепторов. Получены данные, свидетельствующие о том, что в таких транслокациях при образовании DBS непосредственное участие принимают квадруплексы [25]. Выявлена тесная ассоциация между локализацией мотивов, способных к формированию G-квадруплексов и участками повышенной ломкости в около 70% генов, участвующих в перестройках в лимфоидных опухолях [19; 24].

В популяциях опухолевых клеток человека относительно часто наблюдаются рекомбинации Alu-повторов в генах супрессорах опухолевого роста [9]. Сиквенс этих генов в семействах с повышенным риском опухолей молочной железы позволил обнаружить потенциальную роль геликазы PIF1 в предрасположенности к развитию опухолей. Особенностью этой геликазы является ее высокое сродство к последовательностям G4 квадруплексов [9]. Предполагается, что Pifl участвует в рекомбинациях, опосредуемых Alu повторами, и полиморфизм по этому гену может вносить свой вклад в предрасположенность к онкологическим заболеваниям.

Появление новых химерных генов, образующихся в результате межгенных обменов и часто используемых как биомаркеры опухолевого процесса, в ряде случаев тесно связаны с формированием G4 квадруплексов. Такой квадруплекс обнаруживается в последовательности протоонкогена Ret в том участке, где наиболее часто наблюдаются разрывы при слиянии с фрагментом гена Kif5B и образовании нуклеотидной последовательности химерного белка [16].

Показана важная регуляторная роль G квадруплекса, присутствующего в области гиперчувствительности к нуклеазам (nuclease hypersensitive element — NHE III1) в промоторе гена человека c-myc (h c-myc), в регуляции транскрипции этого гена. Обнаружено, что ядерная поли(АДФ-рибоза) полимераза 1 человека (h PARP-1) участвует в регуляции экспрессии h c-myc гена через взаимодействие этого белка с G квадруплексом [12]. Важно подчеркнуть, что сам фермент h PARP-1 является одним из ключевых ферментов репарации одноцепочечных разрывов ДНК [23], т. е. участие во влиянии на транскрипцию G квадруплекса в промоторе гена c-myc реализуется через ключевой фермент репарации одноцепочечных разрывов.

Исследуется роль G-квадруплексов в развитии других болезней человека, таких, например, как экспансия триплета CGG. Такие повторы предрасположены к формированию G-квадруплексов, их размножение в гене FMR-1 ассоциировано с нейродегенеративными болезнями, связано с повышенной ломкостью хромосомы Х и рядом других заболеваний [24].

В популяционно-генетических исследованиях человека и набора клеточных линий опухолей человека обнаружено, что мононуклеотидные замены (SNP), нарушающие структуру G4 квадруплекса в промоторах ряда структурных генов, сопровождаются изменением их экспрессии. Авторы приходят к заключению о том, что G4 квадруплексы и нарушение таких структур могут быть прямыми механическими причинами популяционной изменчивости в экспрессии генов [7].

Таким образом, накопленные к настоящему времени данные свидетельствуют о широком участии G квадруплексов в процессах подержания стабильности/нестабильности генома.

Высокополиморфные геномные участки сельскохозяйственных видов животных

Современное развитие генных и геномных методов привело к возможности перехода от контроля аллельных вариантов немногочисленного количества генов или других геномных элементов к полилокусному геномному сканированию. Геномное сканирование (полилокусное генотипирование) может варьировать от использования нескольких десятков или сотен маркеров до истинного геномного сканирования путем полного секвенирования геномов [21]. Особое значение геномное сканирование приобретает в исследованиях генофондов сельскохозяйственных видов, поскольку только наличие достаточного количества геномных молекулярно-генетических маркеров позволяет сохранять, контролировать и усовершенствовать необходимое биоразнообразие таких видов. В последние несколько десятилетий с этой целью используют генотипирование «анонимных» фрагментов ДНК, фланкированных инвертированным повтором либо одного из случайно выбранных декануклеотидов (Random Amplified Polymorphic DNA — RAPD), фрагмента микросателлита (InterSimple Sequence Repeat — ISSR), или фланга ретротранспозона (Inter-Retrotransposon Amplified Polymorphism — IRAP) [5]. Каждый из перечисленных методов позволяет получать в полимеразной цепной реакции (PCR) спектр продуктов амплификации, совокупность которых отражает полиморфизм нескольких десятков или сотен геномных участков, в которых локализованы соответствующие инвертированные повторы, и достаточно надежно устанавливать особенности генетической структуры разных групп животных [14]. В то же время общим недостатком методов такого геномного сканирования является то, что остается недостаточно исследованным информационное содержание таких «анонимных» фрагментов ДНК и источники их высокой изменчивости, позволяющие надежно отличать при их использовании даже близкородственные группы животных. Накопление данных об источниках изменчивости фрагментов ДНК, фланкированных инвертированными повторами, может позволить разрабатывать методы увеличения/уменьшения геномной стабильности сельскохозяйственных видов животных.

Ранее нами были получены данные, свидетельствующие о том, что одним из источников высокого полиморфизма ISSR-PCR маркеров может быть их формирование в результате рекомбинационных событий между мобильными генетическими элементами [3]. Следует отметить, что в секвенированных последовательностях геномов крупного рогатого скота и лошадей мобильные генетические элементы, в частности с длинными концевыми повторами (LTR), встречаются на порядок чаще, чем микро-сателлитные локусы [11; 31], и их полиморфизм является видоспецифичным [13].

Для того чтобы оценить возможность вовлечения в формирование высокополиморфных спектров ISSR-PCR маркеров неканонических структур ДНК, в настоящей работе выполнены исследования локализации в секвенированных фрагментах генома лошади и крупного рогатого скота продуктов амплификации, полученных в результате полимеразной цепной реакции (PCR) с использованием в качестве праймера микросателлитного повтора (AG)9C.

Исследования распределения квадруплексов и шпилечных структур в секвенированных последовательностях ISSR-PCR маркеров

Для исследований использовали результаты секвенирования продукта амплификации спектра ISSR-PCR маркеров генома лошади длиной в 416 нуклеотидов [3] и фрагмента длиной в 1920 нуклеотидов спектра ISSR-PCR маркеров крупного рогатого скота [4].

Для анализа использовали программы, имеющиеся в открытом доступе. Поиск гомологичных последовательностей в GenBank осуществлялся с помощью алгоритмов семейства BLASTn. Выявление инвертированных повторов внутри сек-венированного фрагмента выполнялся с использованием программы Mobyle, поиск гомологии в архиве повторов проводился с применением программ RepeatMasker и Giri. Характеристики вторичных структур секвенированных фрагментов оценивали с помощью программы The mfold Web Server. Локализация квадруплексов в секвенированных фрагментах оценивалась с использованием программы QGRS (Quadruplex forming G-Rich Sequences) Mapper. Последовательность, потенциально

образующая квадруплексы, представляет следующую структуру:

G2-5NL1 G2-5NL2 G2-5NL3G2-5, где об^

значениями NL1-3 указаны петли, варьирующие по длине и нуклеотидному составу.

В результате получены следующие данные.

Последовательность квадруплекса обнаруживается в сек-венированном фрагменте генома лошади длиной в 416 нуклеотидов, начиная от 125 нуклеотида с 5' конца до 154 нуклеотида (рис. 1).

Последовательность квадруплекса в этом участке локализована за 12 нуклеотидов до конца фрагмента с 46 по 166 нуклеотид (рис. 2), гомологичного к консенсусу участка длинного терминального повтора ретровирус-подобного элемента млекопитающих, ERV3 (Mammalian long terminal repeat, MLT1G2 subfamily — a consensus) в обратном направлении, от 579 нуклеотида до 454 (25% дивергенции). Впервые был описан в геноме человека [28].

13244.tmp/data,ori DNA-8-5_DR MLT1G2 ERV1-1N-EC_LTR

1 39 46 166 182 416

Рис. 2. Участки гомологии в секвенированной последовательности фрагмента ДНК генома домашней лошади, фланкированного инвертированным повтором (AG)9C, длиной в 416 нуклеотидов: 1-39 — фрагмент неавтономного ДНК транс-позона рыбы; 46-166 — фрагмент LTR ERV 3, описанный в геноме человека; 182-416 — фрагмент LTR ERV1, специфичный для генома домашней лошади

Для всего этого участка длиной в 416 нуклеотидов характерно наличие инвертированных повторов, способных к формированию шпилечных структур, что приводит к 11 возможным вариантам его фолдинга. Несколько примеров разной упаковки этой последовательности представлены на рисунке 3. Последовательность 166 - 182, отделяющая участки гомологии к эндогенным ретровирусам LTR ERV 3 и LTR ERV1

5'лалалалалалалалаласалллаласлтатлтатааатстстатт

стлтсастататласлллтслссстллтттллтсттлтллллсллттлт

тттлттлттстллтаалстстатаслтслооллттсталалоолтттлт

тооаслтоостталстстаттстталтааслтаалсстллтлсталссс

талтллслатттссстлслттлллсссласлтлтлтлсааттллллссл

лллслстслттссстасттлстстстаасттсстаастсслаллтсслст

лтсстаслталалслалслсслссллаалслласлссталлттслстл

тстсстсслтлсллласллтлслааслатааалластасталслллтл

лаасслтааастстстстстстстстст 3'

Рис. 1. Локализация квадруплекса в фрагменте ДНК длиной в 416 нуклеотидов спектра продуктов амплификации, полученных с использованием в РОР в качестве праймера последовательности (ДО)ЭО с геномной ДНК лошадей алтайской породы: последовательность квадруплекса выделена цветом, пары гуанинов — подчеркиванием, начало квадруплекса — с125 нуклеотида, его длина - в 29 нуклеотидов

Рис. 3. Примеры (из 11 возможных) предрасположенности к формированию шпилечных структур в секвенированном фрагменте генома лошади длиной в 416 нуклеотидов: стрелками указаны нуклеотидные последовательности, локализованные между участками гомологии к фрагментам ДНК эндогенных ретровирусов (^ — последовательность 39-46; — последо-

вательность 166-182)

(см. рис. 3), локализована в том участке, разнообразие упаковки которого вносит существенный вклад в наличие 11 возможных вариантов фолдинга этого участка, т. е. обладает повышенной вероятностью лабильности вторичной структуры ДНК.

5'лалалалалаласалслтаааалалсслатлтттсалалллсталтсссллттст

ттлттттсслалатстатттттлтлслстллалтаттлтлсллллатслсатааааА

сласлатссталсттттлттлллатслаатасттслслслллтатлтлслалаатст

тлааоотаттлслтслтсттстоосслооааоосстасталсллтттлсалссстс

тссттаталсласаатслатсллтслаалсттлтттстсслааасталттлттстсл

лллслалсасслсссллатлллаттлслстсстлслооаталаоотатлатаоотт

ттлаттллоолллаллтттлсттласстллаатстллсаталттллтлтслллаатс

ллттстлт лт лттслттллт лтототллоссслсссслт лт сслолстт лосллсл

ллслттаастсласлллталллллсссттслссллслсллтттстллттлассслтт

ЛTЛCTTЛTЛCTЛЛTЛGTTTCCTЛЛCTTTTCTЛЛGGЛЛCCTGTTTTTЛGЛЛGGTTTЛЛA

GCЛTCTCGTGCCTCTCЛTGGTTGGGЛGGCTGTGЛGCЛЛTCЛCЛTGTGGCCGGЛCGЛ

GCCTGT CЛGGCЛGGCCЛGЛGЛЛCCTTCЛGЛGGЛGTTTGTЛGGTTЛЛЛЛCЛCT CTTG

TCЛCЛCCCЛЛGЛGTTTTTЛTTGЛCTGЛЛGCTCTЛGGTTЛЛCTCCTTCTCCGЛЛЛGЛG

GT GGT GGGGGЛCЛGCCCCCCGT ЛЛЛGTCЛGЛGGTGT AGGT ЛЛGЛGCЛCЛЛЛGT ЛG

TЛЛЛGTCGGCЛGGCTCTGGTTЛTGGGGGTЛGЛCGCTCGЛGGЛTTTCCЛGGGGGЛC

TCCTGЛGGCTCGЛTCCCGCCTTTGCGTЛTGTCGЛGCCTCCTTCCTCЛTGЛCCTTTGCC

ATGGGCAGAGTACCTCACTCTGGCCCCCAACAGGTGTGGTCTCTTAAATGTTGAAAA

ЛCCCЛЛЛTЛЛTCGCCCTCЛЛTTCЛGCTCTCTGGGCCGЛTGTCTCTTCЛGTTЛCCTGA

ЛсЛт GGGЛTTTTCCЛTCЛЛT ЛЛTTGTGЛCTGCTTTЛCCЛTTЛGЛGGЛЛCCЛTCTGTG

AAAACTAAAATTGCCTCTTCCAGAGGTTGAATAGAAAATTTCTTTGGAAAAATCACT

GGЛTGTGTTTTCЛЛЛЛЛЛЛTGCЛGTЛGGGGGCTTGЛGGGCЛЛЛTGЛЛЛCЛЛЛЛTTT

GCCCTGЛЛЛTCTЛTCЛGGGCЛЛCTTGCCЛЛTCЛTCЛCTЛTTTTGTЛЛЛЛGЛЛЛTTGC

ЛGTTGЛTCCTTЛTTGЛTTGGЛЛTCЛCTЛTЛTTTGCTЛCTTCTTTTCCЛЛЛЛЛЛTTCCA

CЛCTCTTTTTCTЛTCTTTTЛTЛЛTTЛЛTTGTGCCЛCCЛЛGCTGGGЛTЛЛGЛTЛЛЛЛCT

ЛTTTTTCTTGGGGTCЛCTGGTЛGЛTGGЛGCCЛTTCCЛЛTGGGCCTTCTTGCCЛCЛGC

ЛTCCTЛTЛGGTGTЛTGTTCTGЛGGCЛЛGЛЛTЛЛTTЛЛЛTCCCЛTCCTCTGGTЛЛTЛT

TЛЛCCCTЛЛTTЛЛCTGЛTCЛTTTЛЛЛGCCTCЛTCCЛCTTTЛЛCЛЛGЛGCCЛЛCTCTG

CCTCЛCTЛЛCCЛЛCTTTCTCTTЛGЛЛCTGGGЛTTЛGGЛTCGCTTTTTЛЛGCЛЛTCЛA

ЛCЛЛЛGGCTTTЛЛЛTCTGCЛGTЛGTCЛGTTTTЛЛЛTGTGGGTGTЛTCCЛЛTTЛЛTЛT

CCCCTAATAATTTCTGGAAATCATTTTGTTAGGTAGGTAGAATAGGGAAAAGGAGT

CCЛЛЛЛTGGTGGTGGCTЛЛЛЛGЛCЛЛGGЛЛGGTCЛЛЛGGЛЛGGTCCGЛGGЛCCЛ

GЛGTGЛЛGЛCTTCЛGGCЛGЛЛCЛЛЛCЛGCЛGCCCTGGCTЛЛGCCCЛЛTTTGCЛTЛG

GGCЛGGCCTЛGGTGGЛЛGЛЛЛЛЛЛCЛTЛTЛЛЛЛGGЛGGЛGCCЛЛЛЛCЛCTTTCTC

TTGGЛCTCTCTCTCTCCCЛTGTGCGTGCGCTCTTTCTCTCЛCTCTCTCTCTC 3'

Рис. 4. Локализация квадруплекса в фрагменте ДНК длиной в 1921 нуклеотид спектра продуктов амплификации, полученных с использованием в рОр в качестве праймера последовательности (ДО)ЭО с геномной ДНК крупного рогатого скота: последовательность квадруплекса выделена цветом, пары гуанинов — подчеркиванием

В секвенированной последовательности фрагмента ДНК генома крупного рогатого скота длиной в 1921 нуклеотид выявлено 11 участков локализации потенциаль-

ных квадруплексов (без перекрывания) (рис. 4).

Если учитывать варианты перекрывания друг с другом последовательностей, потенциально способных формировать квадруплексы, их оказывается существенно больше (см. таблицу).

По данным, представленным в таблице, видно, что наиболее высокая плотность перекрывающихся последовательностей, потенциально

способных к формированию квадруплексов, локализована в участках между 168 и 206, 801 и 857 и между 1680 и 1755 нуклеотидами.

С использованием

программ Яереа1Ма8кег и

Оігі в секвенированной последовательности генома крупного рогатого скота длиной в 1921 нуклеотид выполнен поиск повторов, в результате получены следующие данные. С 5 нуклеотида по 938 выделенный участок имеет гомологию в 96% с последовательностью видоспецифичного для крупного рогатого скота эндогенного ретровируса БтьтЯІБ (БКУ2, [і8]; с 976 по 1674 нуклеотид — с более чем 70% гомологией к последовательности эндогенного ретровируса БКУ2-1_т8у-1, впервые описанного у вида обезьян Багеіш Іагеіег [17], а с позиции 1675 по 1921 в обратном направлении, с 1 по 256 нуклеотид, с 92% гомологией — к последовательности эндогенного ретровируса крупного рогатого скота БЯУ1-2-ЬтЯ_Бт [20] (БЯУ1, рис. 5).

Сравнение распределения последовательностей, потенциально способных к формированию квадруплексов (см. рис. 4), и участков гомологии к мобильным генетическим элементам (см. рис. 5) свидетельствует о предпочтительной локализации потенциальных квадруплексов (с высоким уровнем перекрывания) близко к флангам рекомбинирующих фрагментов эндогенных ретровирусов.

Выполненный анализ вариантов упаковки нуклеотидной последовательности длиной в 1921 нуклеотид генома крупного рогатого скота показал наличие большого количества инвертированных повторов, что приводит к потенциальным возможностям формирования 22 вариантов упаковки этого участка. Причем существенный

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Локализация последовательностей, потенциально способных к формированию квадруплексов с учетом их перекрывания, в секвенированном участке ДНК длиной в 1921 нуклеотид генома крупного рогатого скота

Позиция Длина Последовательность потенциальных квадруплексов Э-Бсоге

168 29 ООТСТТАООООТОТТАСАТСАТСТТСТОО 5

175 27 ООООТОТТАСАТСАТСТТСТООССАОО 5

175 28 ООООТОТТАСАТСАТСТТСТООССАООО 5

175 29 ООООТОТТАСАТСАТСТТСТООССАОООО 5

175 29 ООООТОТТАСАТСАТСТТСТООССАОООО 3

175 30 ООООТОТТАСАТСАТСТТСТООССАООООО 5

175 30 ООООТОТТАСАТСАТСТТСТООССАООООО 0

175 30 ООООТОТТАСАТСАТСТТСТООССАООООО 4

175 30 ООООТОТТАСАТСАТСТТСТООССАООООО 3

176 28 ОООТОТТАСАТСАТСТТСТООССАОООО 4

176 29 ОООТОТТАСАТСАТСТТСТООССАООООО 5

176 29 ОООТОТТАСАТСАТСТТСТООССАООООО 4

176 30 ОООТОТТАСАТСАТСТТСТООССАОООООО 6

176 30 ОООТОТТАСАТСАТСТТСТООССАОООООО 5

176 30 ОООТОТТАСАТСАТСТТСТООССАОООООО 4

177 27 ООТОТТАСАТСАТСТТСТООССАОООО 5

177 28 ООТОТТАСАТСАТСТТСТООССАООООО 6

177 28 ООТОТТАСАТСАТСТТСТООССАООООО 5

177 29 ООЇОЇЇАОАЇОАЇОЇЇОЇООООАОООООО 7

177 29 ООТОТТАСАТСАТСТТСТООССАОООООО 6

177 29 ООТОТТАСАТСАТСТТСТООССАОООООО 5

21 перекрывающийся участок

322 30 ОООТОАОООТОТАОТОООІІІІАОТТААОО 14

322 30 ОООТОАОООТОТАОТОООІІІІАОТТААОО 15

322 30 ОООТОАОООТОТАОТОООТТТТАОТТААОО 15

322 30 ОООЇОАОООЇОЇАОЇОООІІІІАОЇЇААОО 16

323 29 ООТОАОООТОТАОТОООІІІІАОТТААОО 13

323 29 ООТОАОООТОТАОТОООІІІІАОТТААОО 14

323 29 ООТОАОООТОТАОТОООІІІІАОТТААОО 14

323 29 ООТОАОООТОТАОТОООІІІІАОТТААОО 15

427 15 ОООСАООООАТАТОО 17

428 14 GGCAGGGGATATGG 17

588 30 ООТТОООАООСТОТОАОСААТСАСАТОТОО 5

588 30 ООТТОООАООСТОТОАОСААТСАСАТОТОО 4

592 30 ОООАООСТОТОАОСААТСАСАТОТООССОО 5

593 29 ООАООСТОТОАОСААТСАСАТОТООССОО 4

616 24 GGООGGAОGAGООЇGЇОAGGОAGG 11

716 30 ООТТААСТССТТСТССОАААОАООТООТОО 2

738 10 ООТООТОООО 20

738 11 21

738 11 ООТООТООООО 19

801 18 GGОAGGОЇОЇGGЇЇAT GG 19

801 19 ООСАООСТСТ ООТТАТ ООО 18

801 20 ООСАООСТСТ ООТТАТОООО 17

801 20 ООСАООСТСТООТТАТОООО 11

801 20 ООСАООСТСТООТТАТОООО 13

801 21 ООСАООСТСТООТТАТООООО 16

Позиция Длина Последовательность потенциальных квадруплексов Э-Беоге

801 21 ОООДОООТОТООТТДТООООО 12

801 21 ОООДОООТОТООТТДТООООО 10

801 21 ОООДОООТОТООТТДТООООО 14

801 21 ОООДОООТОТООТТДТООООО 13

805 16 ОООТОТООТТДТОООО 17

805 17 ОООТОТООТТДТООООО 18

805 17 ОООТОТООТТДТООООО 16

805 30 ОООТОТООТТДТОООООТДОДОООТООДОО 11

805 30 ОООТОТООТТДТОООООТДОДОООТООДОО 12

805 30 ОООТОТООТТДТОООООТДОДОООТООДОО 13

805 30 ОООТОТООТТДТОООООТДОДОООТООДОО 14

805 30 ОООТОТООТТДТОООООТДОДОООТООДОО 9

805 30 ОООТОТООТТДТОООООТДОДОООТООДОО 11

805 30 ОООТОТООТТДТОООООТДОДОООТООДОО 10

811 24 ООТТДТ ОООООТДОДОООТООДОО 9

811 24 ООТТДТОООООТДОДОООТООДОО 11

811 24 ООТТДТОООООТДОДОООТООДОО 10

817 27 ОООООТДОДОООТООДООДТТТООДОО 9

817 27 ОООООТДОДОООТООДООДТТТООДОО 11

817 28 ОООООТДОДОООТООДООДТТТООДООО 9

817 28 ОООООТДОДОООТООДООДТТТООДООО 11

817 29 ОООООТДОДОООТООДООДТТТООДОООО 9

817 29 ОООООТДОДОООТООДООДТТТООДОООО 11

817 29 ОООООТДОДОООТООДООДТТТООДОООО 1

817 29 ОООООТДОДОООТООДООДТТТООДОООО 7

817 30 ОООООТДОДОООТООДООДТТТООДООООО 9

817 30 ОООООТДОДОООТООДООДТТТООДООООО 0

817 30 ОООООТДОДОООТООДООДТТТООДООООО 11

817 30 ОООООТДОДОООТООДООДТТТООДООООО 2

817 30 ОООООТДОДОООТООДООДТТТООДООООО 0

817 30 ОООООТДОДОООТООДООДТТТООДООООО 8

817 30 ОООООТДОДОООТООДООДТТТООДООООО 7

818 26 ООООТДОДОООТООДООДТТТООДОО 10

818 27 ООООТДОДОООТООДООДТТТООДООО 10

818 28 ООООТДОДОООТООДООДТТТООДОООО 10

818 28 ООООТДОДОООТООДООДТТТООДОООО 8

818 29 ООООТДОДОООТООДООДТТТООДООООО 10

818 29 ООООТДОДОООТООДООДТТТООДООООО 1

818 29 ООООТДОДОООТООДООДТТТООДООООО 9

818 29 ООООТДОДОООТООДООДТТТООДООООО 8

819 27 ОООТДОДОООТООДООДТТТООДОООО 9

819 28 ОООТДОДОООТООДООДТТТООДООООО 10

819 28 ОООТДОДОООТООДООДТТТООДООООО 9

820 26 ООТДОДОООТООДООДТТТООДОООО 10

820 27 ООТДОДОООТООДООДТТТООДООООО 11

820 27 ООТДОДОООТООДООДТТТООДООООО 10

833 24 ООДТТТООДОООООДОТООТОДОО 12

833 24 ООАТТТООАОООООАОТООТОАОО 14

833 24 ООДТТТООДОООООДОТООТОДОО 13

55 перекрывающихся участков

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

1373 18 ЗЗЗЗТОАОТЗЗТАЗАТЗЗ 16

1375 30 ООТОДОТООТДОДТООДОООДТТООДДТОО 14

Позиция Длина Последовательность потенциальных квадруплексов З-Бсоге

1680 22 GGTAGGTAGAATAGGGAAAAGG 16

1680 22 ООТАООТАОААТАСООААААОО 15

1684 30 ООТАОААТА ОО ОАААА ООАОТССААААТ ОО 16

1684 30 ООТАОААТАСООААААООАОТССААААТОО 15

1693 24 ОООААААООАОТССААААТООТОО 12

1693 27 ОООААААООАОТССААААТООТООТОО 15

1693 27 ОООААААООАОТССААААТООТООТОО 9

1693 27 ОООААААООАОТССААААТООТООТОО 5

1694 23 ООААААООАОТССААААТООТОО 12

1694 26 ООААААООАОТССААААТООТООТОО 15

1694 26 ООААААООАОТССААААТООТООТОО 9

1694 26 ООААААООАОТССААААТООТООТОО 6

1700 20 ООАОТССААААТООТООТОО 12

1712 21 ООТООТООСТААААОАСААОО 11

1712 25 ООТООТООСТААААОАСААООААОО 7

1712 25 ООТООТООСТААААОАСААООААОО 8

1712 25 ООТООТООСТААААОАСААООААОО 12

1715 22 ООТООСТААААОАСААООААОО 11

1715 29 ООТООСТААААОАСААООААООТСАААОО 11

1715 29 ООТООСТААААОАСААООААООТСАААОО 7

1715 29 ООТООСТААААОАСААООААООТСАААОО 9

1718 26 ООСТААААОАСААООААООТСАААОО 12

1718 30 ООСТААААОАСААООААООТСАААООААОО 12

1718 30 ООСТААААОАСААООААООТСАААООААОО 12

1718 30 ООСТААААОАСААООААООТСАААООААОО 8

1731 17 GGAAGGTCAAAGGAAGG 18

1731 24 ООААООТСАААООААООТССОАОО 14

1731 24 ООААООТСАААООААООТССОАОО 14

1731 24 ООААООТСАААООААООТССОАОО 14

1735 20 ООТСАААООААООТССОАОО 18

30 перекрывающихся участков

1814 16 GGGCAGGCCTAGGTGG 18

1815 15 ООСАООССТАООТОО 18

1825 28 ООТООААОААААААСАТАТААААООАОО 4

вклад в лабильность такой упаковки вносили последовательности нуклеотидов, локализованные между участками гомологии к фрагментам рекомбинирующих ретровирусов (см. рис. 5, нуклеотидные последовательности между 938 — 976 и между 1674 и 1675 позициями нуклеотидов). Примеры вариантов упаковок в этих участках представлены на рисунке 6 а, б.

Рис. 5. Распределение участков гомологии к фрагментам эндогенных ретровирусов в полноразмерном фрагменте нуклеотидных последовательностей участка хромосомы 15 крупного

рогатого скота (ОепВапк: 1\1С_007313.5)

б

Рис. 6. Примеры вариантов упаковки последовательностей нуклеотидов, локализованных между участками гомологии к различным эндогенным ретровирусам в фрагменте длиной в 1921 нуклеотид генома крупного рогатого скота: а — варианты упаковки ДНК, включающие последовательность от 938 до 976 нуклеотида; б — варианты упаковки ДНК, включающие последовательность от 1674 до 1675 нуклеотида

Следует отметить, что, по литературным данным, встречаемость последовательностей, потенциально способных к образованию квадруплексов, обнаруживается в ядерном и митохондриальном геноме, в частности дрожжей, с существенно меньшей частотой, чем в исследованных нами секвенированных фрагментах геномной ДНК домашней лошади и крупного рогатого скота, представленными участками, гомологичными комбинациям фрагментов эндогенных ретровирусов. Так, у Saccharomyces cerevisiae мтДНК содержит на порядок больше G4 DNA на одну тысячу пар нуклеотидов (0,373), чем любая ядерная хромосома этого же вида (0,034-

0,067) [8]. У человека в ядерном геноме на одну тысячу нуклеотидов встречается примерно 0,1 потенциальной последовательности G4 (~376000 G4 на 3 х 109 нуклеотидов гаплоидного генома человека [27]). В то же время в секвенированном фрагменте ДНК генома лошади последовательность нуклеотидов, потенциально способная к формированию квадруплекса, встречается 1 раз на 416 нуклеотидов (см. рис. 1), т. е. условно около трех последовательностей на тысячу пар нуклеотидов. В случае секвенированной последовательности фрагмента генома крупного рогатого скота даже без учета перекрывания потенциальных G4 участков (см. таблица), такие последовательности встречаются приблизительно с частотой 5 потенциальных G4 на

одну тысячу нуклеотидов (рис. 4), что на порядок больше, чем в мтДНК, и на два порядка — в ядерной ДНК S. сerevisiae. Следует отметить также, что потенциальные 04 в наших исследованиях локализованы близко к тем участкам, которые отличаются повышенной вероятностью формирования различных вариантов шпилечных структур (см. рис. 3, 6).

Полученные данные свидетельствуют о том, что в высокополиморфных участках ДНК, фланкируемых ивертированными повторами и состоящими из последовательностей, гомологичных рекомбинантам между разными эндогенными ретровирусами, обнаруживается относительно повышенная частота встречаемости нуклеотидных последовательностей, способных формировать квадруплексы. Причем наблюдается смещение их локализации к флангам участков гомологии к эндогенным ретровирусам (местам рекомбинаций между ними), для которых характерно наличие нуклеотидных последовательностей, предрасположенных к формированию лабильных вариантов шпилечных структур.

Направления поисков геномных стабилизаторов

Последовательности, потенциально способные к формированию квадрупле-сов, часто предрасположены к формированию шпилечных структур [6]. Районы, вовлеченные в образование шпилек и одновременно несущие последовательности, способные формировать 04 структуры, можно обнаружить и в участках на флангах фрагментов эндогенных ретровирусов, входящих в исследованные нами нуклеотидные последовательности длиной в 416 нуклеотидов генома домашней лошади и длиной в 1921 нуклеотид генома крупного рогатого скота (см. рис. 3, 6), образующие разные варианты фолдинга.

Для раскручивания структур 04 и шпилек необходимо участие разных гели-каз. Геликаза 5-3' Р1£1 способствует лиенизации 04 структур, а геликаза 3-5' дрожжей и ее гомолог у человека БЬМ раскручивает шпилечные структуры [6]. В то же время в некоторых исследованиях отмечается их определенная дополняющая функция [27], что, по-видимому, может быть обусловлено возможностями перехода из одного варианта вторичной структуры ДНК в другой.

В работах [8] анализ распределения 04 БКЛ по ядерному геному показал прочную ассоциацию мотивов ДНК 04 с сайтами частых двуцепочечных разрывов ДНК (Б8Б8) в митотических и мейотических клетках. У человека выявлено около 25 618 «горячих» сайтов мейотических рекомбинаций, которые существенно обогащены потенциальными участками формирования ДНК 04 квадруплексов [30]. Предполагается, что существенное перекрывание «горячих» сайтов Б8Б в митозе и мейозе обусловлено присутствием структур 04 с общими функциями в обоих типах клеток.

Присутствие структур ДНК 04 в сайтах Б8Б позволяет предполагать наличие двух функций, не исключающих друг друга. Во-первых, формирование структур 04 во время репликации ДНК может увеличивать вероятность Б8Б8. Образование их во время репликации, когда ДНК временно одноцепочечная, может замедлять или даже останавливать прогрессию вилки репликации, приводя к образованию Б8Б8. Известно, что от дрожжей до человека теломерная ДНК препятствует прогрессии вилки репликации во время стандартного полуконсервативного синтеза ДНК. К тому же мутации в ДНК геликазах, которые раскручивают 04, приводят к хромосомным делециям в местах локализации 04.

Во-вторых, мотивы ДНК 04 могут быть связаны с Б8Б8 потому, что они выполняют особую роль в формировании Б8Б. Один из начальных шагов в репариро-

вании DSB разрыва заключается в появлении одиночных хвостов с 3' концов. Формирование структуры ДНК G4 в этих хвостах могут способствовать образованию повреждений ДНК и влиять на расположенные вниз по течению события. Действительно, некоторые репарирующие и рекомбинирующие белки S. cerevisiae имеют активность, меняющую ДНК G4 структуры.

Важно подчеркнуть, что нуклеотидная последовательность геликазы Pifl Bos taurus содержит большое количество последовательностей, способных к образованию G4 структур — на 2461 нуклеотидов этого гена выявляется 28 потенциальных неперекрывающихся G4 структур (814 перекрывающихся, собственные данные). Эта GC богатая последовательность предрасположена также к формированию множества коротких шпилек. Таким образом, факторы, способствующие стабилизации участков потенциального образования квадруплексов, препятствуют не только накоплению DSBs в геномной ДНК в общем, но и увеличению частот мутаций в гене Pifl, ключевой геликазе разворачивания G4. Такой комплексный эффект может вносить существенный вклад в стабилизацию генома. Следует отметить, что в последние годы появилось много работ, в которых подбираются и подробно исследуются способы стабилизации потенциальных G4 последовательностей (например, [10]).

Таким образом, накопленные данные свидетельствуют о том, что именно квадруплексы могут быть одной из ключевых мишеней воздействия в целях разработки методов увеличения/уменьшения геномной изменчивости в зависимости от целей и стадиями селекционной работы с различными группами организмов, поскольку потенциальные G4 структуры не только оказываются тесно связанными с DSBs — общей характеристикой дестабилизации генетического аппарата, но и могут находиться в конкурентных взаимоотношениях с другими неканоническими структурами ДНК (шпилечными, например), а также с кодирующими последовательностями геликазы Pifl — ключевого фермента стабилизации репликации.

Библиографический список

1. Вавилов Н.И. Закон гомологических рядов в наследственной изменчивости. Л.: Наука, 1987. 256 с.

2. Вавилов Н.И. Теоретические основы селекции. М: Наука, 1987. 510 с.

3. Глазко В.И., Феофилов А.В., Бардуков Н.В., Глазко Т. Т. Видоспецифичные ISSR-PCR маркеры и пути их формирования // Известия ТСХА. 2012. №1. С. 118-125.

4. Глазко В.И., Феофилов А.В., Бардуков Н.В., Глазко Т.Т. Микросателлиты и эндогенные ретровирусы в геномном «ландшафте» высших млекопитающих // Российские нанотехнологии. — В печати.

5. Календарь Р.Н., Глазко В.И. Типы молекулярно-генетических маркеров и их применение // Физиология и биохимия культурных растений. 2002. Т. 34. № 4. С. 279-296.

6. Anand R.P., Shah K.A., Niu H., Sung P., Mirkin S.M., Freudenreich C.H. Overcoming natural replication barriers: differential helicase requirements // Nucleic Acids Research. 2012. Vol. 40. No. 3. Р. 1091-1105.

7. Baral A., Kumar P., Halder R., Mani P. Quadruplex-single nucleotide polymorphisms (Quad-SNP) influence gene expression difference among individuals // Nucleic Acids Research. 2012. Vol. 40. No. 9. P. 3800-3811.

8. Capra J.A., Paeschke K., Singh M., Zakian V.A. G-Quadruplex DNA Sequences Are Evo-lutionarily Conserved and Associated with Distinct Genomic Features in Saccharomyces cerevisiae // PLoS Comput Biol. 2010. No. 6(7). P. 1-13.

9. Chisholm K.M., Aubert S.D., Freese K.P., Zakian V.A., KingM.-C. A Genomewide Screen for Suppressors of Alu-Mediated Rearrangements Reveals a Role for PIF1 // PLoS ONE. 2012. Vol. 7. No. 2. e30748. 10 p.

10. Collie G.W., Parkinson G.N. The application of DNA and RNA G-quadruplexes to therapeutic medicines // Chem. Soc. Rev. 2011. №. 40. R 5867-5892.

11. ElsikC.G., TellamR.L., WorleyK.C. The Genome Sequence of Taurine Cattle: A Window to Ruminant Biology and Evolution // Science. 2009. Vol. 324. No. 5926. P. 522-528.

12. Fekete A., Kenesi E., Hunyadi-Gulyas E., Durgo H., Berko B. The Guanine-Quadruplex Structure in the Human c-myc Gene’s Promoter Is Converted into B-DNA Form by the Human Poly(ADP-Ribose)Polymerase-1 // PLoS ONE. 2012. Vol. 7. No. 8. e42690.

13. Garcia-Etxebarria K., Jugo B.M. Genome-Wide Detection and Characterization of Endogenous Retroviruses in Bos Taurus // J. Virol. 2010. Vol. 84. No. 20. P. 10852-10862.

14. Glazko V.I., Bardukov N.V, Pheophilov A.V., Sipko T.P., Elkina M.A., Glazko T.T. Polymorphism of ISSR and IRAP markers in genomes of musk-oxen (Ovibos moschatus) and horse (Equus caballus) of Altai breed // Izvestia of Timiryazev Agricultural Academy. 2012. Special Issue P. 16-26.

15. GreavesM., Maley C.C. Clonal evolution in cancer // Nature. 2012. Vol. 481. No. 7381. R. 287-294.

16. Ju Y.S., Lee W-C., Shin J.-Y., Lee S., Bleazard T. A transforming KIF5B and RET gene fusion in lung adenocarcinoma revealed from whole-genome and transcriptome sequencing // Genome Research. 2012. Vol. 22. P. 436-445.

17. Jurka J. Endogenous retroviruses from tarsier // Repbase Reports. 2010. No. 10(9). R. 1202-1202.

18. Jurka J. Long terminal repeats from domestic cow // Repbase Reports. 2008. No. 8(8). R. 847-847.

19. Kadapadi V.K., Nambiar M., Raghavan S.C. Potential G-quadruplex formation at breakpoint regions of chromosomal translocations in cancer may explain their fragility // Genomics. 2012. Vol. 100. No. 2. P. 72-80.

20. Kohany O., Jurka J. LTR retrotransposons from cow // Repbase Reports. 2008. No. 8(6). R. 674-674.

21. Lowry D.B. Landscape evolutionary genomics // Biol. Lett. 2010. Vol. 6. P. 502-504.

22. Marcel V., Tran P.L.T., Sagne C., Martel-Planche G., Vaslin L., Teulade-Fichou M.-P., Hall J., Mergny J.-L., Hainaut P., Van Dyck E. G-quadruplex structures in TP53 intron 3: role in alternative splicing and in production of p53 mRNA isoforms // Carcinogenesis. 2011. Vol. 32. No. 3. P. 271-278.

23. Masaoka A., Gassman N.R., Kedar P.S., Prasad R., Hou E.W., Horton J.K., Bustin M., Wilson S.H. HMGN1 Protein Regulates Poly(ADP-ribose) Polymerase-1 (PARP-1) Self-PARylation in Mouse Fibroblasts // J. Biol. Chem. 2012. Vol. 287. P. 27648-27658.

24. Nambiar M., Goldsmith G., Moorthy B. T., Lieber M.R., Joshi M.V., Choudhary B., Ho-sur R.V., Raghavan S.C. Formation of a G-quadruplex at the BCL2 major breakpoint region of the t(14;18) translocation in follicular lymphoma // Nucleic Acids Research. 2011. Vol. 39. No. 3. R. 936-948.

25. Nambiar M., Raghavan S.C. How does DNA break during chromosomal translocations? // Nucleic Acids Research. 2011. Vol. 39. No. 14. R. 5813-5825.

26. Schuster-Bockler B., Lehner B. Chromatin organization is a major influence on regional mutation rates in human cancer cells // Nature. 2012. Vol. 488. N.7412. P. 504-507.

27. Sharma S. Non-B DNA Secondary Structures and Their Resolution by RecQ Helicases // Journal of Nucleic Acids. 2011. Vol. 2011. Art. ID 724215. 15 p.

28. Smit A.F. Identification of a new, abundant superfamily of mammalian LTR-transpo-sons // Nucleic Acids Res. 1993. Vol. 21, No. 8. P. 1863-1872.

29. Tsai Y.-C., Qi Н., Lin C.-P., Lin R.-K., Kerrigan J.E., Rzuczek S.G., LaVoie E.J., Rice J.E., Pilch D.S., Lyu Y.L., Liu L.F. A G-quadruplex Stabilizer Induces M-phase Cell Cycle Arrest // J. Biological Chemistry. 2009. Vol. 284. No. 34. P. 22535-22543.

30. Uringa E.-J., Youds J.L., Lisaingo K., Lansdorp P.M., Boulton S.J. RTEL1: an essential helicase for telomere maintenance and the regulation of homologous recombination // Nucleic Acids Research. 2011. Vol. 39. No. 5 P. 1647-1655.

31. Wade C.M., Giulotto E., Sigurdsson S. Genome Sequence, Comparative Analysis, and Population Genetics of the Domestic Horse // Science. 2009. Vol. 326. No. 5954. P. 865-867.

32. Wong H.M., Stegle O., Rodgers S., Huppert J.L. A Toolbox for Predicting G-Quadruplex Formation and Stability // Journal of Nucleic Acids. 2010. Vol. 2010. P. 6.

GENOME INSTABILITY AND NON CANONIC DNA STRUCTURES

B.L. ZYBAILOV, V.I. GLAZKO

(' University of Arkansas for Medical Sciences (UAMS), Little Rock, AR, USA, 2 RTSAU named after K.A. Timiryazev, Moscow, Russia)

The sources of genetic instability connected with non canonical DNA structure of DNA (qua-druplex, hairpins) and their distribution in sequences of horse and cattle ISSR-PCR markers have been considered. The increased frequency of quadruplex localization in studied DNA fragments presented by homologous fragments to endogen retroviruses is shown. Participation of quadruplexes in processes of stabilization/destabilization of genomic DNA is discussed.

Keywords: ISSR-PCR markers, quadruplex, hairpins, double-stranded break of DNA, recombination, endogen retroviruses, helicase.

Зыбайлов Борис Леонидович — н. с. Медицинского университета Арканзаса (4301 W MarkhamLittle Rock, AR 72205).

Глазко Валерий Иванович — д. с.-х. н., проф., акад. РАСХН (иностр. член), руководитель Центра нанобиотехнологий РГАУ-МСХА имени К.А. Тимирязева (125550, г. Москва, ул. Тимирязевская, 49. Тел.: (499) 976-03-75; e-mail: rector@timacad.ru).

i Надоели баннеры? Вы всегда можете отключить рекламу.