CC BY
24
Content in serum S-100 and NSE protein in children with sepsis without prior NCSP is shown in Table 2. The studies have shown that NSE content in patients between the ages of 1-6 months were not significantly different from those of the healthy age group (r1-3> 0.05), and in children aged 6-12 months, this figure was significantly lower in the group of healthy twice (P2-4 <0.001). NSE Indices according to age significantly decreased (8,22±1,2 and 2,71±0,6; respectively r1-2 <0.001). Co-content of the S-100 protein in the serum of children with sepsis without
Thus, in patients with sepsis in young children 82.4% were found to have previous USC, but only in 17.6% ofpatients with sepsis had no prior USC. The high frequency of the presence of sepsis preceding NCSP met in age from 6 to 12 months and amounted to 62.5% of cases, whereas in patients aged 1 to 6 months, it was 37.5%.
Conclusion. NRC Research in peripheral blood allow us to estimate the number of affected cells in the CNS, the severity of
prior NCSP were significantly higher in both age groups (patients 1-6 months — 3.4 times and in patients from 12.6 months — 15 8 times) compared with healthy children (r1-2,2-4 <0.001). In healthy children with the age of the value S-100 significantly decreased (r3-4<0.001), and patients with these values remained high (r1-2> 0.05). This is apparently due to the presence of prolonged septic process 2 in the child table.
This is apparently due to the presence of prolonged septic process 2 in the child table.
lesions and the prognosis of the disease. Follow-up studies the NRC in the peripheral blood showed no normalization parameters in patients with sepsis children not only with the presence of the previous USC, but also in children without USC. This is the basis for the development of the respective pathogenetic therapy with this pathology.
Table 2. - Contents enalazy neuron (NSE) and S-100 protein in the serum of children with sepsis without prior NCSP
Indicators Age from 1-6 months Age 6-12 months Healthy 1-6 months Healthy 6-12 months
NSE (Ug/L) n=80 8,22±1,2 2,71±0,6* ** 9,2±1,8** 1,3±0,4
S-100 (Ng/l)n=80 264,36±45,6* 352,81±48,2* 76,1±3,2** 22,3±4,0
Note: * - the accuracy with healthy; ** - Reliability depending on the age of 1-2 and 3-4
References:
1. Ibragimov UK, Haybulina ZR. Phospholipid spectrum of brain tissue under conditions of oxidative stress in intrauterine hypox-ia//VIII International Conference bioantioxidants. Abstracts. - M, - 2010. - P. 174-176.
2. Mahmudov OS, Pulatova RZ. Methods ofdiagnosis and treatment of sepsis in infants//Guidelines for doctors. - Tashkent, - 2012. - 53 p.
3. Pulatova RZ Patterns of intra-regulation of immunity in the clinical course of sepsis in infants: Author. Dis. ...Dr. med. Sciences. -Tashkent, - 2016.
4. Samsygina GA, Shabalov NP, Talalaev AG et al. Neonatal sepsis. Supplement to the journal "Archives of Pathology". - 2010. - 58 p.
5. Pozdnyakova N., Yatsenko L., Parkhomenko N., Himmelreich N. Perinatal hypoxia induces a long-lasting increase unstimulated gaba release in rat brain cortex and hippocampus. The protective effect of pyruvate//Neurochemistry International. - 2011. - № 58. - P. 14-21.
6. Paradies G., Petrosillo G., Paradies V., Ruggiero F. M. Mitochondrial dysfunction in brain aging: Role ofoxidative stress an cardio-lipin//Neurochemistry International. - 2011. - № 2787. - P. 186-197, - doi: 10.1016.
7. Kissoon N. Sepsis and septic shock. A global perspective and initiative//Saudi Med J. - 2008, - Vol. 29. - (10). - P. 1383-7.
DOI: http://dx.doi.org/10.20534/ESR-17-1.2-104-108
Rakhimova Gulnara Nishanovna, D. m.s., Head of Chair «Endocrinology» The Tashkent Institute of Postgraduate Education for Doctors, Tashkent. The Head of Scientific Department«Children's endocrinology» PSRPMCE MH of Republic of Uzbekistan, Tashkent E-mail: [email protected] Sadikova Akida Sattarovna, Researcher, Scientific Department «Children's endocrinology» RSRPMCE MH Republic of Uzbekistan, Tashkent E-mail: [email protected]
Genetic determinancy with polymorphism of gene ACE of the risk for development of chronic kidney disease in children and adolescents with type 1 diabetes mellitus of Uzbek population
Abstract: The purpose of research was to study distribution of the alleles frequencies and genotypes of I/D gene-candidate of the kidney pathology AKF in children and adolescents with type I diabetes mellitus in Uzbek population with presence and absence of CKD (chronic kidney diseases), and to assess informative capacity of its study as marker for prognosis of kidney
lesion in diabetes mellitus type 1.There were studied 120 children and adolescents with type 1 diabetes mellitus, of them males were 53 (44,2%) and females — 67 (55,8%). The mean age of patients was 13,8±2,7 years (Me 15,0; IQR 13,0-16,0). The stages of chronic kidney diseases were classified according to recommendations K/DOQI (2012). There was found that in children and adolescents with DM type 1 in Uzbek population the use of new classification K/DOQI (2012) allowed evaluation of the attenuation of the kidney function at earlier stages: in 61,9% of children and adolescents with DM type 1 even still at stage NAU there was noted SKD 80,6±7,5 ml/min/1,73 m 2, that corresponds stage II of CKD and 16,7% have CKD 45±9,5 ml/min/1,73 m2, that corresponds to stage III CKD. As well as in 28,6% of children and adolescents at the stage MAU there is noted CKD II, in 75.0% of CKD III stage, respectively. With regard to frequency the distribution of genotypes ofACE gene in children and adolescents with type I diabetes mellitus was characterized by reliable correlation of the DD genotype connected to stage of severity of CKD, reduction of ECV, that confirms effect of genetic factors in the development of CKD. I/D polymorphism of ACE gene is the molecular-genetic marker of the predisposition to the development of CKD in type I DM in children and adolescents of Uzbek population.
Keywords: diabetes mellitus, children and adolescents, CKD, polymorphism ofACE gene.
Introduction
The chronic kidney disease is a pathology, according to rates of growth of prevalence gaining character of noninfectious epidemic alongside with such diseases as diabetes mellitus (DM) and obesity. Chronic kidney disease develops in 13-15% of the persons in a general population and much more often — till 40-50 of% — in groups of risk, to which the patients with DM are attributed [1; 6]. According to the prognosis of International Diabetic Federation the number off patients with DM will increase to 552 mln in the world to 2030. The severity of DM is caused by generalized damage of the vascular system with development of multiple microvascular (nephropathy, retinopathy) and macrovascular complications (ischemic heart disease (IHD, peripheral atherosclerosis). The frequency the temps of development of vascular complications, besides the modified factors (hyperglycemia, arterial hypertension (AT), dis-lipidemia), depends on individual genetic features describing the large or smaller sensitivity of an individuum to damaging effect of the pathological factors at DM [5].
Diabetic nephropathy (DN) is one of the most dangerous complications of DM leading to progressive attenuation of kidney filtration function, which result is development of chronic renal insufficiency (uremia). The classical sign of DN is increased excretion of protein with urine — microalbuminuria (MAU) and in the further — proteinuria (PU). The special feature of study of renal complications in the patients with type I DM is based on definition of protein excretion [2]. Now with the purpose of diagnosis of renal pathology the term CKD was introduced, which represents the generalizing supranosological conception and allows to estimate presence and severity degree of kidney impairment independently on the cause of damage Chronic kidney disease is understood as presence of one or more laboratory, structural or functional attributes of kidneys damage of duration > 3 months or isolated decrease of velocity of glomerular filtration (GFV) < 60 ml/min/1,73 m2. In our research we were guided by the classification of CKD, accepted in the world, and defined its presence as stable (more than 3 months) decrease of GFV < 60 ml/min/1,73 m2 [3; 7].
The leading reason of the development of all vascular complications of DM, including CKD, seems to be chronic hyperglycemia. However at a part of the patients the damage of kidneys develops and quickly progresses, despite of satisfactory glycemic control, that shows the influence of nonglycemic mechanisms. There is shown interrelation of a level of proteinuria, degrees of AH and expression of glomerular sclerosis [4]. In 1989 the first works about possibility of family inheritance of diabetic kidney pathology appeared [5]. The allocation of this category of the pa-
tients has allowed to assume significant participation of the genetic factors in development DN and CKD.
CKD is second, after the cardiovascular pathology, reason of mortality of the patients with DM. The control of a level of glyce-mia and AP with use of preparations, blocking rennin-angiotensin system (RAS) may attenuate progressing, but not prevent development of pathology. The study of genetic predisposition to CKD presents the special importance from positions of prognosis and formation of groups of risk at preclinical stage, when the pathological changes are potentially convertible [1; 8; 9].
Modern strategy of research of genetic predisposition to such multifactoral pathology, as vascular complications of DM, is based on study of polymorphic markers of the genes — candidates — genes, the products of expression of which participate in the pathogenesis ofthis disease [10; 11; 12]. The polymorphic marker (PM) of gene is variable site of DNA, connected with certain phenotyping attribute (for example, AT). The association of a genetic marker with disease includes reliable differences in distribution of frequencies of alleles or pair set of alleles (genotype) in persons with presence and absence of pathology.
The purpose of our work was to study distribution of frequencies of alleles and genotypes of I/D gene-candidates of the renal pathology ACE in children and adolescents with DM type 1 of Uzbek population with presence and absence of CKD, and to evaluate informativity of its investigation as marker of prognosis of kidney damage in DM type 1.
Materials and methods
This study were enrolled 120 children and adolescents with type I DM of the Uzbek population included by the principle "case-control". The selected patients were ethnically homogenous. Group I (n=32) was formed through not overlapped criteria of selection: the patients with CKD at duration of disease less than 5 years ("CKD+", n=12) and patients without CKD with DM type 1 with duration of disease more than 10 years ("CKD-", n=20). In this group there was studied ID polymorphism of ACE gene. In 2 group (n=120) the patients were divided into subgroups "CKD+" and "CKD-" (n=51 and n=69) without dependence on duration of DM, where polymorphism of gene ACE was also investigated. Such approach to creation of groups with use of "polar" phenotypes was applied because CKD especially at DM is a multi-factor disease in order to reduce masking influence of not genetic risk factors, from which the duration of influence of hyperglycemia appeared to be one of the most significant. Presence of CKD was defined as persistent decrease in CKD< 60 ml/min/1,73 m2, designed on the standard formula of Shwartc.
Table 1. - General characteristic of groups with presence and absence of CKD
Group 1, n=32 Group 2, general, n=120
Clinical parameters CKD+ less than 5 years, n=12 CKD- more, than 10 years, n=20 P CKD+, n=51 CKD-, n=69 P
Sex (m/f),% 50/50 55/45 37,3/62,7 49,3/50,7
Age, years 13,5±2,5 14,5±1,2 0,14 14,6±1,7 13,2±3,1 0,004
Duration of DM, years 2,1±1,5 11,1±1,3 - 7,4±3,7 6,1±3,9 0,07
HbA1C,% 11,1±2,7 10,6±2,4 0,59 9,8±2,1 10,1±2,5 0,49
Cholesterol, mmol/l 4,6±0,7 4,1±0,8 0,08 4,6±1,1 4,2±0,8 0,03
SAP, mm Hg. 107,1±10,5 106,8±9,2 0,93 110,3±13,1 105,5±10,0 0,03
DAP, mm, Hg. 70,4±8,1 70,5±9,7 0,98 72,5±9,6 68,3±8,5 0,01
BMI, kg/m2 16,4±2,2 18,9±2,2 0,004 18,7±3,1 18,0±2,9 0,21
CFV, ml/min/1,73 m 2 46,2±26,8 172,6±44,6 0,0001 49,3±26,1 168,9±58,4 0,0001
Retinopathy,% 33,3 (n=4) 75,0 (n=15) 56,9 (n=29) 37,7 (n=26)
MAU, mg/l 137,5±144,5 25,3±16,9 0,002 155,6±180,7 21,0±13,2 0,0001
Isolation of genom DNA and genotyping by I/D polymorphic marker of ACE gene (was performed in the Laboratory of Human Functional Genomic ofthe Institute of Genetics and experimental biology of plants. The Academy of sciences of the Republic of Uzbekistan). Isolation of DNA was carried out by a method of Higuchi H. Erlich (1989) with use of a dry set of reagents Diatom ™ DNA Prep 200.
Statistical processing of the received results was performed with use of program STATISTICA 6 and Biostat. The ratio of chances
Results
The clinical characteristic of the patients is presented in table 1. All patients were comparable on age, gender, BMI. In groups "CKD+" in comparison with the patients without "CKD-" there was noted reliable difference in BMI, CKD and level of albuminuria. In the patients with CKD the more high level of albuminuria and SAP was registered (main nonglycemic risk factors of CKD progressing).
The distribution of frequencies of genotypes in sample "CKD-" on all polymorphisms met to balance of Hardy-Wainberg. Markers ofACE gene showed reliable association with development CKD.
Marker I/D ofACE gene (angiotensin converting enzyme): in group with CKD (+) in process of inclusion and accumulation of allele D in a genotype the frequency of occurrence of this genotype in
At the analysis of data of the distribution of polymorphism of ACE gene in children and adolescents with type I DM of Uzbek population depending on presence and absence of CKD without the taking into account of duration of disease has come to light, that in group with presence of CKD the frequency of occurrence of genotype DD reliably increased in relation to genotype II (0R=9,0;
(CR) and 95% CI (95% CI) were calculated with use of logistic regression. Reliability of various parameters were evaluated with use of nonparametric criterion x2 (Pirson's criterion). The quantitative parameters are presented as M±SD, and median (Me) and 25 and 75 percents (IQR). Differences between groups were considered as statistically significant in p=0,05.
The conditions of PCR and sequence of primers for amplification of the studied locuses are given in table 2.
relation to genotype II reliably increased (0R=9,0; CI 95% 1,4257,1). In group with CKD (-) there was not observed any case of carrying of DD genotype ofACE gene and also frequency of occurrence of I/D genotype was reliably less than genotype II (0R=32,1; CI 95%; 5,66-182,2). In children and teenagers with type I DM of the Uzbek population without CKD the frequency of occurrence of a genotype II was reliably higher in comparison with group "CKD+" in which duration of disease was less than 5 years: 85,0% vs 8,3%, p=0,0001. It was established, that carrying of genotype DD of ACE gene has predisposing importance, as at DM of duration more than 10 years without CKD there was no one case with a genotype DD, whereas, at presence of CKD the frequency of occurrence of genotype DD has made 75%. The data are shown in table 3.
CI 95% 9,94-84,0). In group with CKD (-) there was not observed any case of carrying of genotype DD of gene ACE, as well as the frequency of occurrence of genotype I/D was reliably less than genotype II (0R=4,0; CI 95% 1,97-8,12). In group without CKD the frequency of occurrence of genotype II was reliably higher in comparison with group of CKD (0R=32,0; CI 95% 8,99-113,4) and
Table 2. - Sequences of primers and special features of amplifications of polymorphic sites of ACE gene
Polymorphic marker Direct and inverse primers (5—3') MgCl2, mM Annealing, ° C
ACE (I/D) CTGGAGACCACTCCCATCCTTTCT GATGTGGCCATCA-CATTCGTCAGAT 1,5 62
Table 3. - Distribution of markers and genotypes of gene ACE in children and adolescents with type 1 DM with presence or absence of CKD in relation to duration of disease
Genotypes CKD+ less than 5 years, n=12 CKD- more than 10 years, n=20 OR 95% CI P
n % n %
II 1 8,3 17 85,0 62,3 5,73-678,2 0,0001
I/D 2 16,7 3 15,0 0,88 0,13-6,22 0,71
DD 9 75,0 - -
OR; 95% CI; p 9,0; 1,42-57,1; 0,04 32,1; 5,66-182,2; 0,0001
Reliably more than DD Reliably more than II
85,0% vs 8,3%, p=0,0001. It is established, that carrying of genotype DD of gene ACE has predisposing meaning, as in group without CKD even not depending on duration of disease not a sole case
Discussion
The works devoted to study of genetic markers of a pathology of kidneys in the patients with DM, are scarce and very inconsistent. It is connected not so much to heterogeneity of ethnic groups or interpopulational differences of the results of investigations. First of all, definition of kidney lesions in the patients with DM induces significant complications. Under conditions of multifactor lesion of organ-targets in DM, significant frequency of accompanying cardiovascular pathology, AH, urinary tract infection, wide use of drugs blocking rennin-angiotensin system (RARAS), that significantly influence on the evaluation of protein excretion, identification of classic DN is very difficult. In this connection the use of classification of CKD as the main criterion for formation of groups of comparison is considered for us to be the most optimal choice.
What is the basis for effect of gene polymorphism on the development of that or other pathology and, consequently, on the possibility to study and evaluation of risks? Polymorphic marker of gene represents the variable site of DNA, which carrying of certain variant induces change of product of gene expression (enzyme activity or protein-transporter) that, in its turn, directly or most of all, indirectly, change one phenotype sign. However the presence of allele or genotype of risk does non result in development of disease, only at specific combinations of alleles and genotypes genetic predisposition may be realized into phenotype of pathology under effect of pathological ambient factors. As a rule, research included polymorphic markers of those genes, which code modulators of investigated pathology known underlying the pathogenesis of disease.
In our research the reliable association with development of CKD was shown by the markers of a gene coding key media-
was observed with a genotype DD, whereas, at presence of CKD the frequency of occurrence of genotype DD accounted for 84,3%. The data are submitted in table 4.
tors of kidney damage: vasoactive factors of endothelium (ACE). Polymorphism of ACE gene type of insert/absence of insert (I/D, insertion/deletion). This polymorphism connected with level of angiotensin converting enzyme and, consequently, regulates production of angiotensin II -key factors for development and progressing of glomerulosclerosis. To the present time there have been accumulated multiple data about presence of association of I/D polymorphism of ACE with vascular complications of DM: DN, IHD and myocardial infarction. Meta-analysis, including investigations for 10-year period and 14727 patients with DM showed that genotype DD of gene ACE seems to be independent risk factor for development of DN in type 1 DM and type 2 DM [9]. In our work there was revealed statistically significant differences between groups of CKD in type 1 DM in children and adolescents of Uzbek population.
Conclusions:
1. As a result of research it is established, that the development of CKD in children and adolescents with type 1 DM of Uzbek population is genetically determined.
2. It is established, that carrying of genotype DD of gene ACE has predisposing meaning, as at DM by duration more than 10 years without CKD no sole case was with a genotype DD, whereas, at presence of CKD the frequency of occurrence of a genotype DD has made 75%.
3. The reliable association of the risk of CKD with polymorphism of ACE gene has been revealed, that, in its turn, allows to use data of polymorphic markers as genetic diagnosticum in order to prognose CKD and to form risk groups for development of pathology at the pre-clinical stage.
Table 4. - Distribution of markers and genotypes of gene ACE in children and adolescents with type 1 DM with presence or absence of CKD without taking into consideration of disease duration
Genotypes CKD+, n=51 CKD-, n=69 OR 95% CI P
II 3 5,9 46 66,7 32,0 8,99-113,4 0,0001
I/D 5 9,8 23 33,3 4,60 1,61-13,1 0,005
DD 43 84,3 - -
OR; 95% CI; p 28,9; 9,94-84,0; 0,0001 4,0; 1,97-8,12; 0,0001
Reliably more than DD Reliably more than II
References:
1. Vikulova O. K. Clinical-laboratory and genetic factors of development and progressing of diabetic nephropathy in the patients with type 1 diabetes mellitus: Autoref. Diss. ... cand.med.sci. - Moscow; - 2003.
2. Zablitsev S. V., Chernobrivtsev P. A., Kishenya M. S., Pischulina S. V. Role of genetic marker of endothelial dysfunction of gene ACE in the pathogenesis of glomerulonephritis. Tavricheskiy medico-biological vestnik, - 2012. - Vol. 15, - No. 3. - 105-108.
3. Ivanova I. E., Rodionov V. A., Semenova L. V. Chronic kidney disease in children of Chuvashckaya Republic. Pediatric, - 2011, - Vol. 90, - No. 3. - 138-144.
4. Maslova O. V., Cuntsov Yu. I., Shestakova M. V., Kazakov I. V., Bikulova O. K., Cukhareva O.Yu. et al. Prevalence of kidney lesion in diabetes mellitus of type 1 and type 2 in the Russian Federation. Diabetes Mellitus. - 2009. - No. 4. - 47-51.
5. Rakhimova G. N., Sadikova A. S. Clinical-genetic risk factors for development of chronic renal insufficiency in children and adolescents with type 1 DM ofUzbek population. Theoretical and Clinical medicine, - 2014. - 124-128.
6. Shestakova M. V., Dedov I. I. Diabetes mellitus and chronic kidney disease. - Moscow, - 2009.
7. KDIGO 2012 Clinical Practice Guideline for the Evaluation and Management of Chronic Kidney Disease. Kidney International Supplements. - 2013; - 3 (1):1—150. Available from: http://www. kdigo.org/clinical_practice_guidelines/pdf/CKD/KDIG0_2012_KD_
GL.pdf.
8. Fogarty D. G., Rich S. S., Hanna L., Warram J. H., Krolewski A. S. Urinary albumin excretion in families with type 2 diabetes is heritable and genetically correlated to blood pressure. Kidney Int. - 2000. - 57 (1): 250-257. - doi: 10.1046/j.1523-1755.2000.00833.x
9. Seaquist E. R., Goetz F. C., Rich S., Barbosa J. Familial clustering of diabetic kidney disease. Evidence for genetic susceptibility to diabetic nephropathy. N Engl J Med. - 1989. - 320 (18):1161-1165.
10. Ng D. P., Tai B. C., Koh D., Tan K. W., Chia K. S. Angiotensin-I converting enzyme insertion/deletion polymorphism and its association with diabetic nephropathy: a meta-analysis of studies reported between - 1994 and - 2004 and comprising 14,727 subjects. Diabeto-logia. - 2005; 48 (5):1008-1016. - doi: 10.1007/s00125-005-1726-2
11. Shestakova M. V., Vikulova O. K., Gorashko N. M., Voronko O. E., Babunova N. B., Nosikov V. V., et al. The relationship between genetic and haemodynamic factors in diabetic nephropathy (DN): Case-control study in type 1 diabetes mellitus (T1DM). Diabetes Res Clin Pract. - 2006. - 74 (2): - P. 41-50. - doi: 10.1016/j.diabres. - 2006.06.013.
12. Hixson J. E., McMahan C. A., McGill H. C. Jr, Strong J. P. Apo B. insertion/deletion polymorphisms are associated with atherosclerosis in young black but not young white males. Pathobiological Determinants of Atherosclerosis in Youth (PDAY) Research Group. Arterioscler Thromb. - 1992. - 12 (9):1023-1029. - doi: 10.1161/01. ATV.12.9.1023.
DOI: http://dx.doi.org/10.20534/ESR-17-1.2-108-110
Rakhimov Mirgolib Mansurovich, Samarkand State Medical Institute Department of Internal Diseases № 4 and Hematology
Resident of Master Degree E-mail: [email protected] Aralov Nematilla Ravshanovich, Samarkand State Medical Institute, Chief of the Department of Internal Diseases № 4 and Hematology
Associate Professor, E-mail: [email protected] Akhmedov Feruz Sayfullaevich, Doctor of Diagnostic Center "Doctor Aralov Medical" E-mail: [email protected] Ziyadullaev Shukhrat Khudayberdievich, Samarkand State Medical Institute, Chief of the Department of Internal Diseases, Pharmacology and Clinical Pharmacology. Associate Professor, E-mail: [email protected] Dushanova Gavkhar Abdukarimovna, Samarkand State University, Department of Physiology, Genetics and Biochemistry,
Associate Professor, E-mail: [email protected]
The degree of production cytokines il-8 and il-12 in patients with extrinsic allergic alveolitis
Abstract: The objective of the research was to examine the level of concentration of certain cytokines, involved in the regulation of immune response in patients with extrinsic allergic alveolitis (EAA), in particular production IL-8 and IL-12. To clarify the immunological bases of the pathogenesis EAA we studied the concentration of certain cytokines involved in the regulation of immune response in patients EAA in particular IL-8 production and IL-12. Analysis of the content of IL-8 in the surveyed patients EAA showed that the level of it's in the general group of patients studied was 38.4±2.5 pg/ml and greatly exceeds the values characteristic for healthy persons (18.1±1.8 pg/ml, p<0.01). Thus, the highest level studied parameter seen in the patients of chronic stage EAA that distinguishes this group among the total group studied patients with EAA, and distinguishes it from the two comparison groups with acute and subacute stage of the disease.
Keywords: Extrinsic allergic alveolitis, cytokines, immune response.
Introduction. Extrinsic allergic alveolitis (EAA) — a group of detected in 3% of patients with pulmonary and reaches 42 cases diseases characterized by allergic diffuse lesions of alveolar and in- per 100,000 populations [2, 4]. EAA is rightly considered immune terstitial lung structures and emerging in response to the repeated in- disease, the development of which the leading role belongs to al-halation dust of antigens organic and inorganic origin and use of lergic reactions of the 3rd and 4th types [1]. Nowadays, one of the drugs. According to the WHO group of diseases under this name is most important areas of immunology has been the development of
