Научная статья на тему 'Генетические изменения в линии Рпоч1-КК cветлоклеточного рака почки человека'

Генетические изменения в линии Рпоч1-КК cветлоклеточного рака почки человека Текст научной статьи по специальности «Фундаментальная медицина»

CC BY
223
20
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
HUMAN KIDNEY CLEAR CELL CARCINOMA / CELL CULTURE РПОЧ1-КК / TUMOR SUPPRESSOR GENE VHL / TUMOR SUPPRESSOR GENE TP53 / MUTATION / СВЕТЛОКЛЕТОЧНЫЙ РАК ПОЧКИ / КУЛЬТУРА КЛЕТОК РПОЧ1-КК / ГЕН-СУПРЕССОР VHL / ГЕН-СУПРЕССОР ТР53 / МУТАЦИЯ

Аннотация научной статьи по фундаментальной медицине, автор научной работы — Лушникова А.А., Морозова Л.Ф., Абрамов И.С., Дубровина Т.С., Балбуцкий А.В.

Перевиваемая клеточная линия Рпоч1-КК из коллекции РОНЦ им. Н. Н. Блохина относится к подтипу светлоклеточного рака почки и может использоваться для исследования механизмов канцерогенеза, а также определения молекулярных мишеней таргетной терапии.Цель исследования – анализ генетических изменений в стабильной культуре клеток Рпоч1-КК для характеристики этой модельной линии.Результаты. Изменения в генах VHL (экзоны 1, 2 и 3) и ТР53 (экзоны 6–10) идентифицировали путем амплификации геномной ДНК с последующим фрагментным анализом продуктов полимеразной цепной реакции и прямым секвенированием по Сэнгеру. Выявлена протяженная делеция в экзоне 1 гена VHL в сочетании с мутацией в экзоне 7 и 2 полиморфизмами в экзоне 4 гена ТР53. Такие cопряженные нарушения в генахсупрессорах могут быть одной из причин агрессивного роста опухоли и ее резистентности к стандартной терапии.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по фундаментальной медицине , автор научной работы — Лушникова А.А., Морозова Л.Ф., Абрамов И.С., Дубровина Т.С., Балбуцкий А.В.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

Genetic alterations in the human kidney clear cell carcinoma line Рпоч1-КК

Continuous cell line Рпоч1-КК from the сollection of N. N. Blokhin Russian Cancer Research Center refers to the kidney clear cell carcinoma subtypе. It is useful for study of carcinogenesis and molecular targets for targeted therapy.Objective. Analysis of the genetic alterations in a stable cell culture Рпоч1-КК to characterize this model cell line.Results. Alterations in VHL (exons 1, 2 and 3) and TP53 genes (exons 6–10) were identified by amplification of genomic DNA followed by fragment analysis polymerase chain reaction and direct Sanger sequencing. An extended deletion in exon 1 in combination with mutation in exon 7 of VHL gene and 2 polymorphisms in exon 4 of TP53 gene were reveated. Such simultaneous alterations in 2 suppressor genes maight be one of the causes of aggressive tumor growth and its resistance to standard therapy.

Текст научной работы на тему «Генетические изменения в линии Рпоч1-КК cветлоклеточного рака почки человека»

Генетические изменения в линии Рпоч 1-КК светлоклеточного рака почки человека

CV

И

ш и

А.А. Лушникова1, Л.Ф. Морозова1, И.С. Абрамов2, Т.С. Дубровина1, А.В. Балбуцкий1 о

ФГБУ«Российский онкологический научный центр им. Н.Н. Блохина» Минздрава России; о

Россия, 115478, Москва, Каширское шоссе, 24; 2

2ФГБУН «Институт молекулярной биологии им. В.А. Энгельгардта» РАН; Россия, 119991, Москва, ул. Вавилова, 32 0=

■si

Контакты: Анна Александровна Лушникова LAN21@yandex.ru

и ш

Перевиваемая клеточная линия Рпоч1-КК из коллекции РОНЦ им. Н.Н. Блохина относится к подтипу светлоклеточного рака почки Ц и может использоваться для исследования механизмов канцерогенеза, а также определения молекулярных мишеней таргетной терапии. Цель исследования — анализ генетических изменений в стабильной культуре клеток Рпоч1-ККдля характеристики этой модельной линии.

Результаты. Изменения в генах VHL (экзоны 1, 2 и 3) и ТР53 (экзоны 6—10) идентифицировали путем амплификации геномной ДНК с последующим фрагментным анализом продуктов полимеразной цепной реакции и прямым секвенированием по Сэнгеру. SJ Выявлена протяженная делеция в экзоне 1 гена VHL в сочетании с мутацией в экзоне 7и 2 полиморфизмами в экзоне 4 гена ТР53. g Такие сопряженные нарушения в генах-супрессорах могут быть одной из причин агрессивного роста опухоли и ее резистентности к стандартной терапии. s

Ключевые слова: светлоклеточныйрак почки, культура клеток Рпоч1-КК, ген-супрессор VHL, ген-супрессор ТР53, мутация

DOI: 10.17650/2313-805X-2016-3-3-81—85

Genetic alterations in the human kidney clear cell carcinoma line Рпоч1-КК

A.A. Lushnikova1, L.F. Morozova1, I.S. Abramov2, T.S. Dubrovina1, A. V. Balbutskiy1 g

1N.N. Blokhin Russian Cancer Reseach Center, Ministry of Health of Russia; 24 Kashirskoe Shosse, Moscow, 115478, Russia; щ

2V.A. Engelhardt Institute of Molecular Biology, Russian Academy of Sciences; 3 Vavilova St., Moscow, 119991, Russia Eg

Continuous cell line Рпоч1-ККfrom the сollection of N.N. Blokhin Russian Cancer Research Center refers to the kidney clear cell carcinoma subtypе. It is useful for study of carcinogenesis and molecular targets for targeted therapy. Ж Objective. Analysis of the genetic alterations in a stable cell culture Рпоч1-КК to characterize this model cell line.

Results. Alterations in VHL (exons 1, 2 and 3) and TP53 genes (exons 6—10) were identified by amplification of genomic DNA followed by fragment analysis polymerase chain reaction and direct Sanger sequencing. An extended deletion in exon 1 in combination with mutation in exon 7 of VHL gene and 2 polymorphisms in exon 4 of TP53 gene were reveated. Such simultaneous alterations in 2 suppressor genes maight be one of the causes of aggressive tumor growth and its resistance to standard therapy.

Key words: human kidney clear cell carcinoma, cell culture Рпоч1-КК, tumor suppressor gene VHL, tumor suppressor gene TP53, mutation

u

Введение

Рак почки (РП) занимает 3-е место среди опухолей мочеполовой системы по частоте встречаемости и 1-е по смертности. Ежегодно в мире регистрируют около 250 тыс., а в России — более 9 тыс. случаев заболевания РП в год [1]. Наиболее распространенный подтип РП — светлоклеточный рак почки (СРП), составляющий 60—85 % всех случаев этого заболевания. Для СРП характерны высокая молекулярно-генетическая гетерогенность, метастатическая активность и неблагоприятный прогноз. В опухолевых клетках больных СРП обнаружен целый спектр генетических нарушений, включая мутации, потерю гетерозиготности и аберрантное метилирование промоторных областей, а также патологические полиморфные варианты генов-супрес-соров [2]. Генетический анализ местно-распростра-ненного и метастатического РП позволяет решить

вопрос о применении таргетных препаратов и улучшить прогноз заболевания. Результативность таргетной терапии РП и прогноз заболевания зависят от спектра генетических нарушений в опухолевых клетках, поэтому молекулярно-генетическая характеристика РП имеет важное значение как для выбора терапии, так и для идентификации клинически значимых опухолевых маркеров.

Использование уже имеющихся маркеров для тар-гетной терапии РП в клинической практике затруднено из-за высокой гетерогенности заболевания, обусловленной поликлональностью опухолей. Спектр моле-кулярно-генетических изменений довольно широк и может варьировать даже в пределах одного и того же новообразования. Поэтому идентификация генетических нарушений в первичной опухоли не всегда соответствует прогнозу и терапии РП на более поздних

CV

со

ев

и ш u

ж ш

и

этапах болезни, и основным методом лечения по-прежнему остается хирургическое удаление опухоли.

Клеточные модели РП представляют большой интерес как для изучения механизмов канцерогенеза в целом, так и для воздействия молекулярно направленных препаратов на рост опухоли, в частности.

Цель исследования — характеристика генетических нарушений в клетках культивируемой линии СРП Рпоч1-КК.

Материалы и методы

Перевиваемая клеточная линия Рпоч1-КК была получена из опухолевого фрагмента Рпоч1 2-го пассажа, представленного в коллекции опухолевых штаммов человека РОНЦ им. Н.Н. Блохина [3]. Гистологическое исследование опухолевой ткани на первых 4 пассажах при трансплантации на бестимусных мышей выявило признаки трабекулярно-папиллярного светлоклеточ-ного рака. Клетки выращивали в питательной среде КРМ11640/ВМБМ в соотношении 1:1 с добавлением 10 % эмбриональной телячьей сыворотки, 2 мМ глю-тамина, пирувата натрия, комплекса витаминов и аминокислот в разведении 1:1000 стандартных концентраций этих препаратов (ПанЭко, Россия).

Мутации генов УИЬ (экзоны 1, 2 и 3) и ТР53 (эк-зоны 6—10) идентифицировали путем амплификации геномной ДНК с последующим фрагментным анализом продуктов полимеразной цепной реакции (ПЦР) и прямым секвенированием по Сэнгеру. Геномную ДНК из 3-суточной культуры клеток Рпоч1-КК выделяли с помощью набора АмплиПрайм ДНК-сорб-В (Интер-ЛабСервис, Россия) по инструкции производителя. В смесь для амплификации гена УИЬ методом ПЦР входило 5 мкл (20 нг) геномной ДНК; 2,5 Ед Тад-поли-меразы; буфер, содержащий 3 мМ хлорида магния (MgCl2); по 200 мкл каждого из 4 нуклеотидтрифосфа-тов; по 0,2 пМ прямого и обратного праймеров; стерильная деионизированная вода до конечного объема 25 мкл. После активации полимеразы при температуре 94 °С в течение 5 мин выполняли 35 циклов амплификации в следующем режиме: денатурация при тем-

Праймеры к гену УИЬ и условия полимеразной цепной реакции

Экзон Последовательность праймеров 5' ^ 3' Температура отжига, °С Длина продукта полимеразной цепной реакции, п. о.

1 tggtctggatcgcggagggaat ggcttcagaccgtgctatcg 61 416

2 accggtgtggctctttaacaacc tcaagtggtctatcctgtacttac 62 227

3 tgccactgaggatttggtttttgc aaagctgagatgaaacagtgtaag 57 250

пературе 94 °С 30 с, отжиг праймеров при температуре 57—62 °С 30 с, элонгация при температуре 72 °С 30 с, финальная элонгация 5 мин (см. таблицу). Минисек-венирование и детекцию генетических изменений в режиме фрагментного анализа проводили с помощью оборудования ААТ1 Fragment Analyzer с использованием набора реагентов DNF-910 dsDNA Reagent Kit 35-1500bp, позволяющего разделять фрагменты длиной от 35 п. н. до 1500 п. о. с допустимой погрешностью 5 п. н. Полученные данные обрабатывали с помощью программы PROSize 2.0.

Для амплификации экзонов 6—10 гена ТР53 с последующим прямым секвенированием ПЦР-продуктов использовали праймеры коммерческой NGS-панели SeqPlate TP53 компании Tib Molbiol [4].

Результаты и обсуждение

Около 2 % больных РП страдают наследственным синдромом Хиппеля—Линдау — аутосомным заболеванием, которое обусловлено инактивацией гена-супрес-сора VHL вследствие терминальных мутаций. Инактивация этого гена и/или аберрантное метилирование промотора и потеря гетерозиготности обнаружены у 54 % российских пациентов уже на I стадии СРП. У больных СРП с метастазами на момент постановки диагноза выявлены аллельные делеции 2 или более других генов-супрессоров, локализованных на хромосоме 3р [5]. Молекулярные нарушения гена VHL характерны именно для СРП, но не для более редких папиллярного, хромофобного и других подтипов РП. Мутации и аберрантное метилирование гена VHL выявлены в 45,3 % (87 из 192) исследованных образцов спорадического СРП. При этом вероятность метастазирования опухолей, несущих делеции хромосомы 3р и/или мутации гена VHL, очень высока [6].

Ген VHL локализован на хромосоме 3р25, содержит 3 экзона и кодирует полипептид, состоящий из 213 аминокислотных остатков (рис. 1).

Белок рУИЬ необходим для функционирования убиквитин-лигазного комплекса и деградации фактора 1а (hypoxia-inducible factor 1а, HIF-1a), индуцируемого гипоксией. Указанные выше изменения в гене приводят к ингибированию его экспрессии или синтезу дефектного белка. Показано, что VHL-ассоциированные изменения в опухоли при СРП влияют на клеточный метаболизм, секрецию, взаимодействие опухолевых клеток со стромой и Т-клеточный иммунный ответ [7, 8].

Анализ мутаций генов-супрессоров VHL и TP53. В результате фрагментного анализа экзона 1 гена VHL в клетках линии Рпоч1-КК был выявлен ПЦР-продукт длиной 290 п. н., тогда как в морфологически нормальной ткани длина этого фрагмента составляет 417—420 п. н. Таким образом, в опухолевых клетках имеется протяженная делеция гена VHL в экзоне 1 длиной 125 ± 5 п. н. (в пределах погрешности метода). Продукты амплификации экзонов 2 и 3 не отличались от нормы. Это указывает на возможную делецию участка хромосомы

Ген VHL Структура

БелокVHL Кодоны

Экзон 1

214

5' UTR /

Met *

1 14

553 554 676 677 855

3

4400

Met

54 63

114

(GXEEX)8

Функциональные участки в молекуле белка

3' UTR

155

193 204 213

Связывание элонгина С

Ядерный экспорт

CV

ев

и ш u

Супрессия роста опухоли

Рис. 1. Структура гена УИЬ и кодируемого им белка-супрессорарУИЬ. Цифрами обозначены нуклеотиды (ген) и кодоны (белок). Экзоны обозначены голубыми прямоугольниками. Дефектный белок рУИЬ не связывается с элонгином С, в результате чего нарушается элонгация мРНК

3р, в котором локализован ген-супрессор роста опухоли VHL, играющий важную роль в неоангиогенезе и опухолевой прогрессии.

Известно, что инактивация гена VHL играет ключевую роль в генезе как наследственных, так и спорадических форм СРП. По данным Д. С. Михайленко, соматические мутации гена VHL были обнаружены в 32,3 % случаев СРП и в 26,6 % образцов архивного или замороженного опухолевого материала с преобладанием изменений в экзонах 1 и 2. При этом подавляющее большинство (76,7 %) мутаций относились к де-лециям [5].

Утрата гена VHL нередко выявляется при СРП как раннее генетическое изменение, сопровождающееся последующей индукцией фактора HIF-a, поскольку продукт гена VHL — рУНЬ — ключевой компонент убиквитин-лигазного комплекса, регулирующего про-теолиз этого фактора. Показано также, что в метафазе белок рУНЬ входит в состав центросом и регулирует сигналинг, зависимый от рецептора эстрогена a (ER-a). Ингибирование этого сигнального пути критично для регуляции формирования микротрубочек и развития лекарственной устойчивости опухоли [9].

В результате ПЦР-анализа с последующим прямым секвенированием по Сэнгеру экзонов 6—10 гена TP53 была обнаружена однонуклеотидная замена в экзоне 7 — с.742 С>Т, приводящая к замене аргинина на триптофан Arg->Trp в кодоне 248. Эта патогенетическая мутация описана как герминальная (см. ссылку в базе данных BLAST http://www.ncbi.nlm.nih.gov/SNP/snp_ ref. cgi?rs=rs121912651 и ссылку NP_001119584-86.1:

p. Arg248Trp в базе HGVS). В базе данных Cosmic эта мутация гена TP53 описана как соматическая: ENST 00000420246» p.R248W/c.742C>T (см. ссылку http://cancer. sanger. ac.uk/cosmic/mutation/overview? id=3388183). Клетки Рпоч1-КК гомозиготны по указанной мутации (рис. 2).

Кроме того, в клетках изучаемой культуры в гомозиготном состоянии выявлены 2 полиморфизма: R72P — замена аригинина (R) на пролин (Р) в кодоне 72, соответствующая нуклеотидной замене в экзоне 4 гена ТР53, и IVS6+62G/A — G. Таким образом, в линии Рпоч1-КК СРП обнаружены мутации одновременно в 2 генах-супрессорах роста опухоли: VHL и ТР53.

Показано, что молекулярные нарушения в гене VHL, скорее всего, относятся к ранним событиям канцерогенеза и чаще обнаруживаются у больных с I—II стадиями заболевания, чем с III—IV стадиями. У пациентов с инактивацией гена VHL достоверно чаще наблюдается отдаленное метастазирование РП в лимфатические узлы и печень: у 48,0 % пациентов — метастазы в лимфатические узлы и у 17 % — в печень; при отсутствии изменений в гене VHL метастазы в лимфатические узлы наблюдаются у 17 % пациентов, а в печень не обнаруживаются. Однако регуляция уровня экспрессии факторов роста, вовлеченных в ангиогенез и пролиферацию опухолевых клеток, зависит не только от активности сигнального пути AKT/mTOR/HIF/ VEGF/PDGF, но и от р53-зависимого сигналинга [10].

Синдром Ли—Фраумени, обусловленный мутациями в гене TP53, относится к редким наследственным патологиям. Тем не менее, соматические мутации, вы-

х ш

и

2

в

в

a

а G G C A T G A A C C G G A G G C C C

cv со

es

и ш u

Gly Met

■ T G A

Asn

A С

T G

Arg

G

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Arg Pro

A G G С С С

Met

Asn

Trp

Arg

Pro

Рис. 2. Результаты прямого секвенирования экзона 7 гена ТР53: а — фрагмент нуклеотидной последовательности экзона 7 гена ТР53 дикого типа, внизу показана кодируемая аминокислотная последовательность; б — мутация, выявленная в клетках Рпоч1-КК. Стрелкой показан сайт с однонуклеотидной заменой с. 742С>Тв экзоне 7гена ТР53, приводящей к замене аргинина на триптофан в кодоне 248 — р.К248Ж

зывающие утрату функции обоих аллелей гена ТР53, — наиболее частые генетические изменения, наблюдаемые в спорадических опухолях. Мутации в гене TP53 или делеция сегмента хромосомы 17р (участок р13.1), включающей ген TP53, характерны для таких онкологических заболеваний, как рак молочной железы, яичников, мочевого пузыря, шеи, пищевода, кожи, легких, глиобластома мозга, остеогенная саркома, гепатокле-точная карцинома, колоректальный рак.

Ген ТР53 дикого типа ингибирует транскрипцию генов, кодирующих белки, которые определяют множественную лекарственную устойчивость опухоли. Мутантный ген TP53 повышает экспрессию генов множественной лекарственной устойчивости и резистентность опухоли к терапии. Мутации гена ТР53 связаны с устойчивостью опухолевых клеток к препаратам на основе платины, а также с активацией онкогенов FGFR3 и HRAS [11].

Помимо генетических данных, о плохом прогнозе РП могут свидетельствовать результаты иммуногисто-химических исследований, которые позволяют обнаружить в клетках линии Рпоч1-КК повышенную экспрессию онкогенов sis, c-myc, myb [3].

Заключение

Опухолевая гетерогенность РП — один из основных механизмов клональной эволюции и адаптации опухоли к меняющимся условиям микроокружения и поддержания ее злокачественного потенциала. Соотношение различных популяций опухолевых клеток в пределах одной опухоли и преобладание одного из клонов на определенном этапе канцерогенеза обусловливают уникальность биологии опухоли и ее резистентность к стандартной терапии [12]. Выявление хромосомных аберраций в субклонах и анализ их дальнейшей эволюции в опухоли играют решающую роль в выборе адекватного лечения. Потенциальные мишени для воздействия молекулярно направленными препаратами — фактор роста эндотелия сосудов (УБОБ), тромбоцитарный фактор роста (РБОБ), рецепторы к ростовым факторам (УОБЯ, РБОБЯ, БОБЯ, БОБЯ), сигнальный белок шТОЯ. Поиск новых молекулярных мишеней — актуальная проблема, которая требует дальнейших исследований на охарактеризованных клеточных моделях.

В клетках перевиваемой линии СРП мы обнаружили мутации одновременно в 2 генах-супрессорах роста

опухоли: протяженная делеция длиной 125 ± 5 п. н. в экзоне 1 гена VHL, нуклеотидная замена в экзоне 7 гена ТР53, а также 2 полиморфизма в гомозиготном состоянии: R72P — замена аригинина (R) на пролин

(Р) в кодоне 72 и 1У86+620/Л — О. Эти генетические изменения указывают на возможные причины агрессивного роста СРП и необходимость развития новых подходов к таргетной терапии РП.

CV

ЛИТЕРАТУРА / REFERENCES

CS

1. Давыдова М.И., Аксель Е.М. Статистика злокачественных новообразований в России и странах СНГ в 2012 году. М.: Издательская группа РОНЦ, 2014. 226 с. [Davydovа МЛ., Аksel' Е.М. Statistics of malignant tumors

in Russia and CIS countries in 2012. Мoscow: Izdatel'skaya gruppa RONTS, 2014. 226 p. (In Russ.)].

2. Михайленко Д.С., Попов А.М., Курынин Р. В. и др. Анализ молекулярно-генетических нарушений в генах VHL, RASSF1, FHITи TP53 при светлоклеточном раке почки. Медицинская генетика 2008;(4):9—14. [Мikhaylenkо D.S., Popov А.М., Kurynin R.V. et al. Аnalysis of molecular & genetic defects in VHL, RASSF1, FHIT and TP53 genes at the clear cell adeno-carcinoma. Меditsinskaya genetika = Меdical Genetics 2008;(4):9-14.

(In Russ.)]

3. Коллекция опухолевых штаммов человека. Под ред. М.И. Давыдова. М.: Практическая медицина, 2009. С. 37—38. [Collection of human tumor strains. Ed. Davydov МЛ. Мoscow: Prak-ticheskaya meditsina, 2009. Pp. 37-38. (In Russ.)].

4. Lyubchenko L.N., Abramov I.S., Bateneva E.I. et al. DNA-diagnostics

for inherited breast and/or ovarian cancer:

standard approaches and novel technologies; Eur J Hum Gen 2014;22(1):243.

5. Михайленко Д.С. Анализ молекулярно-генетических нарушений, ассоциированных с развитием злокачественных новообразований почки. Автореф. дис. ... канд. мед. наук. М., 2008. [Мikhaylenkо D.S. Аnalysis of molecular & genetic defects, associated with the development of malignant kidney tumors. Аи^аг^ abstract of thesis ... of candidate of medical sciences. Мoscow, 2008. (In Russ.)].

6. Михайленко Д. С., Григорьева М.В., Землякова В.В. и др. Молекулярно-гене-тические нарушения в гене VHL и метилирование некоторых генов-супрессоров в спорадических светлоклеточных карциномах почки. Онкоурология 2010;(2):32—

6. [МИ^ук^ю D.S., Grigor'evа М.У., Zern^a^^^ V.V. et al. МоЬш^г & genetic defects in VHL gene and methylation of some suppressing genes in sporadic clear cell kidney carcinomas. Оnkourologiya = Cancer Urology 2010;(2):32-6. (In Russ.)].

7. Leisz S., Schulz K., Erb S. et al. Distinct von Hippel-Lindau gene and hypoxia-regulated alterations in gene and protein expression patterns of renal cell carcinoma and their effects om metabolism. Oncotarget 2015;6(13);11395-406.

8. Stehle F., Leisz S., Schulz K. et al. VHL-dependent alterations in the secretome

of renal cell carcinoma: association with immune cell response. Oncotarget 2015;6(41):43420-37. PMID: 26486078.

9. Jung Y.S., Chun H.Y., Yoon M.H., Park B.J. Elevated estrogen receptor-a in VHL-deficient condition induces microtubule organizing center amplification via disruption of BRCA1/Rad51 interaction. Neoplasia 2014;16(12);1070-81.

DOI: 10.1016/j. neo.2014.09.013.

10. Носов Д.А., Яковлева Е.С., Федянин М.Ю. и др. Прогностическое значение инактивирующих нарушений в гене VHL у больных метастатическим почечно-клеточным раком. Онкоурология 2011;(3):47-51. [Nosov DA., Yatev^ RS., Fedyanin М.Yu. et al. Prognostic value

if desactivating defects in VHL gene at patients with metastatic renal cell carcinoma. Оnkourologiya = Cancer Urology 2011;(3):47-51. (In Russ.)].

11. Alexiev B.A., Drachenberg C.B. Clear cell papillary renal cell carcinoma: incidence, morphological features, immunohistochemical profile,

and biologic behavior: a single institution study. Pathol Res Pract 2014;210(4); 234-41.

12. Yates L.R., Campbell P.J. Evolution of cancer genome. Nat Ren Genet 2012;13(11):795-806.

И

ш и

X ш

и

i Надоели баннеры? Вы всегда можете отключить рекламу.