CC BY
39
ках-черничниках Архангельской области: автореф. дисс. ... канд. с.-х. наук. - Л.: ЛТА, 1972. - 19 с.
7. Грязькин А.В. Возобновительный потенциал таежных лесов (на примере ельников Северо-Запада России) : монография. - СПб.: СПбГЛТА, 2001. - 188 с.
8. Гугелев С.М., Савицкий В.Ю., Люманов Р.А. и др. Оценка валочно-трелевочной машины на соответствие экологическим требованиям // Об-зорная информация. - М.: ВНИПИЭИлеспром, 1992. - 48 с.
9. Залесов А.С. Влияние главных рубок на возобновление ельников липня-ковой группы типов леса на Среднем Урале : автореферат дис. ... канд. с.-х. наук. - Екатеринбург, 2005. - 20 с.
10. Калиниченко Н.П., Писаренко А.И., Смирнов Н.А. Лесовосстановление на вырубках. - М., 1991. - 384 с.
11. Колданов В.Я. Смена пород и лесовосстановление. - М.: Лесн. пром-сть, 1966. - 171 с.
12. Обыденников В.И. Возобновление леса после проведения сплошных ру-бок: обзорная информация. - М., 1992. - 60 с.
13. Обыденников В.И., Кобылкин А.Т., Рожин Л.Н. Анализ использова-ния агрегатной техники в сосняках Забайкалья // Лесн. пром-сть, 1994. - №5/6. - С. 19-20.
14. Обыденников В.И. Географические особенности последствий сплошных рубок с использованием агрегатной техники // Лесное хозяйство, 1996. - №5. - С. 20-22.
15. Сабанин А.А. Формирование естественных древо-стоев на участках рубок леса с сохранением предваритель-
ных генераций хвойных пород: автореф. дисс. ... канд. с.-х. наук. - СПб.: ЛТА, 2003. - 18 с.
16. Санников С.Н. Естественное лесовозобновление в Западной Сибири. - Екатеринбург, 2004. - 254 с.
17. Смолин В.Н., Рудник А.М. Влияние системы лесосечных машин на лес-ную среду // Лесная промышленность, 1994. - №1. - С. 21-22.
18. Соловьев С.В., Сапожников А.П. Влияние рубок и пожаров на лесовоз-обновительный потенциал пихтово-е-ловых лесов хребта Вандан // Лесное хозяйство, 2010. -Вып.3. - С. 19-21.
19. Федорчук В.Н., Кузнецова М.Л. Особенности естественного возобновле-ния ели и сосны после проведения узкополосных рубок // Лесоводство, лесные культуры и почвоведение. - СПб., 1998. - С. 76- 83.
20. Чмыр А.Ф. Эколого-биологические основы восстановления еловых лесов южной тайги (Северо-Запад Европейской части РСФСР): автореф. дисс. ... доктора биол. наук. - Минск, 1980. - 40 с.
21. Ягудин Ю.Н., Гугелев С.М. Лесовозобновление на лесосеке // Лесн. пром-сть, 1991. - №7. - С. 18.
22. Harvey B.D., Bergeron Y. Site patterns of natural regeneration following clear-cutting in northwestern Quebec // Can. J. Forest, res. 1989. 19. №11. - P. 1458-1469.
23. Pominville P., Ruel J. Effets de la coupe a blanc et de la coupe par bandes sur la regeneration obtenue apres 5 ans dans des pessieres noires du Quebec // Can. J. Forest res. 1995. 25. 2. - P. 329-342.
GENE ANALYSIS OF SALT TOLERANCE IN WHEAT (TRITICIUM AESTIVUM L.) VARIETIES, APPLICATION POSSIBILITY IN
BREEDING
Odgerel Bold
Researcher at Biotechnology lab in Plant Protection Research Institute, Ulaanbaatar
Dejidmaa Turmunkh
Head of Biotechnology lab in Plant Protection Research Institute, Ulaanbaatar
Enkhchimeg Vanjildorj
Professor at Department of Biotechnology and breeding, College of Animal science and Biotechnology, Mongolian University of
Life Sciences, Ulaanbaatar
ABSTRACT
Wheat (Triticum aestivum L.) is a strategic crop for food consumption in Mongolia. It is difficult to select a genotype which suited certain condition, because biological and useful characteristics of wheat defined by gene combinations, and modify according to the environmental factors. In Mongolian harsh climatic condition, it is economically necessary to introduce wheat varieties with stable characteristics of yield and quality. The purpose of the research work is to define salt resistant capacity of some commonly grown varieties in Mongolia; to observe activation of responsible genes and their interactions; and to reveal possibilities to obtain salt tolerance varieties using these characteristics and utilization of varieties in the wheat selection. When the overlapping of homology nucleotides consequences of the salt responsive genes analyzed cluster SOS1, SOS2, SOS3, SOS4, SOS5, SOS6, P5CS1, CIPK3, WRKY1 and WRKY10 genes of wheat genome were 82.81-88.47% overlapping with the rice. The interrelationship of analysis was done based on mapping of phylogenetic sequences of cDNA of drought and salt tolerance genes of wheat. To compare salt tolerance to the gene Actin, SOS5, P5CS1, CIPK3, WRKY1 and WRKY10 showed expression to all experimental varieties, and highest in the varieties Darkhan-74 and Darkhan-34.
Key words: Wheat (Triticum aestivum L.), salt tolerance, SOS1-6, P5CS1, CIPK3, WRKY1, WRKY10
Introduction
Wheat (Triticum aestivum L.) is a strategic crop for food consumption in Mongolia. It is difficult to select a genotype which suited certain condition, because biological and useful
characteristics of wheat defined by gene combinations, and modify according to the environmental factors. In Mongolian harsh climatic condition, it is economically necessary to introduce wheat varieties with stable characteristics of yield
and quality. From the abiotic stress factors drought, cold, soil salinity and decline of soil fertility (especially loss of nitrogen) are considered most crucial factors on yield loss.
High soil salinity is a major abiotic stress in plant agriculture worldwide [19]. Increases in salinity tolerance for the world's two staple crops, wheat and rice, are an important goal as the world's population is increasing more quickly than the area of agricultural land to support it (FAO, 2010). Urban spread has reduced the area of prime land available for agriculture, so productivity must increase to maintain global food supply. Meanwhile, rising water tables due to land clearing or irrigation are causing salinization and desertification of previously productive land globally [13]. Food production is limited by this human-induced salinity, together with the natural and complex salinity found in soils of most semi-arid regions of the world [14].
This study was carried out for understanding of salt tolerance mechanisms of wheat (Triticum aestivum L.) under salinity conditions. For this aim, 10 days old (T. aestivum L.) seedlings were subjected to salt (200 mM NaCl ) stress for 48 hours and then gene expression of SOS1, SOS2, SOS3, SOS4, SOS5, SOS6, P5CS1, CIPK3, WRKY1 and WRKY10 was revealed in some local varieties of wheat namely Darkhan-34, Darkhan-74, Darkhan-131, Darkhan-141, Darkhan-144, Khalkhgol-1, to observe activation of responsible genes and their interactions; and to reveal possibilities to obtain salt tolerance varieties using these characteristics and utilization of varieties in the wheat breeding program.
Materials and methods
Plant materials and stress treatments. The seeds of 6 of Mongolian local wheat (T. aestivum L.) varieties, Darkhan-34, Darkhan-74, Darkhan-131; Darkhan-141, Darkhan-144 and Khalkhgol-1 were obtained from the Plant Science and Agricultural Training Research Institute of Darkhan-Uul. The seeds were sterilized in 70% ethanol for 3 min, and then were rinsed with sterilized water. The sterilized wheat seeds were germinated in a growth chamber (25°C, 200 ^molm-2s-1, 16h light/8 h dark cycle). The 10 days old seedlings were transferred to petri dishes containing 200 mM NaCl solutions, and incubated under light for 24 h. The treatments, wheat seedlings at similar
Gene specific primers
growth states were used, and untreated wheat seedlings were taken as controls. Leaf samples were frozen in liquid nitrogen, and then stored at -70°C until RNA extraction. The experiment was carried out three times independently under the same conditions.
RNA isolation and cDNA synthesis. Total RNA was isolated by using the TRIzol reagent (Invitrogen) according to the manufacturer's instructions. The RNA preparations were subjected to DNase digestion in the presence of a recombinant ribonuclease inhibitor. Specific primers were designed to amplify these cDNAs. PCR amplifications were performed at 420C for 15 min, followed by 35 cycles of 950C for 5 min with a final extension at 40C for 5 min.
RT-PCR analysis. RT-PCR was used to determine the expression of specific ESTs in the WRKY1, WRKY10, P5CS1, CIPK3 and SOS gene family after treating wheat seedlings with 200 mM NaCl. Primers (Table 1) used in RT-PCR had high specificity, as determined by 1% agarose gel electrophoresis. The RT-PCR reactions were performed using TaKaRa DNA polymerase for 35 cycles (TaKaRa, Daejong, Korea). Expression levels of target genes were normalized using TaActin as an internal control. RT-PCR analysis, the PCR conditions were as follows: an initial denaturation step at 95°C for 5 min (1 cycle), followed by 35 cycles (95°C for 30 s, 50°C for 30 s, and 72°C for 1 min) and a final extension cycle of 7 min at 72°C. Three independent experiments were performed and gave similar results.
Results
The Characteristics of WRKY1, WRKY10, SOS1, SOS2, SOS3, SOS4, SOS5, SOS6, P5CS1, CIPK3 genes in Wheat. To obtain salinity responsive WRKY1, WRKY10, SOS1, SOS2, SOS3, SOS4, SOS5, SOS6, P5CS1, CIPK3 genes in wheat, we referred to the highly similar orthologs in rice. Then, we performed TBLASTN analysis in the DFCI database (http:// compbio.dfci.harvard.edu/tgi/) using salinity stress induced rice WRKY1, WRKY10, SOS1, SOS2, SOS3, SOS4, SOS5, SOS6, P5CS1, CIPK3 cDNA sequences and then expression patterns were analyzed by RT-PCR under various salinity stress conditions.
Table1.
sed for RT-PCR analysis
Gene Name Forward sequence Reverse sequence
SOS1 5'-CGGTGGTGTATAGCATTGTTGTAT-3' 5'-AATGCATTGTGTACAGGTTCACTC-3'
SOS2 5'-CTGCCCAAGGAAATGTTCAG-3' 5'-ATCCTATTCCTGTACACCACCAGT-3'
SOS3 5'- GAAGAACATGACTCTCCCATACCT-3' 5'-ACATGATGT TGTATGCCTGAGACT-3'
SOS4 5'- TGAGATACCCAAGATACCTGCATA-3' 5'-TGATCTCATCCTGGCTTTGTATTA-3'
SOS5 5'-TGATCTCATCCTGGCTTTGTATTA-3' 5'-AATGCATTGTGTACAGGTTCACTC-3'
SOS6 5'-TCCAGAGAAAGAACCTCCATTAAC-3' 5'-TTGTAAGGGTCCCTCTTTAGACTG-3'
P5CS1 5'-GATCTTGTTATTCCAAGAGGCAGT-3' 5'- AAGCAGTGTTTCCATAGCATTACA-3'
CIPK3 5'-CTTGATTCATGTGGAAATCTGAAG-3' 5'-TAGAGTCCTCAAAAGGCAAATACC-3'
WRKY1 5'-GCATCCTAGGGGTTACTACAAGTG-3' 5'-TCTT TCTCTAGAAAACGGAGGCTA-3'
WRKY10 5'-GCTGCCT TCTACACAT TCCAGT-3' 5'-CACCTCCAGCTGCT TCTCTAAT-3'
Actin 5'-CTTGTATGCCAGCGGTCGAACA -3' 5'- CTCATAATCAAGGGCCACGTA -3'
The table shows the primers used during RT-PCR experiments Reverse transcription polymerase chain reaction (RT-PCR). and annealing temperature for each gene (SOS2, S0S6-580C; RT-PCR analyses showed that WRKY1, WRKY10, SOS1, SOS1, SOS3, P5CS1-590C; SOS2, SOS5, CIPK3-600C). SOS2, SOS3, SOS4, SOS5, SOS6, P5CS1, CIPK3 genes were
significantly regulated by salinity stresses in 6 of Mongolian as the templates for RT-PCR. WRKY1, WRKY10, SOS1, SOS2, local wheat varieties (Fig. 1). To clarify the tissue expression SOS3, SOS4, SOS5, SOS6, P5CS1, CIPK3 genes was detected patterns of genes, mRNA isolated from wheat leaves were using varying degrees of expression in leaves of 10-day-old seedlings. Figure 1. Expression levels of wheat salinity upregulated genes under 200mM NaCl treatment.
To compare salt tolerance to the gene Actin, SOS1, SOS2, SOS3, SOS4, SOS5, SOS6, P5CS1, CIPK3, WRKY1, WRKY10 showed expression to all experimental varieties, and highest expression level was shown in the varieties Darkhan-74 and Darkhan-34.
Discussion
Wheat is the foremost staple food crop in the world which provides both calories and proteins to over 35% of the human population [12]. The production of wheat is affected by multiple environmental stresses, including drought, salinity and extreme temperatures [13]. In the present study, wheat WRKYs were identified and TaWRKY1 and TaWRKY10 gene expression show the all 48 hours salinity treatment in 6 variety of Mongolian local wheat (T. aestivum L.). The highest expression level was Darkhan-74 and Darkhan-34 and lowest expression level was Darkhan-131 respectively was (Fig. 1) characterized to function as a positive factor in salinity stresses. When the overlapping of homology nucleotides consequences of the salt responsive genes analyzed cluster SOS1, SOS2, SOS3, SOS4, SOS5, SOS6, P5CS1, CIPK3, WRKY1 and WRKY10 genes of wheat genome were 82.81-88.47% overlapping with the rice. Expression of all three SOS genes was induced by salt stress in roots and, in particular, high levels of SOS1 expression were detected in root epidermal cells of A. thaliana [16]. Originally, the SOS pathway, like other signal transduction pathways, was thought to function in a linear system from an unknown Na+ sensor through SOS3 and SOS2 to mediate the Na+/H+ antiport activity of SOS1. In the present study, salt tolerance characteristics of wheat defined combination of SOS1, SOS2, SOS3, SOS4, SOS5, SOS6, P5CS1, WRKY1 and WRKY10 gene expression levels and its interrelationships.
Conclusion
In conclusion, our results clearly demonstrated that WRKY1, WRKY10, SOS1, SOS2, SOS3, SOS4, SOS5, SOS6, P5CS1, CIPK3 genes are salinity stress-inducible genes and that the show expression in 6 wheat variety of the Mongolian local variety WRKY1, WRKY10, SOS1, SOS2, SOS3, SOS4, SOS5, SOS6, P5CS1, CIPK3 was up-regulated by NaCl. Darkhan 74
and Darkhan-34 was selected the most salinity resistant variety and Darkhan-131 was selected the most salinity sensitive variety depending upon WRKY1, WRKY10, SOS1, SOS2, SOS3, SOS4, SOS5, SOS6, P5CS1, CIPK3 genes expression level after 48 hours 200mM NaCl stress treatment.
References:
1. Christian A. Ross, Yue Liu and Qingxi J. Shen 2007. The WRKY Gene Family in Rice (Oryza sativa) 49 (6): 827-842
2. Eulgem, T., Rushton, P.J., Robatzek, S., Somssich, I.E., 2000. "The WRKY superfamily of plant transcription factors" Trends Plant Sci. 5, (2010)199-206.
3. FA0.2010. FAO Land and Plant Nutrition Management Service. http://www.fao.org.
4. Girdhar K. Pandey, Yong Hwa Cheong, Kyung-Nam Kim, John J. Grant, Legong Li, Wendy Hung, Cecilia D'Angelo, Stefan Weinl, Jörg Kudla, and Sheng Luan "The Calcium Sensor Calcineurin B-Like 9 Modulates Abscisic Acid Sensitivity and Biosynthesis in Arabidopsis" Plant Cell. (2004); 16(7): 19121924. doi: 10.1105/tpc.021311
5. Golldack D, Liking I, Yang O "Plant tolerance to drought and salinity: stress regulating transcription factors and their functional significance in the cellular transcriptional network" Plant Cell Rep. 30 (2011) 1383-1391
6. Knight H., and .Knight M.R, Imaging spatial and cellular characteristics of low temperature calcium signature after cold acclimation in Arabidopsis. J. Exp. Bot. 51, (2000) 1679-1686.
7. Knight H., and Knight M.R., Abiotic stress signalling pathways: Specificity and cross-talk. Trends Plant Sci. 6, (2001) 262-267
8. Kyung-Nam Kim, Yong Hwa Cheong, John J. Grant, Girdhar K. Pandey, and Sheng Luan "CIPK3, a Calcium Sensor-Associated Protein Kinase That Regulates Abscisic Acid and Cold Signal Transduction in Arabidopsis" Plant Cell (2003) 15(2): 411-423
9. Hongtao Ji, José M. Pardo, Giorgia Batelli, Michael J. Van Oosten, Ray A. Bressan and Xia Li The Salt Overly Sensitive
(SOS) Pathway: Established a Emerging Roles. Molecular Plant, Volume 6, Number 2, (2013) Pages 275-286.
10. Huazhong Shi, Francisco J. Quintero, Jose M. Pardo, and Jian-Kang Zhua "The Putative Plasma Membrane Na/H Antiporter SOS1 Controls Long-Distance Na Transport in Plants H" The Plant Cell, (2002) Vol. 14, 465-477
11. Niu C, Wei W, Zhou Q, Tian A, Hao Y, et al. (2012) Wheat WRKY genes TaWRKY2 and TaWRKY19 regulate abiotic stress tolerance in transgenic Arabidopsis plants. Plant Cell Environ 35: 1156-1170.
12. Nevo E, Korol AB, Beiles A, Fahima T (2002 Calcium signaling in Arabidopsis thaliana responding to drought and salinity. Plant J. 12, (1997) 1067-1078) Evolution of wild emmer and wheat improvement: Population genetics, genetic resources, and genome organization of wheat's progenitor, Triticum dicoccoides. i-xxii, 1-364 p.
13. Rengasamy P. 2006. World salinization with emphasis on Australia. Journal of Experimental Botany 57, 1017-1023.
14. Rengasamy P. 2010. Soil processes affecting crop production in saltaffected soils. Functional Plant Biology 37, 255-263.
15. Shannon M. C, "Adaptation of plant salinity" Adv. Agron. 60: (1998) pp. 75-119
16. Shi, H., Quintero, F.J., Pardo, J.M., and Zhu, J.K. (2002). The putative plasmamembrane Na+/H+ antiporter SOS1 controls longdistance Na+ transport in plants. Plant Cell. 14, 465-477.
17. Wenming Du, Huixin Lin, She Chen, Yisheng Wu, Jun Zhang, Anja T.Fuglsang, Michael G.Palmgren, Weihua Wu, and Yan Guo "Phosphorylation of SOS3-Like Calcium-Binding Proteins by Their Interacting SOS2-Like Protein Kinases Is a Common Regulatory Mechanism in Arabidopsis1" Plant Physiology, (2011) Vol. 156, pp. 2235-2243
18. Yong Hwa Cheong, Kyung-Nam Kim, Girdhar K. Pandey, Rajeev Gupta, John J. Grant, and Sheng Luan, CBL1, a Calcium Sensor That Differentially Regulates Salt, Drought, and Cold Responses in Arabidopsis. Plant Cell, Vol. 15, (2003)1833-1845.
19. Zhenxian Gao , Xiaoliang He , Baocun Zhao , Chunjiang Zhou , Yingzhu Liang , Rongchao Ge , Yinzhu Shen and Zhanjing Huang, Overexpressing a Putative Aquaporin Gene from Wheat, TaNIP , Enhances Salt Tolerance in Transgenic Arabidopsis. Plant Cell Physiol. 51(5): 767-775 (2010) doi:10.1093/pcp/ pcq036.
БИОЛОГИЗАЦИЯ СЕВООБОРОТОВ И ИХ ПРОДУКТИВНОСТЬ В ПАРОВЫХ ЗВЕНЬЯХ С ЯРОВОЙ ПШЕНИЦЕЙ
ЖАРОВА Татьяна Федоровна
научный сотрудник, ФГБНУ «Тувинский научно-исследовательский институт сельского хозяйства», Кызыл
ROTATION BIOLOGIZATION AND PRODUCING CAPACITY IN FALLOW PARTS
WITH SPRING WHEAT
Zharova Tatyana Fedorovna
senior science master, FSBI «Tuvan research Institute of agriculture»
АННОТАЦИЯ
Представлены результаты исследований, по влиянию полевых севооборотов на урожай-ность яровой пшеницы на темно-каштановой почве в условиях лесостепи Улуг-Хемской котловины Тувы. На основе исследований показана возможность рационального и эф-фективного использования чистых, занятых и сидеральных паров. Установлено, что за три ротации севооборотов, предшественники яровой пшеницы (донник и горох), влияют на агрохимические свойства почвы: перед посевом яровой пшеницы содержание нитратного азота по предшественникам соответствует средним и повышенным содержанием в почве. Прослеживаются, некоторые преимущества в мобилизации фосфатов по донниковым парам в сравнении с чистым паром. Увеличение содержания основных элементов питания в сево-оборотах позволяет получать устойчивый урожай яровой пшеницы. Установлено, что на фоне естественного плодородия лучшая урожайность достигается во влажные годы по паровым предшественникам, в сидеральных и занятых парах.
ABSTRACT
The fore crop effects on spring wheat yield and agrochemical properties of dark chestnut soil in a climate of Ulug-Khem's forest-steppe were considered in this study. Opportunity for effective use a complete fallow, a seeded fallow and a green-manured fallow was showed. It has been established that spring wheat forecropes (melilot and pea) building up the soil over three crop rotations. Content nitrate nitrogen after forecropes, before seeds correspond average and high concentration in soils on the same basis as dung application (30 t/ha). Concentration of labile phosphorus is higher after legume fallow than after fallow on 9.4%. The minimal concentration increase of nutrition basic elements in forecropes is obtained sustainable yield of spring wheat and raised agrochem-ical soil criterion. It was shown that superior yield against natural fertility is attained on fallow forecropes during wet years. The superior yield is obtained on complete fallow and seeded fallow during medium years after using organic and mineral amendments.
Ключевые слова: предшественники, темно-каштановая почва, сидераты, урожайность, яро-вая пшеница.
Keywords: forecrop, dark chestnut soil, yield, green manure, spring wheat.
В условиях земледелия в республике Тува наибольшую элементами минерального питания. Од-нако очевидны эко-урожай-ность пшеница формирует в зернопаровых севоо- логические и энергетические издержки парования, ме-ха-боротах за счет лучшей обеспеченности посевов влагой и ническая обработка пара приводит к изменениям водного
