CC BY
76
ISSN 0869-4362
Русский орнитологический журнал 2007, Том 16, Экспресс-выпуск 356: 567-575
First insights into a DNA sequence based phylogeny of the Eurasian Jay Garrulus glandarius
A.Akimova1), E.Haring2), S.Kryukov1), A.Kryukov1)
1)1 Institute of Biology and Soil Science,
Far East Branch of the Russian Academy of Sciences, Vladivostok, Russia
2) Museum of Natural History, Vienna, Austria
Received 23 April 2007
The Eurasian jay Garrulus glandarius Linnaeus, 1758 is a widespread Palearctic species which includes 33-35 more or less differentiated subspecies. These subspecies, combined into eight groups (Stresemann 1940; Vaurie 1959) were later classified in five morphologically and geographically defined groups (Goodwin 1986). Besides G. glandarius, two mono-typic species belong to the genus: Lidth's jay Garrulus lidthi Bonaparte, 1850 (restricted to some southern Japanese Islands) and Black-headed jay Garrulus lanceolatus Vigors, 1831 (Himalayas).
Up to now, molecular phylogenetic studies including jays were published mainly for inter-species and inter-genus comparisons. Cibois and Pasquet (1999) investigated the phylogenetic relationships of 11 genera of Corvidae using sequence of the mitochondrial (mt) cytochrome b gene (cytb) as a molecular marker. In that analysis a close relationship of G. glandarius and the Siberian jay Perisoreus infaustus was rejected, a result which was confirmed later by Ericson et al. (2005) in an analysis based on one mt and two nuclear genes. These authors revealed a closer relationship of jays with several genera of the Old World corvids than to the monophyletic group of New World jays.
Besides those studies, no phylogenetic analyses were performed concerning interspecific relationships within the genus Garrulus or the in-traspecific variation within G. glandarius. Therefore, the aim of the study was to provide insights into the phylogeography of jays and to assess in-traspecific genetic variation and phylogeographic patterns. We analyzed sections of two mt sequences with different substitution rates: the cytb gene and the control region (CR). The latter one is in general considered as the faster evolving sequence and therefore was supposed to be especially useful for intraspecific studies (e.g. Kryukov et al. 2004). On the territory of Russia and adjacent countries, five subspecies are recognized (Stepanyan 2003): G. glandarius glandarius (Linnaeus, 1758), G. glandarius brandtii Eversmann, 1842; G. glandarius iphigenia Sushkin et
Ptuschenko, 1914; G. glandarius krynicki Kaleniczenko, 1839; G. glan-darius hyrcanus Blanford, 1873. Besides samples of these subspeices we included also G. glandarius japonicus Temminck et Schlegel, 1847 from Japan as well as G. lidthi. We wanted to find out whether the individuals cluster according to subspecies assignment (i.e., geographic origin) as well as the level of their genetic differentiation.
Material
The sample set included 26 specimens (Table 1) belonging to five subspecies covering a huge range from Western Europe to Japan: G. g. glandarius (distributed in Europe), G. g. brandtii (Asia), G. g. krynicki (Caucasus and Turkey), G. g. iphigenia (Crimea), G. g. japonicus (Japan), and one hybrid between G. g. glandarius and G. g. krynicki (taken from South Russia), and also G. lidthi. Samples of livers and muscles fixed in 96% ethanol and kept in -4°C were used. As an outgroup, we used the magpie Pica pica (sequence determined in a previous study: Kryukov et al. 2004) and the chough Pyrrhocorax pyrrhocorax (this study). Accession numbers of all sequences determined in this study as well as of published sequences are given in Table 1.
Methods
DNA-extraction was performed with the phenol-chloroform deproteinization method (Maniatis et al. 1982). The two marker sequences were analyzed in two different laboratories (IBSS, Vladivostok and NHMW, Vienna). A partial region of cytb (length of PCR product: 586 bp) was amplified at the IBSS employing several published primers used previously for corvid birds (L14827, H16065, Helm-Bychowski, Cracraft 1993; L14990, Kocher et al. 1989; H15916, Edwards et al. 1991; and SNL4 (L15196), Kryukov, Suzuki 2000). All these primers initiated amplification, but the most successful combination (yielding one clear fragment on the gel) proved to be L15916 (ATGAAGGGATGTTCTACTGGTTG) / H16065 (GGAGTCTTCAGTCTCTGGTTTACAAGAC). Polymerase chain reaction was carried out in a «Biometra» Thermocycler (USA) in 20 pl of reaction containing 2 pl of 10x buffer, 0.125 mM MgCl2, 0.1 mM of each dNTP, 1 pmol of each primer, 60 ng of template DNA and 1 unit of Taq-DNA-polymerase. PCR was performed under the following conditions: 5 min of pre-denaturation at 94°C, 35 cycles of denaturation for 1 min at 95°C; primer annealing for 2 min at 55°C; elongation for 2 min at 72°C, and finally an elongation step for 7 min at 72°C before cooling to 4°C. The amplification products were analyzed by electrophoresis in 1.5% agarose gels before sequencing.
Automated sequencing was perfomed with an ABI Prism 310 (Applied Biosystems). Cycle sequencing of purified PCR products was performed with the BigDye Terminator kit (Applied Biosystems) and the primers SNL4 and H15916 at a final concentration of 1 pmol/pl. Conditions of cycle sequencing: 25 cycles of denaturation for 30 sec at 96°C, annealing for 10 sec at 55°C, and elongation for 4 min at 60°C, and finally cooling to 4°C. A partial section of the CR was amplified at the NHMW with the primers CR-Cor+ (ACCCTTCAAGTGCGTAGCAG)
and Phe-Cor- (TTGACATCTTCAGTGTCATGC) as described previously (Kryukov et al. 2004). PCR products (length: ~ 680 bp) were extracted from 1% Agarose gels using the Quiaquick Gel Extraction Kit (Qiagen) and cloned using the TOPO TA cloning Kit (Invitrogen). Sequening of both strands was performed by MWG Biotech (Germany) using M13 universal primers.
Table 1. Specimens and sequences from GenBank used in the study.
Labcode Geographic origin Source / Marker Accession
collection number sequences numbers
Garrulus glandarius glandarius
Gglagla1 Russia, Kirov Region V.Sotnikov / 174 cytb EF602118
Gglagla2 Russia, Kirov Region V.Sotnikov / 227 cytb EF602119
Gglagla3 Russia, Kirov Region V.Sotnikov / 228 cytb EF602120
Gglagla4 Russia, Kirov Region V.Sotnikov / 233 cytb EF602121
Gglagla5 Russia, Kirov Region V.Sotnikov / 235 cytb EF602122
Gglagla6 Russia, Kirov Region V.Sotnikov / 239 cytb, CR EF602123, EF602136
Gglagla7 Russia, Kirov Region V.Sotnikov / 243 cytb EF602124
Gglagla8 Russia, Kirov Region V.Sotnikov / 226 CR EF602137
Gglagla9 Russia, Smolensk Region Ya.Red'kin / 126 cytb EF602125
Gglagla10 Russia, Tula Region Ya.Red'kin / 128 CR EF602138
Gglagla11 Russia, Moscow Region V.Korbut / 175 cytb, CR EF602126, EF602139
Gglagla12 Russia, Moscow Region M.Konovalova / 518 cytb EF602127
Gglagla13 France E.Pasquet / 381 cytb, CR EF602128, EF602140
Gglagla14 Austria, Upper Austria A.Gamauf CR EF602141
Gglagla15 Austria, Upper Austria A.Gamauf CR EF602142
Gglagla16 GenBank Cibois, Pasquet 1999 cytb U86034
Garrulus glandarius b r a n dt i i
Gglabra1 Russia, Primorsky Region A.Kryukov / 354 CR EF602146
Gglabra2 Russia, Primorsky Region A.Tsvetkov / 347 cytb EF602131
Gglabra3 Russia, Primorsky Region Ya.Red'kin / 346 cytb, CR EF602132, EF602147
Gglabra4 Russia, Amurskaya Region N.Kolobaev / 239 cytb, CR EF602133, EF602148
Gglabra5 Russia, Primorsky Region V.Sotnikov / 351 cytb EF602134
Garrulus glandarius i phi g e ni a
Gglaiph1 Russia, Crimea pen. Ya.Red'kin / 747 CR EF602144
Gglaiph2 Russia, Crimea pen. V.Arhipov / 748 CR EF602145
Garrulus glandarius krynicki
Gglakry2 Russia, Kislovodsk Ya.Red'kin / 125 cytb, CR EF602130, EF602149
Garrulus glandarius krynicki x G. glandarius glandarius
Gggxk1 Russia, Rostov Region G.Bahtadse / 375 cytb, CR EF602129, EF602143
Garrulus glandarius ja p o ni c u s
Gglajap1 Japan, Honshu W.Neuner cytb, CR EF602135, EF602150
Garrulus l i dt h i
Glid1 Japan, Riukiu Isl. E.Pasquet / 383 CR EF602151
Glid2 GenBank Cibois, Pasquet 1999 cytb U86035
Pica pica j a n ko w s kii
Ppicjan5 Russia, Primorsky Region A.Kryukov / 714 cytb, CR AY701183, AY701171
Pyrrhocorax pyrrhocorax brachypus
Gpyrbra1 Russia, Tuva Rep. Ya.Red'kin / 104 CR EF602152
Gpyrbra2 Russia, Tuva Rep. A.Tsvetkov / 133 CR EF602153
Phylogenetic analysis
Experimental sequences and those obtained from the GenBank were aligned with the software SeaView (Galtier et al. 1996). Phylogenetic trees (NJ, MP and ML) were calculated with PAUP, version 4.0b10 (Swofford 2002). NJ trees were calculated with p-distances. MP trees were calculated by a heuristic search with a random taxon addition sequence (1000 replicates) and the TBR (tree bisection reconnection) branch swapping algorithm and delayed character transformation (DELTRAN). Gaps were treated as missing character. ML trees were calculated by a heuristic search with a NJ starting tree and TBR branch swapping using the GTR+Г model. For all tree calculating algorithms (NJ, MP and ML) a bootstrap analysis was performed with 1000 (NJ, MP) or 100 (ML) repeats, respectively. Pairwise P-distances and Kimura 2-parameter distances were calculated with the program DNASA (Kryukov et al., in press). Average distances were calculated by hand from the tables obtained from DNASA.
Results and Discussion
The partial cytb sequence was isolated from 18 individuals comprising the four subspecies: G. g. glandarius, G. g. brandtii, G. g. krynicki, and G. g. japonicus. The partial sequence of the CR was determined from 16 Gar-rulus individuals. Besides the four subspecies mentioned above, the CR data set includes also two samples of G. g. iphigenia. Moreover, two Gar-rulus sequences from GenBank were included: Gglagla16 and Glid2 (cytb). Pica pica and Pyrrhocorax pyrrhocorax were used as outgroup: Ppicjan5 (ctyb, CR; sequences from Kryukov et al. 2004) and Ppyrbra1, 2 (CR; this study). Lengths of the alignments were 586 bp for cytb (about half of the total gene, 1143 bp) and 677 bp for the CR.
Within the cytb sequences no insertions or deletions were found. Nucleotide frequencies for the cyt b gene were: А = 0.2942, T = 0.2272, G = 0.1120, C = 0.3666. The G-criterion was calculated as 1.0922 which means equal nucleotide dispersion within the section studied. As expected, synonymous transitions at the third codon positions were found as the most common substitution type, which is in agreement with published data for many animals. Among birds, up to 78% of informative substitutions are located in the third codon position (Helm-Bychowski, Cracraft 1993).
The neighbor-joining tree based on the cytb sequences is shown in Fig. 1. The MP and ML trees calculated from this data set have in general the same topology with the four subspecies of G. glandarius separated in four clusters (bootstrap values of all analyses are shown in Fig. 1 as NJ/MP/ML). Among them, the most basal split separates G. g. japonicus from the mainland taxa. G. g. brandtii splits off from the next node. Finally, a clade comprising the 12 individuals of G. g. glandarius is the sister group of the G. g. krynicki clade which includes also a hybrid between G. g. glandarius and G. g. krynicki. The hybrid origin of this phenotypi-
73,64,59
cally intermediate bird was approved by Ya.Red'kin (pers. comm.). Within subspecies, haplotype variation is rather low which is especially interesting for the nominate race the samples of which originated from quite distant European regions, i.e. Kirov (East European Russia), Austria and France.
- Gglagla3
- Gglagla13 Gglagla5 Gglagla1 Gglagla6 Gglagla16
Gglagla7 Gglagla2 Gglagla4 70,64,- Gglagla12 Gglagla11
- Gglagla9
100,96,85
100,100,90
100,100,83
I Gggxk1 /1 Gglakry2
100,79,66
100,100,99
Gglabra4 Gglabra3 Gglabra5 — Gglabra2
Gglajap1
Glid2
Ppicjan5
0.5%
Fig. 1. NJ tree based on cyt b sequences of Garrulus glandarius, G. lidthi and P. pica (outgroup). Bootstrap values >50% are depicted at the nodes (NJ, MP, ML). Labcodes of specimens correspond to those in Table 1.
The NJ tree calculated on the basis of the CR data set is very similar to the cytb tree (Fig. 2). It includes also G. g. iphigenia which is part of the G. g. glandarius clade. The order of splits is the same as in the cytb tree.
The fact that the Japanese subspecies splits from the basal node in both trees is in accordance with the hypothesis about the first appearance of corvids in South East Asia from Australia (Sibley, Ahlquist 1985). In this context the origin of the genus Garrulus itself may have been located in South East Asia.
96,62,82
97,90,89
94,86,98
100,100,100
1,84£"
Gggxk1
88,60,80
98,91,
Gglakry2 r Gglagla10 Gglagla14 Gglagla15 p Gglagla11 Gglagla8 Gglaiph1 Gglaiph2 Gglagla13 Gglagla6 70,65,6^ Gglabra1 100,100,93 Gglabra4 Gglabra3 Gglajap1
Glid1
100,100,1001 Ppyrbra1
Ppyrbra2
Ppicjan5
1%
Fig. 2. NJ tree based on CR sequences of Garrulus glandarius, G. lidthi and the outgroup species Pica pica and Pyrrhocorax pyrrhocorax. Bootstrap values >50% are depicted at the nodes (NJ, MP, ML). Labcodes of specimens correspond to those in Table 1.
For both data sets we calculated average K2P distances between the four clades: G. g. glandarius including G. g. iphigenia (its distance to G. g. glandarius of 0.3% in the CR is neglectable), G. g. krynicki, G. g. brandtii, and G. g. japonicus (Tables 2 and 3). For comparison the p-distances are also shown. The differentiation of G. g. japonicus and G. g. brandtii is quite pronounced in both data sets. Average K2P distances between G. g. japonicus and the mainland subspecies range from 5.3-6.1 (cytb) and 4.44.9 (CR), for G. g. brandtii the respective values are 2-2.7 (cytb) and 2.62.8 (CR). This differentiation corresponds well with the distinct geographic distribution of these two subspecies in the Russian Far East and Japan respectively. In contrast, the differentiation between G. g. krynicki and G. g. glandarius is lower (1% in cytb and 2% in CR).
The average K2P distance between G. lidthi and G. glandarius is 12.3-14.9 in cytb, which is in the same range as the divergence of the outgroup genus Pica (14-16.6%). This underlines (1) that the mt lineages of the two species have split long ago and (2) that the cytb gene clearly has reached saturation for this level of divergence. This obviously is not the case in the CR data set as becomes apparent when comparing the dis-
tances between G. glandarius, G. lidthi, and the outgroup taxa (Table 3). For example, the distances between Pica pica vs. ingroup are twice as high as those found for G. glandarius vs. G. lidthi.
Table 2. Average genetic distances between the four clades of Garrulus glandarius, G. lidthi and the outgroup Pica pica, calculated from cytochrome b sequences. Kimura 2-parameter distances are above diagonal, p-distances below diagonal.
All codon positions considered
Gglagla Gglakry Gglabra Gglajap Glid Ppic
Gglagla 1.0 2.72 5.34 14.24 15.28
Gglakry 0.99 2.04 5.01 14.32 15.54
Gglabra 2.66 2.0 6.08 14.90 16.58
Gglajap 5.09 4.78 5.75 12.34 14.88
Glid 12.57 12.63 13.11 11.09 13.99
Ppic 13.62 13.82 14.64 13.31 12.63
Table 3. Average genetic distances between the four clades of Garrulus glandarius, G. lidthi and the outgroup Pica pica and Pyrrhocorax pyrrhocorax, calculated from Control Region sequences. Kimura 2-parameter distances are above diagonal, p-distances below diagonal
Gglagla Gglakry Gglabra Gglajap Glid Ppyrbra Ppic
Gglagla 2.03 2.79 4.69 18.53 30.48 35.97
Gglakry 1.99 2.62 4.86 18.06 30.69 36.37
Gglabra 2.72 2.56 4.36 18.18 29.26 36.40
Gglajap 4.51 4.66 4.19 18.65 28.67 35.77
Glid 16.34 15.97 16.07 16.42 30.22 33.64
Ppyrbra 25.0 25.14 24.21 23.82 24.85 31.31
Ppic 28.53 28.77 28.8 28.4 27.07 25.59
Which general conclusions can we draw from our data? There is a deep interspecific divergence of the two Palearctic jays, G. glandarius and G. lidthi, which is in the range of differentiation among many bird genera (Moore, DeFilippis 1997). Within G. glandarius there is a subspecific differentiation at the genetic (mt) level with the exception of G. g. iphigenia. The differentiation of G. g. japonicus and G. g. brandtii could be easily explained with a longer lasting (or repeated) isolation of these subspecies during the Pleistocene. Nevertheless, the differentiation is not so pronounced as found for the west-east divergence in other corvid taxa (e.g., P. pica, Corvus corone, C. frugilegus - Haring et al. submitted). Concerning the western subspecies one could interpret the trees at first sight in the following way: G. g. krynicki and G. g. glandarius are differentiated and the hybrid bird (Gggxk) has originated from a cross between a female G. g. krynicki and a male G. g. glandarius. Nevertheless, the sample size is too low to draw such conclusions, especially concerning the differentiation between the G. g. glandarius and G. g. krynicki clades, which appear very closely related. It also has to be taken into consideration that some mem-
bers of both clades come from geographic localities that are rather close compared to the rest of the European samples: Crimea (Gglaiph1, 2) and Rostov Region (Gggxk) in South Eastern Europe and Kislovodsk (Gglakry) in the North Caucasus region, respectively. Without analyzing much bigger samples of the subspecies one cannot rule out the possibility that the differentiation of G. g. glandarius and G. g. krynicki on the basis of mt sequences is just a sampling artifact.
The present data can be regarded as a first survey of the genetic diversity within G. glandarius. Our future aim is to analyze a broader sample covering the whole Palearctic which probably will be possible only with the inclusion of museum specimens into the study. This will enable us to elucidate the phylogeographic history of this species in more detail and to compare it to genetic patterns found in other widespread corvid birds.
Acknowledgements
Authors are grateful for Ya.Red'kin, V.Sotnikov, G.Bahtadse, V.Arhipov, A.Tsvet-kov, N.Kolobaev, M Konovalova, V.Korbut for providing us with the samples from Zoological Museum of the Moscow University. We thank also A.Gamauf (NHM Vienna, Austria), E.Pasquet (MNHN Paris) and W.Neuner (TLF, Innsbruck, Austria) for providing samples. The study was supported by the Program of RAS «Dynamics of genpools».
References
Cibois A., Pasquet E. 1999. Molecular analysis of the phylogeny of 11 genera of the
Corvidae // Ibis 141: 297-306. Edwards S.V., Arctander P., Wilson A.C. 1991. Mitochondrial resolution of deep branch in the genealogical tree for perching birds // Proc. R. Soc. Lond. B. 243: 99107.
Ericson P.G.P., Jansen A.-L., Johansson U.S., Ekman J. 2005. Inter-generic relationships of the crows, jays, magpies and allied groups (Aves: Corvidae) based on nucleotide sequence data // J. Avian Biol. 36: 222-234. Galtier N., Gouy M., Gautier C. 1996. SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecular phylogeny // Comput. Appl. Biosci. 12: 543-548.
Goodwin D. 1986. Crows of the World. 2nd ed. Univ. Washington Press: 1-229. Helm-Bychowski K., Cracraft J. 1993. Recovering phylogenetic signal from DNA sequences: relationships within the Corvine assemblage (class Aves) as inferred from complete sequences of mitochondrial cytochrome-b gene // Mol. Biol. Evol. 10: 1196-1214.
Kocher T.D., Thomas W.R., Meyer A., Edwards S.V., Paablo S., Villablanca F.X. Wilson A.C. 1989. Dynamic of mitochondrial DNA evolution in animals: Amplifications and sequencing with conserved primers // Proc. Natl. Acad. Sci. U.S.A. 86: 6196-6200.
Kryukov A., Iwasa M.A., Kakizawa R., Suzuki H., Pinsker W., Haring E. 2004. Synchronic east-west divergence in azure-winged magpies (Cyanopica cyanus) and magpies (Picapica) // J. Zool. Syst. Evol. Research 42: 342-351.
Kryukov A.P., Suzuki H. 2000. Phylogeography of carrion, hooded and jungle crows (Aves, Corvidae) inferred from partial sequencing of the mitochondrial cytochrome b gene // Rus. J. Genetics 36: 922-929. Kryukov S.A., Kryukov K.A. Original software DNASA for analysing DNA-sequences. In press.
Maniatis T., Fritsch E., Sambrook J. 1982. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, New York: Cold Spring Harbor. Moore W.S., DeFilippis V.R. 1997. The window of taxonomic resolution for phylog-enies based on mitochondrial cytochrome b // Avian molecular evolution and sys-tematics / D.R. Mindell (ed.). London: 83-113. Sibley C.G., Ahlquist J.E. 1985. The phylogeny and classification of the Australo-
Papuan passerine birds // Emu 85: 1-14. Stepanyan L.S. 2003. Conspectus of the ornithological Fauna of Russia and adjacent territories (within the borders of the USSR as a historic region). Moscow: 1-808 (in Rus.).
Streseman E. 1940. Discussion and review of A.Kleiners Systematic Studien uber die
Corviden // Ornithol. Monatsber. 48: 102-104. Swofford D.L. 2002. PAUP* - Phylogenetic Analysis Using Parsimony (*and other
methods). Vers. 4.0b6-10. Sunderland, MA: Sinauer. Vaurie C. 1959. The Birds of Palearctic Fauna: Passeriformes. London: 1-762.
ISSN 0869-4362
Русский орнитологический журнал 2007, Том 16, Экспресс-выпуск 356: 575-576
О втором цикле размножения у северной бормотушки Hippolais caligata в Вологодской области
С. Е. Федотова, Д. А. Шитиков
Кафедра зоологии и экологии, Московский педагогический государственный университет, ул. Кибальчича, д. 6, корп. 5, Москва, 129278, Россия. E-mail: dshitikov@umail.ru
Поступила в редакцию 23 апреля 2007
В 2000-2006 годах мы проводили изучение гнездовой биологии северной бормотушки Hippolais caligata в мозаичных агроландшафтах национального парка «Русский Север» (Кирилловский р-н, Вологодская обл.; 59°76' с.ш., 38°22' в.д.). Результаты этих работ частично опубликованы (Бутьев и др. 2007).
Характерной особенностью гнездовой биологии бормотушки на исследованной территории являются поздние и сжатые сроки всех явлений репродуктивного цикла. В большинстве гнёзд насиживание кладок начинается в середине первой декады июня, а массовый вылет
